ID: 1077386090

View in Genome Browser
Species Human (GRCh38)
Location 11:2270212-2270234
Sequence CTGCAGCCGGCGGCGGCGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386090_1077386095 -8 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386095 11:2270227-2270249 GGCTGCAGCGCAACAGTTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1077386090_1077386097 -1 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386090_1077386103 27 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386103 11:2270262-2270284 CGCCGGGCAGCGCAGCCGACAGG 0: 1
1: 0
2: 0
3: 3
4: 105
1077386090_1077386098 0 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386098 11:2270235-2270257 CGCAACAGTTCCGGGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1077386090_1077386100 10 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386090_1077386094 -9 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386094 11:2270226-2270248 CGGCTGCAGCGCAACAGTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 48
1077386090_1077386101 11 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386101 11:2270246-2270268 CGGGGACGCGGGTCTCCGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 106
1077386090_1077386104 28 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386104 11:2270263-2270285 GCCGGGCAGCGCAGCCGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1077386090_1077386096 -7 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386090 Original CRISPR CTGCAGCCGGCGGCGGCGAC CGG (reversed) Exonic