ID: 1077389097

View in Genome Browser
Species Human (GRCh38)
Location 11:2291206-2291228
Sequence CTCTGCGAATATACTAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077389097_1077389107 29 Left 1077389097 11:2291206-2291228 CCCGCTTTAGTATATTCGCAGAG No data
Right 1077389107 11:2291258-2291280 ATTCCCCGCTTTATTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077389097 Original CRISPR CTCTGCGAATATACTAAAGC GGG (reversed) Intergenic
No off target data available for this crispr