ID: 1077386088

View in Genome Browser
Species Human (GRCh38)
Location 11:2270196-2270218
Sequence CGACCGGCCACCGCAGAGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386088_1077386096 9 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1077386088_1077386094 7 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386094 11:2270226-2270248 CGGCTGCAGCGCAACAGTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 48
1077386088_1077386101 27 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386101 11:2270246-2270268 CGGGGACGCGGGTCTCCGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 106
1077386088_1077386097 15 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386088_1077386095 8 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386095 11:2270227-2270249 GGCTGCAGCGCAACAGTTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1077386088_1077386100 26 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386088_1077386098 16 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386098 11:2270235-2270257 CGCAACAGTTCCGGGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386088 Original CRISPR CGACCGGCCACCGCAGAGAC CGG (reversed) Exonic