ID: 1077390695

View in Genome Browser
Species Human (GRCh38)
Location 11:2299490-2299512
Sequence GGACACAGCTTTCCAGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077390688_1077390695 -7 Left 1077390688 11:2299474-2299496 CCACCTCCTGGCCCGAGGACACA 0: 1
1: 0
2: 1
3: 27
4: 263
Right 1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 279
1077390685_1077390695 17 Left 1077390685 11:2299450-2299472 CCTGTCTCAGGAAGGTAGAGGCT 0: 1
1: 0
2: 0
3: 26
4: 199
Right 1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 279
1077390689_1077390695 -10 Left 1077390689 11:2299477-2299499 CCTCCTGGCCCGAGGACACAGCT 0: 1
1: 0
2: 3
3: 37
4: 192
Right 1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 279
1077390684_1077390695 18 Left 1077390684 11:2299449-2299471 CCCTGTCTCAGGAAGGTAGAGGC 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077390695 Original CRISPR GGACACAGCTTTCCAGAGGA GGG Exonic
900482480 1:2905787-2905809 GGCCACGGCTTTTCAGAGGCAGG - Intergenic
900895707 1:5481507-5481529 GGCCACAGCTCTCCTGGGGATGG + Intergenic
901134621 1:6984936-6984958 GGACCCTGCTTCCCAGAGAAAGG + Intronic
902049293 1:13549246-13549268 GGCGACAGCTGTCCAGAGGGTGG + Intergenic
902539726 1:17145632-17145654 GGGGAAAGCCTTCCAGAGGAGGG - Intergenic
902671579 1:17978220-17978242 ACACACAGCTTTCTAGTGGATGG + Intergenic
902828243 1:18992212-18992234 GGAGAAAGCTTTCAAGAGGGTGG - Intergenic
903147085 1:21381262-21381284 AGCCACAGCTTCTCAGAGGAGGG - Intergenic
903569205 1:24291909-24291931 GGAGAAGGCTTTCTAGAGGAAGG - Intergenic
903866780 1:26405010-26405032 GGACAGAGCTTTTCAAAGCATGG - Intergenic
903967967 1:27101692-27101714 GGATACAGATTCCCAGAGGAAGG + Intronic
904015449 1:27416522-27416544 GCACACAGGTTTCCAGTGGGTGG - Intronic
905236858 1:36555974-36555996 GGATATAGCTTCCCAAAGGAGGG - Intergenic
905697057 1:39982281-39982303 GGAGATAGCTTTCAAGATGAAGG - Intergenic
906240321 1:44238673-44238695 GGGCCCATCTTACCAGAGGAAGG - Intronic
907525091 1:55049452-55049474 CCACAGAGCTTTCCAGAGGCTGG + Intronic
907671283 1:56477043-56477065 GGACAGAGCTTTCTTGAGGCTGG - Intergenic
907870603 1:58439185-58439207 GGAGAGAGCTTTCCAGACAAAGG - Intronic
908087379 1:60650592-60650614 GCACAGAGCTTCCCAGAGGAGGG + Intergenic
908469393 1:64428243-64428265 GGAAACAGCTCCCGAGAGGATGG + Intergenic
909492254 1:76238650-76238672 GGAACCAGCTTTGGAGAGGAGGG + Intronic
909499067 1:76312876-76312898 GAACAGAGCTTTCCAGAGAGAGG - Intronic
910080258 1:83333399-83333421 GGGCACAGCTTTCTAGATGGAGG - Intergenic
910197739 1:84661387-84661409 GGAGAAAGCATTCCAGAGAATGG - Intronic
912476976 1:109944641-109944663 CAACACAGCTTTCTAGAGGAAGG - Intergenic
913423460 1:118699387-118699409 GGACACAGCTTTCTCCAGCAGGG - Intergenic
915229042 1:154432311-154432333 TGACAGAGCTTTCCACAGGCTGG - Intronic
917169930 1:172160614-172160636 GGAAAAGGCATTCCAGAGGAAGG - Intronic
917586994 1:176437298-176437320 AGAAACAGCTTTCCAGAGGAAGG - Intergenic
