ID: 1077392142

View in Genome Browser
Species Human (GRCh38)
Location 11:2305035-2305057
Sequence GACCACTCTGGGGGTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077392136_1077392142 -2 Left 1077392136 11:2305014-2305036 CCTGTTTAGCCTGTGAAGCTGGA 0: 1
1: 0
2: 0
3: 10
4: 184
Right 1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG 0: 1
1: 0
2: 2
3: 18
4: 227
1077392134_1077392142 -1 Left 1077392134 11:2305013-2305035 CCCTGTTTAGCCTGTGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG 0: 1
1: 0
2: 2
3: 18
4: 227
1077392132_1077392142 30 Left 1077392132 11:2304982-2305004 CCATGAGGAGCTTGTGCTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 344
Right 1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG 0: 1
1: 0
2: 2
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077392142 Original CRISPR GACCACTCTGGGGGTCCCTG AGG Intronic
900648866 1:3721353-3721375 GGCCACTCTGGGGGCCCCTCTGG - Intronic
900661684 1:3787829-3787851 GAGCACTCTGTGTGTCACTGCGG - Intronic
901670926 1:10856124-10856146 GCCCAGGCTGGGGGTCCCAGGGG - Intergenic
901815109 1:11789356-11789378 GTCCACTCTCGGGGCCCTTGGGG - Exonic
902090849 1:13902060-13902082 GACCACCCCGGGGCTGCCTGGGG - Intergenic
903168955 1:21540399-21540421 AGCTTCTCTGGGGGTCCCTGAGG - Intronic
903540816 1:24095258-24095280 GACAGCTCTGGGGTACCCTGCGG + Intronic
904050360 1:27634799-27634821 GACCTTTTTGGGGGTCCCTTTGG + Intronic
904297216 1:29527822-29527844 CACCTCGCTGGGAGTCCCTGGGG + Intergenic
904834109 1:33323936-33323958 GCCCACCCTGGGAGTCCCAGTGG - Exonic
904964140 1:34358676-34358698 GACCACTGTAGGGGCCCCTGTGG + Intergenic
905894347 1:41535351-41535373 CACCATGATGGGGGTCCCTGGGG + Intronic
906299308 1:44670565-44670587 GACCACCATGGTGGGCCCTGTGG - Intronic
907290895 1:53412321-53412343 TCCCTCTGTGGGGGTCCCTGTGG + Intergenic
909825302 1:80119952-80119974 GGACACTCTGGGGGATCCTGAGG - Intergenic
915650532 1:157307328-157307350 GAAAACTCTGGGTGTCCCTGTGG - Intergenic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
915721571 1:157989685-157989707 CACCATTCTGGAGCTCCCTGAGG - Intergenic
920035178 1:203060790-203060812 GACTGCTCTGTGGGCCCCTGGGG + Intronic
920836959 1:209519948-209519970 TACAATTCTGGGGGTCCCAGTGG - Intergenic
921222088 1:212980518-212980540 GGACACCCTGGGGGTCCCAGAGG + Intronic
922030233 1:221790504-221790526 GACCACGCTGTGGGCCCCTCAGG + Intergenic
922555220 1:226527566-226527588 GACCACTCCTGGGGGCACTGCGG + Intergenic
922741405 1:228016194-228016216 GAGGACTCTGAGGGTCCTTGGGG - Intronic
1064279887 10:13941996-13942018 GACCGCTCTGGAAGACCCTGTGG - Intronic
