ID: 1077386100

View in Genome Browser
Species Human (GRCh38)
Location 11:2270245-2270267
Sequence CCGGGGACGCGGGTCTCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386093_1077386100 -3 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386090_1077386100 10 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386092_1077386100 0 Left 1077386092 11:2270222-2270244 CCGCCGGCTGCAGCGCAACAGTT 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386086_1077386100 29 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386088_1077386100 26 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386091_1077386100 3 Left 1077386091 11:2270219-2270241 CCGCCGCCGGCTGCAGCGCAACA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386100 Original CRISPR CCGGGGACGCGGGTCTCCGC CGG Exonic