918121872 1:181547369-181547391 GGATAGAGGATTCCAGAGGAGGG - Intronic
918570524 1:185986384-185986406 AGTCTCATCTTTCCAGAGGATGG + Intronic
922585963 1:226735781-226735803 GGACAAGCCTTTCCTGAGGAAGG - Exonic
923105079 1:230848138-230848160 GGCAACAGCTCTTCAGAGGAGGG + Intronic
1062885356 10:1011875-1011897 GGGCACAGCTGTGCGGAGGAGGG - Intronic
1063951961 10:11231742-11231764 GGAGACAGCTTTCCAAACAACGG + Intronic
1064791250 10:18959742-18959764 GGACACAGTTTTCTAGCGCACGG - Intergenic
1064869483 10:19921431-19921453 TGTCATAGCTTTCCAGAAGAAGG - Intronic
1065797168 10:29318530-29318552 GGCCTTATCTTTCCAGAGGAAGG + Intergenic
1065945987 10:30605803-30605825 GGCCTTATCTTTCCAGAGGAAGG - Intergenic
1067475483 10:46562578-46562600 GGACAGAGCTAGCCCGAGGAAGG + Intergenic
1067619253 10:47779185-47779207 GGACAGAGCTAGCCCGAGGAAGG - Intergenic
1067748839 10:48956853-48956875 GAACTCAGATTTCCATAGGAGGG + Intronic
1068122989 10:52803781-52803803 GGCAACAGCTTTCCAGGTGAAGG - Intergenic
1069047708 10:63760833-63760855 GGACACAGTGTTCCAGAGTCAGG - Intergenic
1069232186 10:66024505-66024527 GTACACATCTTTACAGAGAATGG - Intronic
1070047434 10:72852724-72852746 AGACAGAGGTTTACAGAGGAAGG + Intronic
1071468124 10:85959303-85959325 GGCCAAAGTTTCCCAGAGGAGGG - Intronic
1073964530 10:108973552-108973574 GGGTACAGCTTTCCAGAGCAGGG + Intergenic
1074899905 10:117807010-117807032 GGACATAGCTATGCAGAGAAGGG - Intergenic
1075256730 10:120931190-120931212 CTAACCAGCTTTCCAGAGGAGGG + Intergenic
1075796998 10:125127740-125127762 GGAAACAGCTTGCCACAGGGAGG - Intronic
1076069994 10:127481790-127481812 GGGCACAGCTTTGCAGAAAATGG - Intergenic
1077035394 11:491934-491956 GGACACAGGATTCCTGGGGAGGG + Intergenic
1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG + Exonic
1077461372 11:2712421-2712443 CCCCACAGCTTTCCAGGGGATGG - Intronic
1078850709 11:15160450-15160472 GCACACAGCTATCAAGAGGAGGG + Intronic
1080272324 11:30463598-30463620 GGAGACAGCATGCCTGAGGATGG + Intronic
1080977233 11:37357348-37357370 GGACAAAGCTTGCCAGAGGAAGG + Intergenic
1082241195 11:49872771-49872793 GAACAAAGCTTTGAAGAGGAAGG - Intergenic
1082831550 11:57622285-57622307 TGGCACAGACTTCCAGAGGATGG - Intergenic
1083654109 11:64220744-64220766 GTACGTAGCTTTCCTGAGGAAGG - Intronic
1087551780 11:99659665-99659687 AGACTGAGGTTTCCAGAGGAAGG - Intronic
1088263039 11:107962868-107962890 GGACAAACATTTCCAGAGAATGG - Exonic
1088294384 11:108276723-108276745 GGACGAACCTTCCCAGAGGAAGG - Intronic
1091347319 11:134864154-134864176 GAACACACCTTTCCAGAGATCGG + Intergenic
1091743478 12:2976470-2976492 GGAAACAGGTACCCAGAGGAAGG - Intronic
1092118497 12:6026466-6026488 GGACTCACCTTCCCAGAGGCAGG - Intronic
1092936286 12:13367139-13367161 GGACACAGTTTTCTAGAACACGG - Intergenic
1092981188 12:13796097-13796119 AGAAACAGCTTTCCAGTGTATGG + Intronic
1093608546 12:21125207-21125229 GGAGAAGGCTTTCCAAAGGATGG - Intronic
1093656417 12:21699735-21699757 TGACACAGATTTCCAAAGGCAGG + Intronic