1065607706 10:27436471-27436493 GACAACTCTGGGGGTCTGGGCGG + Intergenic
1066802554 10:39207150-39207172 GGCGCCTTTGGGGGTCCCTGGGG + Intergenic
1067135108 10:43601172-43601194 GACCACCCTTGGGGGGCCTGGGG - Intergenic
1067162895 10:43842340-43842362 GTGCACTCGGGGGCTCCCTGGGG + Intergenic
1067293064 10:44958607-44958629 GACAGCTCTGAGGCTCCCTGTGG - Intergenic
1071582984 10:86790900-86790922 CACCACTTTGGGGGCCCCTGAGG - Intronic
1072693481 10:97586689-97586711 GAAGAGTCTGGGGGTCTCTGTGG - Intronic
1073177340 10:101564616-101564638 GACCCCTCTCAGGCTCCCTGGGG + Intergenic
1073184172 10:101605655-101605677 GAACACTCTGCGGGTCCCCTGGG - Intronic
1075603704 10:123789275-123789297 GCCCCCTCTGAGGGGCCCTGTGG - Intronic
1075916949 10:126175837-126175859 TACCACTCTGGACTTCCCTGGGG + Intronic
1076000211 10:126907175-126907197 GGCGACAGTGGGGGTCCCTGCGG + Intronic
1076131435 10:128016679-128016701 GACCTTTCTGGCTGTCCCTGTGG - Intronic
1076237848 10:128879641-128879663 GGACACTCTAGGGGTCCATGGGG + Intergenic
1076238771 10:128886445-128886467 GACCACACATGGGGTCCCCGTGG - Intergenic
1077117375 11:891282-891304 GCCCACGGTGGGGGTCCCCGGGG - Intronic
1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG + Intronic
1077899636 11:6478359-6478381 GATCACCCTGGGGATACCTGGGG + Intronic
1078710287 11:13784479-13784501 TAGAACTCTGGGGGTCACTGAGG + Intergenic
1079126025 11:17719410-17719432 GGCCAGTCTGCGGGCCCCTGCGG + Intergenic
1079533812 11:21486255-21486277 GGCCAGTCTTCGGGTCCCTGTGG - Intronic
1079533985 11:21488556-21488578 GGCCAGTCTTCGGGTCCCTGTGG + Intronic
1081617832 11:44601076-44601098 GACTTCTCAGGGGCTCCCTGTGG + Intronic
1083886554 11:65576123-65576145 GACCACCCTGCGGGCCCCAGCGG + Exonic
1084219490 11:67668365-67668387 GACCCCACTGGGGTTCCCTTGGG - Intronic
1084679697 11:70659717-70659739 GCCCAGTCTGGGGGTGCTTGTGG - Intronic
1086552543 11:88069321-88069343 GCCCACCCTGGGGGGCCCTCCGG - Intergenic
1088834904 11:113569249-113569271 GGACACTCTGTGGGTCCTTGGGG - Intergenic
1093443841 12:19230829-19230851 GCCCACTCTGGCCGTGCCTGAGG - Intronic
1093524843 12:20093738-20093760 GCCCACTCTGGTGGTGCTTGAGG - Intergenic
1094500270 12:31015373-31015395 GACCTCACTGTGGGCCCCTGGGG + Intergenic
1096865718 12:54561513-54561535 GTCCCCTCTTGGGGGCCCTGGGG + Intronic
1102326841 12:111993065-111993087 GACCGCTGTGGAGGTCCGTGAGG - Intronic
1102542158 12:113628988-113629010 GACCACTCTTGGGTTCAATGGGG - Intergenic
1103554170 12:121755939-121755961 CGCCACTCTGGGTGTTCCTGGGG - Intronic
1103913194 12:124363165-124363187 GACCAGGCTGGTGGTCCCTTGGG - Intronic
1103951943 12:124556092-124556114 GGCCACTCTGGGCCTCTCTGTGG + Intronic
