ID: 1077392427

View in Genome Browser
Species Human (GRCh38)
Location 11:2306309-2306331
Sequence CAGGAAATGAAAGAGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 305}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077392422_1077392427 -3 Left 1077392422 11:2306289-2306311 CCCCTAGCTGGCCTCTCGCACAG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392415_1077392427 14 Left 1077392415 11:2306272-2306294 CCACCCCTCCGGCCTCTCCCCTA 0: 1
1: 1
2: 5
3: 75
4: 840
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392411_1077392427 21 Left 1077392411 11:2306265-2306287 CCTGCCCCCACCCCTCCGGCCTC 0: 1
1: 2
2: 20
3: 277
4: 1868
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392421_1077392427 2 Left 1077392421 11:2306284-2306306 CCTCTCCCCTAGCTGGCCTCTCG 0: 1
1: 0
2: 18
3: 19
4: 286
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392420_1077392427 6 Left 1077392420 11:2306280-2306302 CCGGCCTCTCCCCTAGCTGGCCT 0: 1
1: 0
2: 3
3: 36
4: 438
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392407_1077392427 30 Left 1077392407 11:2306256-2306278 CCCTTCCTGCCTGCCCCCACCCC 0: 1
1: 4
2: 34
3: 357
4: 2718
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392423_1077392427 -4 Left 1077392423 11:2306290-2306312 CCCTAGCTGGCCTCTCGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392418_1077392427 9 Left 1077392418 11:2306277-2306299 CCTCCGGCCTCTCCCCTAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 316
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392425_1077392427 -5 Left 1077392425 11:2306291-2306313 CCTAGCTGGCCTCTCGCACAGGA 0: 1
1: 0
2: 1
3: 33
4: 189
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392412_1077392427 17 Left 1077392412 11:2306269-2306291 CCCCCACCCCTCCGGCCTCTCCC 0: 1
1: 2
2: 16
3: 169
4: 1589
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392416_1077392427 11 Left 1077392416 11:2306275-2306297 CCCCTCCGGCCTCTCCCCTAGCT 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392409_1077392427 25 Left 1077392409 11:2306261-2306283 CCTGCCTGCCCCCACCCCTCCGG 0: 1
1: 0
2: 6
3: 125
4: 1167
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392414_1077392427 15 Left 1077392414 11:2306271-2306293 CCCACCCCTCCGGCCTCTCCCCT 0: 1
1: 1
2: 10
3: 136
4: 1159
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392417_1077392427 10 Left 1077392417 11:2306276-2306298 CCCTCCGGCCTCTCCCCTAGCTG 0: 1
1: 0
2: 0
3: 28
4: 286
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392413_1077392427 16 Left 1077392413 11:2306270-2306292 CCCCACCCCTCCGGCCTCTCCCC 0: 1
1: 1
2: 12
3: 185
4: 1945
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305