1096555386 12:52400595-52400617 GGACACAGCCTTCCTGATGAAGG - Exonic
1096807893 12:54151446-54151468 TGACCCAGCTTCCTAGAGGAGGG + Intergenic
1101653256 12:106696383-106696405 GGAGATAGCTTTGTAGAGGATGG - Exonic
1103059905 12:117850188-117850210 TCACACAGCTTTTCAGAGGTAGG + Intronic
1103741144 12:123092404-123092426 TGGCAATGCTTTCCAGAGGATGG - Intronic
1105485170 13:20822189-20822211 GGACCCATCTTCCCAGATGAAGG - Exonic
1105675739 13:22670033-22670055 GCACCCAGCGTCCCAGAGGAGGG - Intergenic
1106166858 13:27255005-27255027 GAACACAGCTTTCACTAGGAGGG - Intronic
1111907333 13:94270867-94270889 GCCCACAGCTTTCAAGATGAGGG + Intronic
1112236333 13:97641245-97641267 ACAGAAAGCTTTCCAGAGGAGGG - Intergenic
1112370633 13:98790032-98790054 CTACAGAGCTTTCCACAGGATGG + Intergenic
1112749567 13:102568121-102568143 GAACACAGCTGCCCAGTGGAGGG + Intergenic
1112898783 13:104334821-104334843 TGACACAGCCTTGGAGAGGAAGG + Intergenic
1113127013 13:106990491-106990513 GGACAGACTTTTCCAGACGAAGG + Intergenic
1113131434 13:107041975-107041997 GGATGAAGCTTCCCAGAGGAAGG - Intergenic
1117902052 14:60544482-60544504 GGAGACATCTTTAGAGAGGAGGG - Intergenic
1119029109 14:71177512-71177534 GGCCACAGCTCTCCACAGGAAGG - Intergenic
1119030461 14:71188316-71188338 GCACACTGCTCTGCAGAGGAAGG - Intergenic
1119770772 14:77219517-77219539 CCACGCAGCTTTCCGGAGGAAGG - Exonic
1121426728 14:93857576-93857598 GGGCTCAGCTTTCCAGAAGCAGG + Intergenic
1124798008 15:32801400-32801422 GTACACAGACTCCCAGAGGATGG + Intronic
1124830748 15:33146803-33146825 GCTCACAGCTATCAAGAGGAAGG + Intronic
1127710824 15:61596201-61596223 GGCCGCATCTTTGCAGAGGAAGG + Intergenic
1128357850 15:66941068-66941090 GGAGAGGGCTTTCCAGGGGAAGG - Intergenic
1128549725 15:68590435-68590457 GGAGACAGCCTCCGAGAGGATGG + Intronic
1128693723 15:69744732-69744754 AGACACAGCTGTTGAGAGGAAGG - Intergenic
1131119973 15:89815888-89815910 GGATACAGCTTTCTTGAGGCTGG + Intergenic
1132054872 15:98643286-98643308 TCACACAGCTTTGCAGAGTAGGG + Intergenic
1133483353 16:6193803-6193825 GAACAGAGCTTTCAAAAGGAAGG - Intronic
1133734946 16:8607804-8607826 GGACAAAACTGTCCAAAGGATGG + Intergenic
1134165805 16:11928428-11928450 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1134494917 16:14725312-14725334 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1134500300 16:14764432-14764454 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1134526842 16:14951044-14951066 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1134545564 16:15105304-15105326 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1134580279 16:15364618-15364640 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1134674964 16:16083765-16083787 GTCCACAGCTTTCCAAAGGGGGG + Intronic
1134714419 16:16349521-16349543 AAACAGAGGTTTCCAGAGGAAGG - Intergenic
