ID: 1077386100

View in Genome Browser
Species Human (GRCh38)
Location 11:2270245-2270267
Sequence CCGGGGACGCGGGTCTCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386088_1077386100 26 Left 1077386088 11:2270196-2270218 CCGGTCTCTGCGGTGGCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386086_1077386100 29 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386093_1077386100 -3 Left 1077386093 11:2270225-2270247 CCGGCTGCAGCGCAACAGTTCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386090_1077386100 10 Left 1077386090 11:2270212-2270234 CCGGTCGCCGCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386091_1077386100 3 Left 1077386091 11:2270219-2270241 CCGCCGCCGGCTGCAGCGCAACA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386092_1077386100 0 Left 1077386092 11:2270222-2270244 CCGCCGGCTGCAGCGCAACAGTT 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386100 Original CRISPR CCGGGGACGCGGGTCTCCGC CGG Exonic
900641656 1:3690532-3690554 GCGGGGACGCCGGTCAGCGCCGG - Intronic
901635274 1:10667594-10667616 CCGGGGAAGCGGGCCTCACCTGG + Intronic
907051191 1:51330668-51330690 GCGGGAGCGCGGGTCGCCGCGGG - Intronic
910251321 1:85201343-85201365 CCCGGGGCGCGGGTCCCCGGAGG - Intergenic
910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG + Intergenic
912270052 1:108199941-108199963 CCGAGGAGGTGGGTCGCCGCCGG - Exonic
915333538 1:155127932-155127954 GCGGGGACGCGGGTCTCCTATGG - Exonic
923630999 1:235649623-235649645 CCGGAGCCCCGGGTGTCCGCGGG - Intronic
1064552890 10:16520838-16520860 CCGGGAAGGCGGGTCCGCGCGGG - Exonic
1070257538 10:74825294-74825316 GCGGAGACGCTGGTGTCCGCGGG - Intergenic
1070257675 10:74825680-74825702 CCGGGGACCCGGGTGGCCGGAGG + Intronic
1072021813 10:91410222-91410244 CCGCGGACGCGGCTCCCCACAGG - Intergenic
1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG + Intronic
1075438620 10:122462266-122462288 CCGGGGTGGCGGATTTCCGCGGG + Intronic
1076320824 10:129580215-129580237 CCGGGGGGGCGGGACTGCGCAGG + Intronic
1077367615 11:2167467-2167489 ACGGGGAATCGGGTCGCCGCTGG + Exonic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1083618075 11:64036126-64036148 CCGGGGAGGCGGGTCTCCTCGGG - Intronic
1083667902 11:64285425-64285447 CGGGGGATTCGGGGCTCCGCGGG + Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1089442799 11:118530920-118530942 CCGCGGACCCGGGCGTCCGCGGG + Exonic
1096152456 12:49323203-49323225 CTGGCTACGCGGGCCTCCGCGGG + Intergenic
1096154939 12:49336576-49336598 CCGGGGCCGGGGCTCTCCGCGGG + Exonic
1101371764 12:104137693-104137715 CCGGGGACTCGCGCCGCCGCCGG + Intronic
1104376166 12:128267068-128267090 CCGCGGTCGCGGGGCTCGGCGGG + Intergenic
1104756524 12:131273109-131273131 CCAGGGGGGCCGGTCTCCGCCGG + Intergenic
1104841661 12:131828691-131828713 CCGGAGCCGGGGGTCTCCGCGGG + Intronic
1106308395 13:28532807-28532829 CGGGGGACGCGGGTTCACGCCGG + Intergenic
1107359445 13:39603087-39603109 CCGGGAGTGGGGGTCTCCGCTGG - Exonic
1111951438 13:94712127-94712149 CCGGCCGAGCGGGTCTCCGCGGG - Exonic
1114070253 14:19099626-19099648 TCGGGGCCGCAGGTCACCGCGGG - Intergenic
1114092008 14:19300376-19300398 TCGGGGCCGCAGGTCACCGCGGG + Intergenic
1118220930 14:63853669-63853691 CCGGGGACCCGGGAACCCGCGGG + Intronic
1128161034 15:65422951-65422973 CCGGGGAGGCGCGGCGCCGCGGG + Exonic
1131888622 15:96947920-96947942 CCGAGGACGCGGGCCGGCGCGGG - Intergenic
1132883786 16:2173591-2173613 CCGGGGCCGCCGGCCTCCCCGGG - Intronic
1132996987 16:2828631-2828653 ACGGGGACGCCGGTCTCATCGGG - Intergenic
1133298444 16:4767054-4767076 CCGGAGCGGCGGGTCTCGGCGGG + Exonic
1139954298 16:70685943-70685965 CCGGGGTCGCGGGCCTCCGGCGG + Exonic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142397000 16:89837701-89837723 TCCCGGACTCGGGTCTCCGCAGG + Intronic
1144340014 17:14302856-14302878 GCAAGGACGCGTGTCTCCGCGGG + Intronic
1148207092 17:45785535-45785557 CCCGGGGCTCGGGACTCCGCAGG + Intronic
1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG + Intronic
1152581176 17:81166191-81166213 CTGGCGCCGCGGGGCTCCGCTGG + Intergenic
1152831704 17:82501320-82501342 CCTGGGACCCAGGTCTCCACTGG - Intergenic
1152834413 17:82519963-82519985 CGGGGGCGGCGGGTCCCCGCCGG + Exonic