1104992697 12:132635077-132635099 GTCCACTATGAGGGCCCCTGTGG + Intronic
1105437881 13:20392232-20392254 GGCCCCTCTGCGGGTCGCTGGGG - Intergenic
1106375480 13:29182842-29182864 AACCACTGTGGGGGACCCTAAGG + Intronic
1107884714 13:44865814-44865836 GCCCAGTCTTGGGCTCCCTGTGG - Intergenic
1108594121 13:51935777-51935799 GACCTCACTGGGGGCCGCTGAGG - Intronic
1110436458 13:75482088-75482110 GACCACGCCGAGGGTCCCCGCGG + Exonic
1113065973 13:106374765-106374787 GACCCCTCTGGTTGTCACTGTGG + Intergenic
1117325245 14:54662839-54662861 GACCTCTCTGGGGGTCAACGTGG - Intronic
1119820130 14:77608763-77608785 TACCACGCCTGGGGTCCCTGGGG - Intronic
1119857562 14:77912262-77912284 GCCCACTGTGGGGGTTTCTGCGG - Intronic
1121697747 14:95927614-95927636 GACCACTCTAGGGGATCATGGGG - Intergenic
1122815878 14:104313776-104313798 GAGCACCCTGAGGGTCCCTGAGG + Intergenic
1124006727 15:25800729-25800751 CCCCACTCTGGGGGCCCCTGAGG + Intronic
1124559618 15:30759469-30759491 CACCACTCCAGGGCTCCCTGAGG + Intronic
1124671633 15:31646237-31646259 CACCACTCCAGGGCTCCCTGAGG - Intronic
1127277634 15:57461258-57461280 GACCACACTCAGGGTCCCAGGGG + Intronic
1127717327 15:61661863-61661885 GACCACTCTGAGAGTCAGTGTGG - Intergenic
1128086256 15:64888652-64888674 GGAGACTCTGGGGCTCCCTGAGG - Intronic
1128839088 15:70835021-70835043 GCTGACTCTTGGGGTCCCTGGGG + Intronic
1129239926 15:74245149-74245171 CACTCCTCTGGGGCTCCCTGAGG + Intronic
1129726779 15:77905527-77905549 GACCCCTCTGGAGGTACTTGGGG - Intergenic
1130486450 15:84400949-84400971 GACCCCTCTGGAGGTACTTGGGG + Intergenic
1130808418 15:87351527-87351549 GAACAGTCTGGGGGTCATTGTGG - Intergenic
1130995875 15:88903820-88903842 GATGACACTGCGGGTCCCTGGGG + Intronic
1132980555 16:2736831-2736853 GGACACTATGGGGGCCCCTGAGG - Intergenic
1132995277 16:2819435-2819457 AACCCCTCTGGGGGTTCCTCTGG + Intronic
1137704612 16:50526067-50526089 GGCCACTCTCTGAGTCCCTGTGG + Intergenic
1141552201 16:84813546-84813568 CACCTCTCTGGGGGACCCTGAGG - Intergenic
1141692236 16:85602864-85602886 GACCAGTGTGTGGGCCCCTGCGG - Intergenic
1142377283 16:89712426-89712448 GACCGCCCTGGTGGTCCCCGAGG - Intronic
1142430036 16:90021217-90021239 CACCACTGTGTGGGTGCCTGAGG + Intronic
1144673838 17:17148289-17148311 TAGACCTCTGGGGGTCCCTGAGG + Intronic
1144814121 17:18021378-18021400 GAGCACTCTGGTCTTCCCTGGGG + Intronic
1145011021 17:19367971-19367993 GAGCACTCTGGGGGGCCCTGAGG + Intronic
1146398836 17:32488024-32488046 GACCCGTTTGGGCGTCCCTGCGG - Exonic
1147458691 17:40554694-40554716 GACCTCTCCCAGGGTCCCTGGGG - Exonic