1134722294 16:16392885-16392907 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1134945133 16:18318984-18319006 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1134952397 16:18359137-18359159 AAACAGAGGTTTCCAGAGGAAGG + Intergenic
1135311198 16:21405842-21405864 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1135364150 16:21838293-21838315 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1135447692 16:22533055-22533077 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1135776085 16:25258199-25258221 GGACACGGCGTTCCGGTGGAGGG + Intergenic
1136150352 16:28343737-28343759 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1136166589 16:28457575-28457597 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1136196386 16:28657457-28657479 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1136212726 16:28771582-28771604 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1136257448 16:29051501-29051523 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1136307902 16:29384838-29384860 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1136321318 16:29486382-29486404 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1136435998 16:30226352-30226374 AAACAGAGGTTTCCAGAGGAAGG + Intronic
1137274196 16:46922778-46922800 GGACACAGGTTGGCAGAGGCGGG - Intronic
1137959672 16:52869645-52869667 GGTTACAGCTTTATAGAGGAGGG - Intergenic
1138277261 16:55744104-55744126 AGACACACCTTTGCACAGGAAGG + Intergenic
1138285788 16:55809325-55809347 TGACACACCTTTGCACAGGAAGG - Intronic
1139237384 16:65354527-65354549 GGAAAATGCTTTCCAGAGGAAGG - Intergenic
1139433711 16:66924781-66924803 GGACCCAGCTGTTCAGGGGAGGG - Intronic
1139855593 16:69977271-69977293 AAACAGAGGTTTCCAGAGGAAGG + Intergenic
1140367140 16:74390820-74390842 AAACAGAGGTTTCCAGAGGAAGG - Intronic
1140777142 16:78260104-78260126 GGACAGAGACTCCCAGAGGAAGG + Intronic
1143170868 17:4929509-4929531 AGAAAAGGCTTTCCAGAGGAAGG + Intergenic
1144581347 17:16461171-16461193 GGAAACACCTTTCCAGAGCAAGG + Intronic
1144776512 17:17787665-17787687 GGATACAGCTATCAAGAGGCCGG - Intronic
1145252527 17:21304347-21304369 GGGCACAGCTATGCAGAGCATGG + Intronic
1145371056 17:22306183-22306205 TAACACAGGTTTTCAGAGGATGG + Intergenic
1147539263 17:41343347-41343369 GGAAAGAGCTTTCCAGAGAGAGG - Intergenic
1148566371 17:48635353-48635375 GGCCCCAGCTCTCCAGAGGTGGG + Intergenic
1149451716 17:56754824-56754846 GGACAAAGGTCTCCAGAGGAAGG - Intergenic
1151319215 17:73342647-73342669 GGCCCCAGCTTTGCAGAGGAAGG + Intronic
1153903065 18:9636194-9636216 AGACTCAGCTTTTAAGAGGAAGG + Intergenic
1154117064 18:11620459-11620481 AAACAGAGGTTTCCAGAGGAAGG + Intergenic
1154147303 18:11876912-11876934 GAACACAGCGTTCCAGGGAATGG + Intronic
1158076904 18:53541200-53541222 GAACGCAGATTTCCAAAGGATGG + Intergenic
1158288897 18:55916882-55916904 GGACACAGCTGGTCAGAGGGTGG + Intergenic
1160572208 18:79825967-79825989 GGACACAGCGTTTCAAAGAAAGG - Intergenic
1161043787 19:2123762-2123784 GGCCACACCTTTCCACAGGCGGG - Intronic