1077392408_1077392427 29 Left 1077392408 11:2306257-2306279 CCTTCCTGCCTGCCCCCACCCCT 0: 1
1: 3
2: 51
3: 846
4: 11423
Right 1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077392427 Original CRISPR CAGGAAATGAAAGAGCTTGC TGG Intronic
900320233 1:2079931-2079953 CAGGGAACGAGAGGGCTTGCGGG - Intronic
900564099 1:3323989-3324011 AAAGGAAAGAAAGAGCTTGCAGG + Intronic
901176273 1:7301800-7301822 CAGGAAGTGAGAGCACTTGCTGG - Intronic
902915351 1:19635444-19635466 AAAGAAAAGAAAAAGCTTGCTGG - Intronic
903309931 1:22447234-22447256 AAGGAAATGAAAGATCATGCTGG + Intergenic
905478140 1:38243282-38243304 CAGGAAATGAAAATGCTAGCTGG + Intergenic
905479718 1:38253160-38253182 AAGGAAAGGAAATAGCCTGCTGG + Intergenic
905851437 1:41277842-41277864 CATGAAATTAATGAGCGTGCGGG + Intergenic
906479611 1:46191434-46191456 CAGGAAAGGGCAGAGATTGCAGG + Intronic
906642122 1:47447454-47447476 CCTGAAATGCCAGAGCTTGCAGG + Intergenic
907585837 1:55617066-55617088 AAGGAAAAGGAAGAGTTTGCAGG - Intergenic
908684532 1:66700502-66700524 CAGGAAATTAGAGAGCTGGAAGG - Intronic
908806759 1:67939875-67939897 CAGGAAATTAAAGAGCCTTGGGG + Intergenic
909193722 1:72588668-72588690 CAGGAAGTGTAAGTGATTGCTGG - Intergenic
909476139 1:76082731-76082753 CAGGAAATGAAAGAGAGGCCTGG - Intronic
912669660 1:111613493-111613515 TTTGAAATGAAAGAGCTGGCCGG - Intronic
914706798 1:150176904-150176926 CATGAAAAGGAAGAGCTGGCCGG + Intergenic
915706215 1:157846296-157846318 CAGGAAAGCAAATAGCTTACAGG + Intronic
919186815 1:194161645-194161667 CAGGAAAAGAAACAGGTTGGAGG + Intergenic
919481809 1:198099319-198099341 GAGGAAATGGAAGAGCTAGTGGG + Intergenic
921391026 1:214613806-214613828 CAGAAAATTCAAGAGCTTGAAGG + Exonic
921456473 1:215377992-215378014 CAGAATATGAAATAGCTTCCAGG + Intergenic
921741152 1:218686498-218686520 GAGGAAATAAAAGAGCTTAAAGG + Intergenic
921965207 1:221080684-221080706 CAGGAAATGAGAGAAATTGTTGG - Intergenic
924560589 1:245154516-245154538 CAGGAAGAGAAAGAACTTGGGGG + Intergenic
1062979790 10:1712576-1712598 CAGTAACTGGAAGAGCTTTCTGG - Intronic
1063157774 10:3396090-3396112 CCAGGAATGAAAGAGCTGGCAGG + Intergenic
1064245315 10:13663309-13663331 TGGGAAATGAGAGAGCTTGCAGG + Intronic
1064633463 10:17340809-17340831 CAAAAAATAAAAGAGCTTTCTGG + Intronic
1064977606 10:21135048-21135070 GAGGAAATGAAAGAGTGTACTGG - Intronic
1065294830 10:24264273-24264295 CAGGAAAAGAATGAACTTCCAGG - Intronic
1065918598 10:30371937-30371959 CAGGAGCACAAAGAGCTTGCTGG - Intronic
1065990487 10:31004704-31004726 AAGGAATTGAAAGAATTTGCCGG + Intronic
1068695152 10:59959645-59959667 CTGGAAATCAAAGAGCTTCGTGG + Exonic
1068953070 10:62796707-62796729 CAGTAAGTGAAAGCCCTTGCTGG - Intergenic
1068963751 10:62891421-62891443 CAGTAAATGAAAGTGATTGGGGG + Intronic
