ID: 1077386097

View in Genome Browser
Species Human (GRCh38)
Location 11:2270234-2270256
Sequence GCGCAACAGTTCCGGGGACG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 30}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386082_1077386097 29 Left 1077386082 11:2270182-2270204 CCGCTGCGCCGCCTCCGGTCTCT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386091_1077386097 -8 Left 1077386091 11:2270219-2270241 CCGCCGCCGGCTGCAGCGCAACA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386086_1077386097 18 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386090_1077386097 -1 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386085_1077386097 21 Left 1077386085 11:2270190-2270212 CCGCCTCCGGTCTCTGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386088_1077386097 15 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386097 Original CRISPR GCGCAACAGTTCCGGGGACG CGG Exonic