1161474189 19:4475091-4475113 GGGCACAGCTTTGCAGTGAAGGG + Intronic
1161583364 19:5092497-5092519 GGACACATCTCCCCAGAGGAGGG + Intronic
1161703475 19:5806829-5806851 GGAGACAGCTTTCAAGAGCTGGG + Intergenic
1161953566 19:7480746-7480768 GGACACAGCCTGCCTGAGGCTGG + Intronic
1162056252 19:8065878-8065900 GGCCCCAGCTGTCCAGAGAAGGG - Exonic
1163779916 19:19240649-19240671 GGAGAGAGATTTCCAGTGGACGG + Exonic
1164743606 19:30594882-30594904 GGACAGAGGTTTCCAGGAGAGGG - Intronic
1166784408 19:45359103-45359125 GGACAGAGGTGCCCAGAGGAGGG + Intronic
1167136428 19:47618871-47618893 GGAGCCACCTTTCCAGAGGCTGG + Intronic
1167412864 19:49355383-49355405 GGACAAGGCTTTCCAGACAATGG - Exonic
925178397 2:1800578-1800600 GGACACAGTTTTCCCAAGGATGG - Intronic
925184215 2:1836105-1836127 GCATACAGCTTTCCAGAGAAGGG + Intronic
927704144 2:25286666-25286688 GGACAAAACCATCCAGAGGAAGG + Intronic
927955627 2:27205469-27205491 GAACACATCTGTCCAGATGACGG + Exonic
928108341 2:28487478-28487500 GGACACGGCTCTCCAGAGAGTGG - Intronic
928424068 2:31163633-31163655 GGACCCAGTTTTCCAGAGGCTGG + Intergenic
929002789 2:37364571-37364593 GGAAACAGGTTTGCAGAGGCAGG + Intronic
929608718 2:43253940-43253962 GGGGACAGCTATCCAAAGGAGGG - Intronic
929907413 2:46058321-46058343 TGTCCCAGCTTTCCAGAGGCTGG - Intronic
929910204 2:46083370-46083392 GGACACAGTTTTTAAGAGTAGGG - Intronic
930016530 2:46974692-46974714 GGATACTGCGTTACAGAGGAGGG + Intronic
933074592 2:77907268-77907290 TGAAACAGCTTTCCACAGAAAGG - Intergenic
936041884 2:109156050-109156072 GGACCCAGCTTCCCAAAGTACGG - Intronic
937261475 2:120589044-120589066 GGACAGGGGTTACCAGAGGAGGG + Intergenic
937520916 2:122711709-122711731 AGACAGAGCTTCCAAGAGGAGGG + Intergenic
937681892 2:124652855-124652877 GGTCACAGCTTTACTGAAGAGGG - Intronic
941254337 2:163209263-163209285 GAACACAGCTGACCAGATGAGGG + Intergenic
946361293 2:219220670-219220692 GGTAACAGCTTTTCAGGGGAAGG - Intronic
946820014 2:223619759-223619781 GGACGCATTTTTCCAGAGGATGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947810514 2:233001097-233001119 GGCCACAGCTGACCAGAGCAGGG + Intronic
948377657 2:237532312-237532334 AGTCACAGCTTTCCCGACGAGGG + Intronic
948919839 2:241059254-241059276 TGACACAGCTGTTCTGAGGAAGG - Intronic
1169052921 20:2595746-2595768 GGTCACAGCCTCCCAGAAGAGGG + Intronic
1169523193 20:6394793-6394815 GGAAAGTGATTTCCAGAGGATGG + Intergenic
1171333275 20:24359972-24359994 AGAGACAGCTTTTCAGAGAATGG + Intergenic
1172132374 20:32664359-32664381 CCACACAGGTTTCCAGAGAAGGG + Intergenic
1173049959 20:39549864-39549886 GCACCCAGCTCCCCAGAGGAGGG + Intergenic
1173554605 20:43956674-43956696 AGACACAGCTAGCCAGAGGCAGG - Intronic
1173579602 20:44137627-44137649 GGATGCAGTTGTCCAGAGGAAGG - Intronic
1173834190 20:46114406-46114428 AGAGAGAGATTTCCAGAGGAGGG + Intergenic
1174723139 20:52834899-52834921 GGAGACAGTTTTCCAGATGGGGG - Intergenic
1175265203 20:57698750-57698772 CGGAACAGCTTTCCAGAAGAAGG - Intronic