1070540726 10:77413392-77413414 CAGGAGGTGAAAGAGGTTGCTGG - Intronic
1070698255 10:78579146-78579168 AAGGACGTGAAAGTGCTTGCAGG + Intergenic
1071481722 10:86069780-86069802 CAGGAAATGAAGACGCTGGCTGG - Intronic
1072726515 10:97817195-97817217 CAGGAAATGTTAAAGCTTCCCGG - Intergenic
1072907612 10:99468969-99468991 CAAGAAATGAAAGAGCTTTGGGG - Intergenic
1072944926 10:99801157-99801179 AAGGAAATGAAAAAGCTTCCAGG - Intronic
1073596892 10:104809597-104809619 CAGGAAATGAGTGTGGTTGCAGG + Intronic
1074885227 10:117688178-117688200 CAGGAAATGGGAGAGGTTGGTGG + Intergenic
1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG + Intronic
1077900871 11:6487527-6487549 CAGAATATGAAATAGCTTCCAGG - Intronic
1078204012 11:9212086-9212108 TAGGAAAAGAAAGAGCTGGCTGG + Intronic
1078234453 11:9471339-9471361 CAGGGAATGACAGAGTTTCCTGG + Exonic
1078678489 11:13450655-13450677 CAAGAACTGAAAGAGCTTGAGGG + Intronic
1079566563 11:21890099-21890121 CAGGAATTTAAATAGCTTTCTGG - Intergenic
1081146971 11:39573527-39573549 CATAAAATGCAAGTGCTTGCTGG + Intergenic
1081383515 11:42444618-42444640 CAGGAAGGAAAAGGGCTTGCAGG - Intergenic
1081496973 11:43621551-43621573 CAAAAAATAAAAAAGCTTGCTGG + Intronic
1083381603 11:62273874-62273896 CAGGACATGAAAGAGACTCCAGG - Intergenic
1084053858 11:66618342-66618364 CAGCAAATGAAATATCTTGGTGG - Intronic
1084754658 11:71229471-71229493 CAAAAAATGAAAGAGTTGGCTGG + Intronic
1088811109 11:113393258-113393280 CAGGAAGTAAAGGAGTTTGCAGG - Intronic
1089220113 11:116863648-116863670 CAGGTAATGGAAGAGGTGGCAGG - Exonic
1090296619 11:125593387-125593409 CAGGAGATGCCACAGCTTGCAGG + Intronic
1090831314 11:130422531-130422553 GAGGGAATGCAAGAGCTTCCCGG - Intronic
1091917132 12:4277745-4277767 TAGCAAATGAAAGAGATTCCAGG + Intronic
1093635272 12:21459202-21459224 CAGGAAGGGAAAGAGGTTGAAGG + Intronic
1097238850 12:57559660-57559682 GAGGATATGAAGGAGCTTTCAGG - Intronic
1097888367 12:64752952-64752974 CAGGAAGTCAAAATGCTTGCAGG + Intronic
1098304336 12:69087412-69087434 AAGGAAATGAAAGAGAAGGCAGG + Intergenic
1099456446 12:82868663-82868685 CAGTAACTGCAATAGCTTGCAGG + Intronic
1099496313 12:83351205-83351227 CAGGAAATAAAATTGTTTGCTGG + Intergenic
1099928615 12:89047896-89047918 CAGGGAATAAAAGAAATTGCAGG + Intergenic
1102050215 12:109856555-109856577 CAGCAAAGGAAAGAGCCTGCTGG - Intronic
1102641958 12:114374621-114374643 CAGGAAATGAGAGAATTTTCTGG + Intronic
1102899203 12:116623230-116623252 CAGGCAGTGCAAGAACTTGCTGG + Intergenic
1103736855 12:123066118-123066140 AAGGAGATGAAAGCTCTTGCAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105246713 13:18659303-18659325 CAGCAAGTGAAAGAGAGTGCGGG - Intergenic
1105484735 13:20816967-20816989 GAGGAAATGAATGTGCTTGATGG + Intronic
