ID: 1077386093

View in Genome Browser
Species Human (GRCh38)
Location 11:2270225-2270247
Sequence CGGAACTGTTGCGCTGCAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386093_1077386103 14 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386103 11:2270262-2270284 CGCCGGGCAGCGCAGCCGACAGG 0: 1
1: 0
2: 0
3: 3
4: 105
1077386093_1077386101 -2 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386101 11:2270246-2270268 CGGGGACGCGGGTCTCCGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 106
1077386093_1077386100 -3 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386093_1077386106 19 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386106 11:2270267-2270289 GGCAGCGCAGCCGACAGGGACGG 0: 1
1: 0
2: 2
3: 20
4: 192
1077386093_1077386108 21 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386108 11:2270269-2270291 CAGCGCAGCCGACAGGGACGGGG 0: 1
1: 0
2: 1
3: 8
4: 122
1077386093_1077386113 30 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386113 11:2270278-2270300 CGACAGGGACGGGGGGCGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 162
1077386093_1077386109 22 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386109 11:2270270-2270292 AGCGCAGCCGACAGGGACGGGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1077386093_1077386104 15 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386104 11:2270263-2270285 GCCGGGCAGCGCAGCCGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1077386093_1077386107 20 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386107 11:2270268-2270290 GCAGCGCAGCCGACAGGGACGGG 0: 1
1: 0
2: 0
3: 10
4: 133
1077386093_1077386110 23 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386110 11:2270271-2270293 GCGCAGCCGACAGGGACGGGGGG 0: 1
1: 0
2: 1
3: 5
4: 94
1077386093_1077386112 29 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386112 11:2270277-2270299 CCGACAGGGACGGGGGGCGCAGG 0: 1
1: 0
2: 2
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386093 Original CRISPR CGGAACTGTTGCGCTGCAGC CGG (reversed) Exonic