ID: 1077386089

View in Genome Browser
Species Human (GRCh38)
Location 11:2270206-2270228
Sequence CGGTGGCCGGTCGCCGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386086_1077386089 -10 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386089 11:2270206-2270228 CGGTGGCCGGTCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1077386082_1077386089 1 Left 1077386082 11:2270182-2270204 CCGCTGCGCCGCCTCCGGTCTCT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1077386089 11:2270206-2270228 CGGTGGCCGGTCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1077386080_1077386089 12 Left 1077386080 11:2270171-2270193 CCGCGCTACGGCCGCTGCGCCGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1077386089 11:2270206-2270228 CGGTGGCCGGTCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1077386085_1077386089 -7 Left 1077386085 11:2270190-2270212 CCGCCTCCGGTCTCTGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1077386089 11:2270206-2270228 CGGTGGCCGGTCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386089 Original CRISPR CGGTGGCCGGTCGCCGCCGC CGG Exonic