1106680611 13:32003256-32003278 TTGGTAATGAAAGAGCTTTCTGG + Intergenic
1107411470 13:40162364-40162386 CAGGAAATGAGTGACCATGCTGG - Intergenic
1108422431 13:50264950-50264972 CTGGTAATGAATGAGCTTGGTGG - Intronic
1108865651 13:54919518-54919540 CAGGAAAAGAAAGATCTGGAGGG + Intergenic
1109276638 13:60311214-60311236 CAGGAAATGAAAGATCTGGGAGG + Intergenic
1111578857 13:90196349-90196371 CAGGAAATGAAAGAGGCATCAGG - Intergenic
1111908956 13:94288493-94288515 CAGATAATGCAAGAGCTTGCAGG - Intronic
1112228311 13:97563014-97563036 CAGGAAGTGCCAGAGATTGCTGG - Intergenic
1113328587 13:109307464-109307486 CAGGCTGTGAAGGAGCTTGCAGG - Intergenic
1114329764 14:21625011-21625033 GTGGAAATGAAAGAAGTTGCTGG - Intergenic
1115080428 14:29444257-29444279 CAGGAGATGAAAAACCTTGTAGG - Intergenic
1115667498 14:35568664-35568686 AAGGAAATGAAACTGATTGCTGG + Intronic
1115982661 14:39071143-39071165 AAGGAAAAGAAAAAGCATGCAGG + Intronic
1115994581 14:39183287-39183309 CAGGAAATGAAACATTTTGCTGG - Intergenic
1116146738 14:41082770-41082792 CAAAAACTAAAAGAGCTTGCTGG - Intergenic
1116537913 14:46059398-46059420 AAGGAAGTGAAAGAGATTTCTGG + Intergenic
1118249304 14:64143467-64143489 CAGGATATGACAAAGCTTCCTGG - Intronic
1118787391 14:69057282-69057304 AAGGGAATAAAAGAGCTTGGTGG + Intronic
1118864822 14:69694729-69694751 CAGTAAAAGAAAGTGCTTGTTGG + Intronic
1119442859 14:74640478-74640500 CAGGAGAGGAAAGAGGTTACTGG - Intergenic
1122510493 14:102263083-102263105 AAGGAAATGAACGAGCATCCTGG + Intronic
1122829328 14:104388104-104388126 TAGGAAATGCCAGAGCTGGCTGG - Intergenic
1122997092 14:105271091-105271113 AAAGAAATGAAACAGCCTGCTGG + Intronic
1123185535 14:106513062-106513084 CAGTGAATACAAGAGCTTGCAGG + Intergenic
1123705699 15:22949409-22949431 GAGGAAAACAAAGAGCATGCTGG + Intronic
1124105046 15:26729722-26729744 GAGGAAGTGAAGGAGCCTGCTGG - Intronic
1126510752 15:49470878-49470900 CAAGAACTCAAACAGCTTGCTGG + Intronic
1128668065 15:69553064-69553086 CAGGAAATGGATGAGCCTGTGGG - Intergenic
1129136748 15:73559881-73559903 AAGGAACTGAAAAAGCTGGCGGG + Exonic
1130015031 15:80179907-80179929 AAGGAGATGGAAGAGCTTGGGGG + Intronic
1131309863 15:91280221-91280243 CAGGACATGATAGAGCATGAAGG + Intronic
1133227561 16:4349249-4349271 CAGGAAAAGAAAGTGCTGGCCGG - Intronic
1134299467 16:12976821-12976843 GAGGAAATGAAACAGCATGGTGG + Intronic
1134556320 16:15168595-15168617 CATGAAATGGAATAGCATGCTGG - Intergenic
1134916902 16:18080301-18080323 CATGAAATGGAATAGCTTGCTGG - Intergenic
1135986095 16:27185372-27185394 CAGGAGATGACAGAGCTGGAGGG + Intergenic
1138611005 16:58124033-58124055 CAGGAAGTGCAAAAGCTTGAAGG + Intronic
1138752976 16:59446457-59446479 AAGGAAATTAAAGAAATTGCAGG - Intergenic
1138887558 16:61097871-61097893 AAGGAACTGAAAGAGCAGGCTGG - Intergenic