1176335455 21:5593788-5593810 GGCCACAGTTTTTCAGATGATGG - Intergenic
1176392302 21:6227160-6227182 GGCCACAGTTTTTCAGATGATGG + Intergenic
1176469117 21:7089014-7089036 GGCCACAGTTTTTCAGATGATGG - Intergenic
1176492678 21:7470792-7470814 GGCCACAGTTTTTCAGATGATGG - Intergenic
1176507964 21:7667591-7667613 GGCCACAGTTTTTCAGATGATGG + Intergenic
1177897171 21:26867356-26867378 GGACTCAGCCTTCCACAGTAAGG - Intergenic
1180612433 22:17106667-17106689 GGAAACAGCTTCCCAGATGACGG - Intronic
1181854460 22:25772219-25772241 GCACATAGCTCTCAAGAGGAGGG + Intronic
1182952403 22:34390176-34390198 GGACAAAACTTCCAAGAGGAAGG - Intergenic
1183015121 22:34979824-34979846 GGACACAGTGTTCCTGATGAAGG - Intergenic
1183271705 22:36866345-36866367 GGAGAAAGCTTAACAGAGGAAGG - Intronic
1183736605 22:39648125-39648147 GGACAGGGCTTTCCAGAGCAGGG - Intronic
1183747448 22:39699741-39699763 TGACACAGCAGGCCAGAGGACGG - Intergenic
1184286995 22:43477469-43477491 GGACCCAGCCTCCCAGGGGAGGG - Intronic
1184745121 22:46451624-46451646 GGACACAGCCTTTCAGAAGAGGG + Intronic
1184825224 22:46946091-46946113 GTACACAGCTTTCCAAAGGGAGG + Intronic
950109287 3:10408232-10408254 GCACACAGCCTTCCAGAGACTGG - Intronic
950515151 3:13460281-13460303 GGACACAGTCTCACAGAGGAGGG + Intergenic
950898819 3:16478128-16478150 GGGGACAATTTTCCAGAGGAAGG - Intronic
951057577 3:18165124-18165146 GGAGACAGCATTCGATAGGAAGG + Intronic
952814648 3:37436630-37436652 GGACACAACTTTCCCGGTGAGGG - Intergenic
954578960 3:51692761-51692783 AGCCACAGCCTTCCAGATGATGG - Intronic
954865443 3:53725289-53725311 GGACGCAGCGTTTCAAAGGAGGG - Intronic
955115519 3:55995733-55995755 AGTCACAACTTTTCAGAGGATGG + Intronic
956536405 3:70281751-70281773 AGAGAAAGCTTTGCAGAGGATGG - Intergenic
956699999 3:71950537-71950559 GGCCACAGCAGCCCAGAGGAAGG + Intergenic
957472492 3:80677498-80677520 AGACACTGCTTTCCAGAGAGAGG - Intergenic
958547287 3:95570526-95570548 GGACAATACTTTCCACAGGAAGG - Intergenic
958899781 3:99872132-99872154 AGACACAGCTATGCAGAGGTAGG - Intronic
959826673 3:110805586-110805608 GGACACATGTTTCCAGAGACTGG + Intergenic
961487801 3:127229397-127229419 GGTCACAGCTGTCCTGGGGAGGG - Intergenic
961958401 3:130827984-130828006 TGACAAAGCTTGCCAGAAGATGG + Intergenic
962346136 3:134620187-134620209 GCCCACAGCTCTCCACAGGATGG - Intronic
966034785 3:175398417-175398439 GGATACAGATTAGCAGAGGAGGG - Intronic
967829046 3:193903138-193903160 GGACACAGTTTTCAACATGATGG + Intergenic
967888501 3:194348332-194348354 GGACACAACTGGGCAGAGGATGG - Intronic
968713467 4:2137679-2137701 GAACACTGCTTTCCCGAGGCTGG + Intronic
969513931 4:7636074-7636096 GAGCACAGCTTTCCTGGGGAGGG - Intronic
969519372 4:7666924-7666946 GAAGACAACTTCCCAGAGGAGGG + Intronic
969957711 4:10909017-10909039 GGACACAGATTTTCAGACCATGG - Intergenic
970056070 4:11973241-11973263 GGACACATCCTTCCTGTGGATGG - Intergenic
970360374 4:15303373-15303395 GAACAAGGCTTCCCAGAGGAAGG + Intergenic
