ID: 1077389064

View in Genome Browser
Species Human (GRCh38)
Location 11:2291043-2291065
Sequence CTCTGCGAATATACTAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077389064_1077389074 29 Left 1077389064 11:2291043-2291065 CCCGCTTTAGTATATTCGCAGAG No data
Right 1077389074 11:2291095-2291117 ACTCCCCACTTTATTCGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077389064 Original CRISPR CTCTGCGAATATACTAAAGC GGG (reversed) Intergenic
No off target data available for this crispr