1138895841 16:61203748-61203770 CAGTAGATGGATGAGCTTGCAGG - Intergenic
1139415492 16:66805149-66805171 CAGGAAATCAAAGGGCATCCTGG + Intronic
1140790243 16:78384602-78384624 CAGGAAATAACAGAGCTAGAGGG - Intronic
1143770564 17:9165980-9166002 CAGGAAAGGAAAGAGCTGAGGGG - Intronic
1144246113 17:13366779-13366801 CAGGAAATGTAAGAGCCTTGTGG - Intergenic
1146028607 17:29345097-29345119 GGGGAAATGAAAGAGCTAGAAGG + Intergenic
1146455815 17:33008969-33008991 GAGCAAAGGAAAGAGCTTGAAGG + Intergenic
1149598342 17:57877116-57877138 CAGGAAATGGAAGGCTTTGCTGG - Intronic
1151041470 17:70865803-70865825 AAAGAAAAGAAAGAGTTTGCAGG + Intergenic
1151938723 17:77280157-77280179 CAGGAAATGAAAATGCTTCTTGG + Intergenic
1152778696 17:82217047-82217069 CAAGAAATGAAAGGGCCTGGTGG + Intergenic
1153240376 18:3026053-3026075 AAGGAAATGACAGAAATTGCAGG + Intergenic
1154197529 18:12277405-12277427 CAGAAAAGGAAAGGGCTTGGTGG + Intronic
1154442147 18:14399819-14399841 CAGCAAGTGAAAGAGAGTGCGGG + Intergenic
1155585427 18:27358802-27358824 AAGGAGATGAAAGAGTCTGCAGG - Intergenic
1155943358 18:31821857-31821879 CAGGAAAGGAATGTGCTTACTGG - Intergenic
1157628488 18:49072618-49072640 CAGGAAATGAAATTGGTTACAGG - Intronic
1157965759 18:52206357-52206379 CAGGGATTGTCAGAGCTTGCTGG - Intergenic
1158501356 18:58005021-58005043 TAGTAAAAGAAAGAGCTGGCTGG + Intergenic
1158617994 18:59005482-59005504 CAGGAAATGAAAAGCCCTGCAGG - Intergenic
1159281130 18:66287592-66287614 AAGGAAATTAAAGAGTTTTCTGG + Intergenic
1160087858 18:75795695-75795717 GAAGAAATGAAAGAGCTTATGGG - Intergenic
1161783054 19:6306454-6306476 GAGGAAATGAAAGAGGATGGGGG + Exonic
1163117414 19:15196893-15196915 AAGGAAAGGCAAGAGGTTGCAGG - Intronic
1163201755 19:15774667-15774689 CAGGAGATGACAGAGAGTGCTGG - Intergenic
1164928231 19:32148547-32148569 CAAAAAATGACAGAGCTAGCTGG + Intergenic
1165702676 19:37950470-37950492 AAGGACAAGAAAGAGCTTACAGG + Intronic
1165720525 19:38075794-38075816 CAGAAAAGAAAAGATCTTGCAGG + Intronic
1166830680 19:45637971-45637993 CAGGAAATAAAATAGCAGGCCGG - Intronic
1167103280 19:47416973-47416995 CAGGAAAGGAGAGAGGTTGAGGG + Intronic
1168697226 19:58410369-58410391 CAGGAAAAGGCAGAGCTTGGTGG - Intronic
925711289 2:6743309-6743331 GAGGAAAAGAAAGACCTAGCAGG - Intergenic
925759641 2:7171974-7171996 CAAGGAATGAAAGAAATTGCTGG + Intergenic
927679872 2:25132194-25132216 CGGGAAATGAAAGGACTGGCTGG + Intronic
927874384 2:26645199-26645221 GATGAAATGACAGAGCCTGCGGG - Intergenic
928104190 2:28457346-28457368 TCGGAAATGAAAGGGCTTGCAGG - Intronic
929046366 2:37794407-37794429 CAGGCAATGACTGAGCTTGGTGG - Intergenic
929235893 2:39605301-39605323 CAAGAAATGAAAGAGCTGCCTGG - Intergenic
930036734 2:47090310-47090332 CAAGAAGTGACAGAGCTTGTTGG + Exonic