975214705 4:71739502-71739524 GGACCCAGGTTTTCAGATGAAGG + Intergenic
977557634 4:98500970-98500992 GGACTCAGCTTTTCAGAGGAGGG - Intronic
980150108 4:129035700-129035722 TCTCATAGCTTTCCAGAGGAAGG - Intronic
980511426 4:133793505-133793527 GGAAACAGATCTCCAGAGAAAGG + Intergenic
984951242 4:185009314-185009336 GGACACATCTTTGCAGTGGGGGG - Intergenic
986298844 5:6462354-6462376 GCATTCAGCTTTCCAGTGGACGG + Intronic
986978953 5:13424066-13424088 CTTCACAGCTTTCCACAGGATGG - Intergenic
987964375 5:24852890-24852912 GAACACAACTTTTCTGAGGAGGG + Intergenic
990169886 5:53036349-53036371 GGCCTCAGCTTTCCAGCTGAGGG - Intronic
994125049 5:96159506-96159528 GGACACTGCTTTCCTCAAGATGG - Intergenic
995337903 5:111023600-111023622 TGAAACATCATTCCAGAGGAAGG - Intergenic
997280721 5:132643061-132643083 GGTCAGAGCTTTCCAAAGGTGGG - Exonic
1000024374 5:157346159-157346181 GCCCACAGCTTTACAGATGATGG - Intronic
1001582177 5:172806320-172806342 CCACACAGCTTCCCAGAGGCTGG - Intergenic
1002569179 5:180130314-180130336 GGACACAGCCTTCCTGAGAGGGG - Intronic
1004088437 6:12474348-12474370 GGACACAGCTTGTCAGAGAAGGG + Intergenic
1010367261 6:75065749-75065771 GGACACAGCTAGCCAGAGAGGGG + Intergenic
1011167398 6:84464382-84464404 CAAAAAAGCTTTCCAGAGGAGGG - Intergenic
1012415231 6:99005795-99005817 AGAAACAGCTTCACAGAGGAGGG - Intergenic
1013279815 6:108625596-108625618 CAACACAGCTTCCCAGAGCAAGG - Intronic
1017047610 6:150362052-150362074 GGACAAGACTTTCCTGAGGAAGG + Intergenic
1017317271 6:153046166-153046188 GGACATAGCATACCAGAGGCTGG + Intronic
1018173976 6:161163524-161163546 GGCCACAGCTCTCCAGTAGATGG + Intronic
1018284032 6:162218093-162218115 AGCCACAGCCCTCCAGAGGAAGG + Intronic
1018915387 6:168129606-168129628 GAAGACAGCGTTCCAGAGGCCGG + Intergenic
1022439931 7:30424865-30424887 GTACTCAGCCTTCTAGAGGAGGG + Exonic
1023042049 7:36180713-36180735 GGAACCAGCTTCCCAGAGGAAGG - Intronic
1023044492 7:36199270-36199292 TGACACAGTTTTCCAGGGTAGGG + Intronic
1023122392 7:36923003-36923025 AGACACAGCCTTCCAGACGAGGG - Intronic
1024157255 7:46638261-46638283 GGATGCAGGTTTCCAGAGGAAGG - Intergenic
1024273196 7:47657722-47657744 GTACACAGGCCTCCAGAGGAGGG - Intronic
1024476097 7:49813156-49813178 GGATTCAGCTTCCCAGAAGATGG + Intronic
1025152827 7:56573794-56573816 GGACTCAGCATTGCTGAGGATGG + Intergenic
1025790695 7:64684490-64684512 GGACACAGCTTTACTCTGGAAGG - Intronic
1026540730 7:71277724-71277746 GTAGACAGCTGTCCAGAGGAGGG + Intronic
1027298030 7:76798663-76798685 GGGCACAGCTTTCTAGATGGAGG - Intergenic
1028598673 7:92575860-92575882 GGACACAGCATTACAGAACAAGG + Intronic
1030922710 7:115412067-115412089 AGTCACATCTTTCCACAGGAAGG - Intergenic
1031552903 7:123136871-123136893 GGAAACAGCATTCCAGACGGAGG + Intronic
1032447322 7:131995584-131995606 GGACACAGCTTATCTGAGGCAGG - Intergenic
1033732856 7:144195714-144195736 GGACACACCTTCCCGGAGGAGGG + Intergenic
1033743706 7:144294294-144294316 GGACACACCTTCCCGGAGGAGGG + Intergenic