1150155690 17:62851153-62851175 CAGAACTCTGGGGGTCCCTCAGG - Intergenic
1150302125 17:64055529-64055551 TTCCACTCTGGGGGTCTCTGTGG - Intronic
1150601099 17:66651756-66651778 GGACACTCTGGGTGCCCCTGAGG - Intronic
1151817735 17:76479481-76479503 GATCAGTGTGGGGGTGCCTGGGG - Intronic
1152269491 17:79315747-79315769 CGCCACCCTGGGGGTCTCTGAGG + Intronic
1152278887 17:79373623-79373645 GCCCACACTGGAGGCCCCTGGGG + Intronic
1152599536 17:81255028-81255050 GACCAGTCTGGGGCTCCAGGGGG + Intronic
1152751969 17:82066338-82066360 ATCCACTCTGGGGTTCCCAGTGG - Intergenic
1152758356 17:82096551-82096573 CACCACCCTGAGGGTCCGTGCGG + Intronic
1152771470 17:82172224-82172246 AGCCACTCATGGGGTCCCTGGGG + Intronic
1152806102 17:82357112-82357134 GAGCCCTCTGAGGGCCCCTGTGG - Intergenic
1153721418 18:7907239-7907261 CACCACTGTGGTGGCCCCTGGGG - Intronic
1153739294 18:8106163-8106185 GGCCACTCTGGGGACTCCTGGGG + Intronic
1155504535 18:26520416-26520438 AACCTCTGTGGGGGTACCTGAGG - Intronic
1156452250 18:37273609-37273631 GACAACACTAGGGGTGCCTGGGG - Intronic
1157588629 18:48820991-48821013 CAGCTCTCTGGGAGTCCCTGGGG + Intronic
1157687816 18:49656982-49657004 GACAACCATTGGGGTCCCTGAGG - Intergenic
1160794706 19:939907-939929 CACCAGTCTGGGGGTCTCCGGGG - Intronic
1161085810 19:2334372-2334394 CACCAGCCTGGGGCTCCCTGAGG + Intronic
1161231837 19:3178512-3178534 GACGGCTCCGGGGCTCCCTGCGG + Intronic
1161976653 19:7611294-7611316 GGCCATTCTGGGGGTCACTTTGG - Intronic
1162164512 19:8743268-8743290 GCCAATTCTGGGTGTCCCTGCGG - Intergenic
1162165584 19:8750736-8750758 GCCAATTCTGGGTGTCCCTGCGG - Intergenic
1162166649 19:8758192-8758214 GCCAATTCTGGGTGTCCCTGCGG - Intergenic
1162167715 19:8765648-8765670 GCCAATTCTGGGTGTCCCTGCGG - Intergenic
1162168654 19:8771946-8771968 GCCAATTCTGGGTGTCCCTGCGG - Intergenic
1162170400 19:8784710-8784732 GCCAATTCTGGGTGTCCCTGCGG - Intergenic
1163153214 19:15427017-15427039 CACCCATCTGAGGGTCCCTGGGG - Exonic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1163664703 19:18597907-18597929 GATCCTTCTGGGGGCCCCTGAGG + Intronic
1164729493 19:30491780-30491802 GACTCCTCTGTGGGTCCCTTGGG + Intronic
1165025631 19:32959173-32959195 GACCAGGCTGGGGGTGCCTTTGG - Intronic
1167664651 19:50817159-50817181 GATGACTTTAGGGGTCCCTGGGG + Intergenic
1167768967 19:51501935-51501957 GTCCACTCCTGGGGACCCTGAGG + Intergenic
925110185 2:1328422-1328444 CACAACTCTGGGGCTCCGTGAGG + Intronic
928136918 2:28694760-28694782 GATCACTCTGGGCAGCCCTGTGG + Intergenic
929737462 2:44565133-44565155 AACCACTTGGGGGGTCCCTTTGG - Intronic
932086263 2:68765048-68765070 GACCACCCTTGGGCTCCCTCCGG + Intronic