1154133035 18:11752117-11752139 GCGAGGGCGCCGGTCTCCGCTGG - Intronic
1155053342 18:22166235-22166257 ACGGGGACGCGGGTCCTTGCTGG + Intergenic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1157261009 18:46175117-46175139 CCGGGGACGGGGGTCGGGGCGGG - Intronic
1157556519 18:48616303-48616325 CCCGGGAAGCTGGCCTCCGCTGG - Intronic
1160672608 19:373431-373453 CCGGGGGCAGGGGTCTCAGCAGG + Intronic
1161031386 19:2059423-2059445 CCAGGGACGCCTGCCTCCGCGGG - Intergenic
1161681137 19:5680422-5680444 TCGGGGACTCGGGTCCCCTCCGG + Intronic
1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG + Intergenic
1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG + Intergenic
1167738788 19:51311938-51311960 CCGGGGGCGGGGGGCTCGGCCGG + Intronic
927472356 2:23385716-23385738 CCGGGGTCGCGGGTGGGCGCAGG - Exonic
932330163 2:70894237-70894259 CTGGGGACACTGGTCTCCACTGG + Intergenic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
942799641 2:179861063-179861085 CCGGGGGCGCCGGTCTGGGCTGG + Intronic
947597294 2:231421138-231421160 CCTGGGACTGGGGTCTCCGTAGG - Intergenic
1168943941 20:1735925-1735947 CCGTGGATGTGGGTCGCCGCTGG + Intergenic
1172702662 20:36862816-36862838 CCGGGGAGGCGGGCGGCCGCGGG + Exonic
1175424645 20:58855673-58855695 CCGGGGCCCCGGGACTCCCCTGG + Intronic
1176173874 20:63708515-63708537 CCCGAGACGCGGGGCTCAGCTGG + Intronic
1180063876 21:45403330-45403352 CAGGGGAAGCAGGTCTCTGCAGG - Intergenic
1180064390 21:45405300-45405322 CGGGGGTCGCGGGGCTCGGCCGG + Intronic
1180216306 21:46325283-46325305 CAGGGGACGCGGGGCTAGGCCGG + Intronic
1181082984 22:20426255-20426277 TCGGGGTCCCGGCTCTCCGCTGG + Exonic
1181532097 22:23522680-23522702 CCGGGCGCGGGGGTCTCCCCCGG + Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
952382659 3:32817166-32817188 GCGGGGCCGCAGGTCCCCGCGGG - Intergenic
953349262 3:42202458-42202480 CCGGGGACGCCGGGCACCCCAGG + Exonic
956229637 3:66998739-66998761 CCGGGCTCGCCGGGCTCCGCAGG + Intronic
962247275 3:133806075-133806097 CCGGGGACGCGGGGCTGAGAGGG + Intronic
962876537 3:139539646-139539668 CCGGGGACAGGGGGCTCTGCGGG + Exonic
980043665 4:127965693-127965715 CCGGGGACGCGGAGCTGGGCGGG + Intronic
982460937 4:155667740-155667762 CCGGGGCCGCTGGTCTCCCACGG + Intronic
985896080 5:2750870-2750892 CCTGGGAAGTGCGTCTCCGCCGG - Intronic
990557581 5:56951693-56951715 CCGCGGAGGGGGGGCTCCGCCGG + Intronic
991686891 5:69189694-69189716 CCGGGCAGGCGGGCCACCGCAGG + Exonic
991999115 5:72418011-72418033 CCGTGCCCGTGGGTCTCCGCAGG - Intergenic
992962835 5:81972441-81972463 CCGGGGAAGCGGGTCCCCGCCGG + Intronic
994497846 5:100535750-100535772 GCGGGGCCGCGGGGCTCCGAGGG + Exonic
1001381903 5:171311028-171311050 CCGGGGTCGCTGGGGTCCGCGGG - Intronic
1001959691 5:175872511-175872533 CTGGGGGTGTGGGTCTCCGCGGG + Intronic
1016949664 6:149566991-149567013 CCGAGGCTGCGGGGCTCCGCCGG + Intronic
1017842244 6:158231917-158231939 CCGGGGGCGGGGGTCTCCCGGGG + Intergenic
1019344365 7:522218-522240 CCGGGGAGGGGGGTCCGCGCGGG - Intergenic
1019457538 7:1138253-1138275 CCTGGGGCGCGGGTCCCTGCCGG - Intronic
1022092353 7:27115787-27115809 CCTGGGCCGCGGGCCTCAGCGGG + Intronic
1024579934 7:50793284-50793306 CGGCGGGCGCGGGTCCCCGCGGG + Intronic
1029524659 7:101087581-101087603 CCCGGCACGCAGGTCTCCACAGG - Exonic
1035262617 7:157671462-157671484 CAGGGGACGGGGGTCTGCACAGG + Intronic
1035577305 8:716116-716138 CCAGGGACTTGGGTCTCCGTTGG - Intronic
1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG + Intronic
1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG + Intronic
1056643435 9:88389053-88389075 CCGGGGACGCGGGCCTGCCCTGG + Intronic
1057259740 9:93576924-93576946 CCGGGGGCGCGGGGCTCGGTCGG - Intronic
1057950849 9:99368129-99368151 CTGGGGACTGGGGTCTCTGCTGG + Intergenic
1061851341 9:133417868-133417890 CCGGGGTCTCGGGTGGCCGCCGG - Exonic
1062253284 9:135608842-135608864 CTGGGGACGAGGGGCTCAGCAGG + Intergenic
1185736596 X:2500765-2500787 CCGGGGACCCGGGTGGGCGCGGG - Intronic
1187900908 X:24025754-24025776 GCCGGGACGCGGGGCGCCGCGGG - Intronic
1189473604 X:41333121-41333143 CCGGGACCCCGGCTCTCCGCAGG - Intergenic
1195615637 X:106909761-106909783 CCTGGGACGGGGGTCCCCTCTGG + Intronic
1200128760 X:153830196-153830218 GCGGGGGCGCGGCCCTCCGCGGG - Intronic