ID: 1077386096

View in Genome Browser
Species Human (GRCh38)
Location 11:2270228-2270250
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386085_1077386096 15 Left 1077386085 11:2270190-2270212 CCGCCTCCGGTCTCTGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1077386082_1077386096 23 Left 1077386082 11:2270182-2270204 CCGCTGCGCCGCCTCCGGTCTCT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1077386090_1077386096 -7 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1077386086_1077386096 12 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1077386088_1077386096 9 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type