934766010 2:96880394-96880416 GAACAGGCTGGGGGTGCCTGGGG + Intronic
934913466 2:98279285-98279307 GTCAACTCTGGGGATCCCTGAGG + Intronic
936706351 2:115079476-115079498 GAACACTCTGGGAGGCCCAGAGG + Intronic
937250605 2:120521504-120521526 GAGGACTGTGGGGGTACCTGTGG - Intergenic
937319522 2:120952729-120952751 GACCAAGCTGGGGTGCCCTGAGG + Intronic
937756275 2:125542580-125542602 GAAAACTCTGGGGGGTCCTGTGG + Intergenic
938564768 2:132508742-132508764 AACCTCTCTGAGGCTCCCTGGGG - Intronic
939118327 2:138087394-138087416 GTCCACTCTGAGGGGCTCTGGGG + Intergenic
940231232 2:151454897-151454919 GACCAATCTGAAGGTCTCTGTGG - Exonic
944711236 2:202336598-202336620 GAGAACTCCGCGGGTCCCTGGGG - Intergenic
948264133 2:236625177-236625199 GAGCACTCAGGAGTTCCCTGTGG - Intergenic
1169630294 20:7622920-7622942 GTCCACTCTGGCGGTGCTTGAGG - Intergenic
1170542964 20:17407283-17407305 GGCCACTCAGCGGGCCCCTGAGG - Intronic
1173416009 20:42856593-42856615 GACAACCCTGGGGGAACCTGGGG - Intronic
1173497412 20:43529575-43529597 GTCCACTCTGGGGGAGCTTGAGG + Intronic
1174365301 20:50053119-50053141 GGCCACTCTGAGGGACTCTGAGG - Intergenic
1175675352 20:60942021-60942043 GACCACTTTGCGGGACTCTGAGG - Intergenic
1176145094 20:63562011-63562033 GCCCACCCTGTGGGTCCCTGTGG + Intronic
1176258991 20:64169132-64169154 GGCAGCTCTGTGGGTCCCTGAGG - Intronic
1178597820 21:33970705-33970727 TACCATTCTAGGGGTTCCTGAGG + Intergenic
1179784014 21:43719572-43719594 GAGCGCTCTGCGGGCCCCTGCGG + Intronic
1180139071 21:45880375-45880397 GTCTGCTGTGGGGGTCCCTGTGG - Intronic
1180876136 22:19176082-19176104 GGACACTCTGGCGGTGCCTGGGG + Exonic
1181167752 22:20992575-20992597 GACCACTCTGAGGGTCTCCATGG + Intronic
1181312889 22:21955018-21955040 GCCCACTCTGAGGATGCCTGCGG - Intergenic
1181345997 22:22221090-22221112 GCCCACTCTGAGGATGCCTGCGG - Intergenic
1181570369 22:23764971-23764993 TCCCACTCTGGGTGTCTCTGTGG - Intronic
1181597588 22:23926714-23926736 CACCCCTCTGGGGCTACCTGAGG + Intergenic
1183460149 22:37944951-37944973 GAGCAGTCAGGGGATCCCTGAGG - Intronic
1183478589 22:38050601-38050623 AACCACTTTGGGGGTGGCTGGGG + Intergenic
1183828147 22:40404465-40404487 CAACACCCTGTGGGTCCCTGTGG - Intronic
1184852860 22:47130687-47130709 GAGCAGTCTGTGGGACCCTGCGG + Intronic
1184855522 22:47144434-47144456 CCCCACTTTGGGGGGCCCTGAGG + Intronic
949509394 3:4755039-4755061 CACCACCCTGGAGGACCCTGTGG - Intronic
950156875 3:10728006-10728028 GAAGACCCTGGGGGTCCCAGAGG + Intergenic
950460580 3:13119982-13120004 GAGCTCTCTCTGGGTCCCTGTGG - Intergenic
953069973 3:39509844-39509866 GACCCTGCTGGGGGTCCCTGGGG - Intronic