1033750195 7:144355303-144355325 GGACACACCTTCCCGGAGGAGGG - Intronic
1034937988 7:155212010-155212032 GCACACAGCTGGCCAGAGGCTGG - Intergenic
1037496467 8:19445798-19445820 ACACACACCTTTCCAGTGGATGG - Intronic
1038610577 8:29057012-29057034 GGACACAGCTGTCCAGACCAGGG - Intronic
1039472005 8:37819225-37819247 GGGCCAGGCTTTCCAGAGGAGGG + Intronic
1039475023 8:37835236-37835258 CTGCACAGCCTTCCAGAGGAGGG + Exonic
1044327516 8:90876219-90876241 GGACACAGCAGTCTGGAGGAGGG - Intronic
1044790638 8:95843423-95843445 GGTCACTGCTCTTCAGAGGAAGG + Intergenic
1044891904 8:96845051-96845073 GGAAACAGCATTCCAGACAAAGG - Intronic
1047021910 8:120784532-120784554 GGACACAGCTGTCCGGACAAAGG + Intronic
1047281115 8:123446528-123446550 GGAAAAAGCTCTCCAGAGGGAGG - Intronic
1048551058 8:135433834-135433856 GAACAAAGCTCTCCAGAGCATGG + Intergenic
1048642204 8:136376242-136376264 GGACAAGGCTTCACAGAGGAGGG - Intergenic
1049385243 8:142339866-142339888 CGGCGCAGCTGTCCAGAGGAGGG - Intronic
1052104438 9:24495196-24495218 GAACACAGCATTCCAGGGTAAGG - Intergenic
1056737966 9:89225923-89225945 GGTCACCATTTTCCAGAGGAAGG + Intergenic
1057054774 9:91951657-91951679 GGACACAGCATTGCTGAGGGAGG - Intergenic
1057185429 9:93055020-93055042 TGCCAGAGGTTTCCAGAGGAAGG - Intergenic
1057477145 9:95412272-95412294 GGACACAGCTGTCCTGGGGAAGG + Intergenic
1057583512 9:96308799-96308821 GTACACAGCTTCCCAGGGGAAGG + Intergenic
1058331187 9:103762763-103762785 TTACACAGCTTTCAAGAGGTAGG - Intergenic
1058697791 9:107574418-107574440 TCTCAAAGCTTTCCAGAGGAGGG + Intergenic
1060228838 9:121812543-121812565 GGACTCAGTTTTCCAGGTGATGG + Intergenic
1060857387 9:126925797-126925819 AGAGACAGCTTACCAGAGGAAGG + Intronic
1061946241 9:133909678-133909700 GGAGACAGCCTTACAGAAGATGG + Intronic
1062595373 9:137296751-137296773 GGACACAGCAGGCCAGAGGAGGG - Intergenic
1203426181 Un_GL000195v1:41114-41136 GGCCACAGTTTTTCAGATGATGG + Intergenic
1185774499 X:2791717-2791739 AGGCACAGCTTTCCAGACTAGGG - Intronic
1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG + Intronic
1186573264 X:10738225-10738247 GGGCTCAGGTTTCCAGAAGAAGG + Intronic
1186682192 X:11886857-11886879 GGAGAGAGCATTCCAGAGAAAGG - Intergenic
1186883829 X:13892754-13892776 GCAAAGAGCTTTTCAGAGGAGGG - Intronic
1190341368 X:49299368-49299390 GGACGAAGCTTCCCAGAGGAAGG - Intronic
1190600698 X:52089316-52089338 GGACAGAGCTTCCAAGGGGAGGG - Intergenic
1190654159 X:52596516-52596538 GGACACAATTTTCCCCAGGAGGG - Intergenic
1193015876 X:76733424-76733446 GGACACAGCTCCCAAGGGGAGGG - Intergenic
1193369541 X:80677947-80677969 GGAAAGAACATTCCAGAGGAGGG + Intronic
1194635581 X:96342331-96342353 GGACAGAGCTCTCAGGAGGAGGG - Intergenic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1197834396 X:130679113-130679135 AGAGATAGCTTTCCAGAGGAGGG + Intronic
1198648767 X:138838105-138838127 GGACAAAGCTTTCTGGGGGAAGG - Intronic
1201738342 Y:17296109-17296131 GGACACAGCTTGACAAAGGTTGG - Intergenic