953422971 3:42769599-42769621 GCCCACTCTGGCGGTGCTTGAGG + Intronic
954446796 3:50551164-50551186 GCCCACTCTGTGGGTTGCTGGGG + Intergenic
954975435 3:54689568-54689590 GAACACACTGGGGGTGGCTGAGG - Intronic
956366827 3:68513145-68513167 CACCACTCTGGAGGCACCTGTGG - Intronic
960479472 3:118171284-118171306 GCCCACTCTGGCCGTGCCTGAGG + Intergenic
961822199 3:129580831-129580853 GGCAATTGTGGGGGTCCCTGGGG - Intronic
963764941 3:149324775-149324797 GATCACTTTGGGGTTCCATGTGG - Intronic
968045718 3:195623082-195623104 GGACACTATGGGGGTCACTGCGG - Intergenic
968064431 3:195750847-195750869 GGACACTATGGGGGTCACTGCGG - Intronic
968308938 3:197667005-197667027 GGACACTATGGGGGTCACTGCGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968541990 4:1172507-1172529 GCCCTCTCTGGGTGTCCCGGGGG + Intronic
968666747 4:1826592-1826614 GTCACCTCTGGGGTTCCCTGAGG + Intronic
969595966 4:8149463-8149485 GACCAAGCTGGGGTTTCCTGTGG - Intronic
969665499 4:8554931-8554953 CAGCACCCTGGGGGTCGCTGGGG - Intergenic
970542676 4:17095437-17095459 GATCATGCTGTGGGTCCCTGTGG - Intergenic
971281749 4:25247089-25247111 GCCCACTCTGGCCGTGCCTGAGG - Intronic
971527439 4:27638852-27638874 AAGCACACTGGAGGTCCCTGGGG + Intergenic
972726235 4:41748382-41748404 GACTGCTCTGGTGGTCCCTGAGG + Exonic
972963865 4:44486264-44486286 GCCCACTCTTGGGGCCCCAGTGG - Intergenic
977678609 4:99774340-99774362 CACCAGGCTGGGGCTCCCTGTGG + Intergenic
981370670 4:143955408-143955430 AACCACTCTGGTGCTCTCTGTGG - Intergenic
985699117 5:1359634-1359656 CTCCTTTCTGGGGGTCCCTGAGG + Intergenic
986523995 5:8653041-8653063 GACCTCTGTGGGGCTCCCTAGGG + Intergenic
986934457 5:12866185-12866207 GACAACTCTCGGGTTACCTGAGG + Intergenic
990448864 5:55917426-55917448 GTCCACCCTGGGGGTCCTTTGGG - Intronic
997468666 5:134104523-134104545 GTCCACCCTGGGGGCCCCTCAGG + Intergenic
998948854 5:147371250-147371272 GACCACTGTGGGGCTGCATGGGG - Intronic
999400934 5:151263747-151263769 GAGCACTCTTGGGGTCCATGGGG + Intronic
1006113271 6:31761636-31761658 GCCCAGCCTGGGGGTCCCCGAGG - Intronic
1006295188 6:33167107-33167129 GGCAGCCCTGGGGGTCCCTGTGG + Exonic
1013807297 6:114010348-114010370 GGACACTCTGGGGGATCCTGTGG - Intronic
1014142889 6:117964636-117964658 GAGCACTCTGGAGGACCCTGAGG + Intronic
1017805646 6:157943403-157943425 GAGGACGCTGGGGGCCCCTGGGG + Exonic
1018038191 6:159899325-159899347 GACCACTCCAGGGGCCACTGAGG + Intergenic
1019073738 6:169370383-169370405 CACAGCTCTGGGGGTTCCTGTGG - Intergenic
1022299828 7:29092749-29092771 GACCTCTCTGCAGGTCCCTAAGG - Intronic
1022737821 7:33092485-33092507 GACCACTCTGGAGTTCCATACGG + Intergenic
1022902365 7:34823835-34823857 GAGCCCTCTGGGGGTCACTGTGG - Intronic
1024054022 7:45648186-45648208 CACCCATCTGGGTGTCCCTGGGG - Intronic
1024117807 7:46209763-46209785 GAGCACTGTGGGGGGTCCTGAGG - Intergenic
1024731156 7:52255288-52255310 GGCCACTTTGGGGTTCCCAGAGG - Intergenic
1025638815 7:63349094-63349116 GGCCGCTCTGGAGGTGCCTGGGG + Intergenic
1025643881 7:63398995-63399017 GGCCGCTCTGGAGGTGCCTGGGG - Intergenic
1025713474 7:63932007-63932029 GGCCGCTCTGGAGGTGCCTGGGG - Intergenic
1026153483 7:67807892-67807914 GACCCCTTTGGGGATCCATGAGG + Intergenic
1026678205 7:72446064-72446086 GTCATCTCTGGGGGTCCCGGGGG - Intronic
1028890903 7:95987591-95987613 GACCATCCTTGAGGTCCCTGTGG + Intronic
1031568733 7:123331020-123331042 GACCAGTCTGTGGGTCCCAGTGG - Intergenic
1032579956 7:133095286-133095308 GATTGCTCTGTGGGTCCCTGAGG - Intergenic
1033251916 7:139767955-139767977 GACCAGGCTCTGGGTCCCTGGGG + Intronic
1033290632 7:140079733-140079755 GTCCACTCTGGGGCTGCCTGTGG + Intergenic
1038104319 8:24415802-24415824 GACAGCTCTGTGGGTCTCTGTGG - Intergenic
1040810927 8:51452566-51452588 GATCACTCTTGGGGCCACTGGGG + Intronic
1041239343 8:55835924-55835946 GACCACTCTTGGCTCCCCTGGGG - Intergenic
1045506230 8:102780776-102780798 GACCACTGTGCTGGGCCCTGGGG + Intergenic
1049700449 8:144008963-144008985 TAACATTCTGGGGGACCCTGGGG + Intronic
1049709315 8:144056533-144056555 GACCACTCCTTGGGTCCCCGCGG - Intronic
1049820415 8:144629945-144629967 GGACACTGTGGGGGGCCCTGGGG + Intergenic
1057301980 9:93891818-93891840 GACCTCCCTGTGGGTCACTGTGG + Intergenic
1059497715 9:114723418-114723440 GCTCACTCTGTAGGTCCCTGTGG + Intergenic
1060141736 9:121216267-121216289 GATCACTCTGATGGTCCATGAGG - Intronic
1060734141 9:126055603-126055625 GGCCCCTCTGGAGGTGCCTGCGG + Intergenic
1061169422 9:128943602-128943624 GGCCACCCTGGGAGTCCGTGGGG + Intronic
1061238161 9:129353925-129353947 GAACACACTTGGGGGCCCTGGGG - Intergenic
1061466727 9:130786214-130786236 GATAATTCTGGGGGGCCCTGGGG + Intronic
1062115533 9:134806255-134806277 GCCGGCCCTGGGGGTCCCTGGGG - Exonic
1062339431 9:136087447-136087469 TGCCGCTCTGGGGGTCCCCGTGG - Intronic
1185666150 X:1767067-1767089 GTCAAGTCTGGGGTTCCCTGGGG + Intergenic
1190779881 X:53583767-53583789 GAGCATGCTGGGAGTCCCTGTGG - Exonic
1192112947 X:68383722-68383744 GAGCTCTCTGGGGATCCCTAGGG - Intronic
1198214956 X:134546727-134546749 GATCGATCTGGGGGTACCTGCGG + Intergenic
1200786445 Y:7264526-7264548 GCTCACTCTTTGGGTCCCTGCGG + Intergenic
1202368980 Y:24184791-24184813 GACCCCTCTGGAGGTACTTGAGG + Intergenic
1202501805 Y:25485326-25485348 GACCCCTCTGGAGGTACTTGAGG - Intergenic