930362696 2:50401878-50401900 CAGGAAGTGAAAAGGCTGGCTGG - Intronic
930979615 2:57507366-57507388 CAGGAATTGGAACAGTTTGCAGG - Intergenic
932134215 2:69214230-69214252 GAGGAAGTGATACAGCTTGCAGG - Intronic
932461778 2:71886711-71886733 CAGCAAATGCAAGAGCTTGGAGG - Intergenic
932781017 2:74558489-74558511 AAGAAAATGAAAGTCCTTGCTGG + Exonic
933425846 2:82111507-82111529 CAGCAAAAGAGAGAGTTTGCTGG + Intergenic
933644790 2:84801930-84801952 CAGGATATGAAAGTCTTTGCTGG - Intronic
935016320 2:99185839-99185861 CAGAAAATTAAAGAGCTAGAAGG - Intronic
936799677 2:116252212-116252234 CTGGAAAAGAAAGATCTGGCGGG - Intergenic
937259881 2:120578489-120578511 GAGGAAAGGAGAGAGCCTGCAGG + Intergenic
938441260 2:131335817-131335839 CAGGGGATGAAGGAGCTAGCAGG - Intronic
938641774 2:133288702-133288724 GAGGTAATGAAACAGCATGCTGG - Intronic
938730105 2:134140766-134140788 CAGGAAAAAAAAGTGCTAGCTGG + Intronic
939882116 2:147642536-147642558 CTGGAGATGAGAGGGCTTGCTGG - Intergenic
940305729 2:152224206-152224228 CTGGAAAGGAAAGAGCCTGGTGG - Intergenic
940584422 2:155627213-155627235 AAGTAAATGAAAGAGATTTCTGG - Intergenic
941643091 2:168010059-168010081 CAGAAAATAAGAGAGCTTGACGG - Intronic
942045108 2:172095476-172095498 CAGGAAAAGAAAGTGCAGGCAGG - Intergenic
942521035 2:176804490-176804512 AAGGGAAGGAAAAAGCTTGCTGG - Intergenic
944912314 2:204322698-204322720 CAGAAAAGGAAAGAGAGTGCAGG + Intergenic
945640852 2:212427790-212427812 CAGGGAATGTGAGAGCTTGTGGG + Intronic
945932650 2:215871042-215871064 CAGCCAATGGAAGAGCATGCAGG + Intergenic
946535307 2:220620871-220620893 GAGAAAATGAAAGAGATTGCTGG - Intergenic
947104873 2:226659027-226659049 CAGGAAAAGAAAGTGCTTTTTGG + Intergenic
947441779 2:230129041-230129063 GAGAAAATGAAAGAGCTTTGTGG + Intergenic
948487480 2:238289898-238289920 CAGGACAGGAAGGAGCTTTCAGG + Intronic
948753488 2:240145437-240145459 CATGAAAAGAAAGAGCTTTTTGG + Intergenic
948998853 2:241600429-241600451 CAAGAAATGAAAGAACAGGCTGG + Intronic
1169879266 20:10328860-10328882 GAGAAAATGAAAGCACTTGCCGG - Intergenic
1171036605 20:21717217-21717239 CATGAAATGTCAGAGCCTGCTGG - Intronic
1173371026 20:42435437-42435459 GAGGAAGTGAAAGAGCTTTCTGG + Intronic
1174693542 20:52533740-52533762 CAGGAAAAGAGCTAGCTTGCAGG + Intergenic
1174823955 20:53752057-53752079 CAGAACATGAAAGAACTTCCTGG + Intergenic
1174867639 20:54152573-54152595 CAGGCAGAGAAAGAGCATGCCGG + Intergenic
1176453927 21:6891353-6891375 CAGCAAGTGAAAGAGAGTGCGGG - Intergenic
1176832102 21:13756401-13756423 CAGCAAGTGAAAGAGAGTGCGGG - Intergenic
1179347254 21:40570134-40570156 CAGAAACTCAAAGAGCTGGCAGG + Intronic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1181690301 22:24555376-24555398 CAGGAAATGCACGAGCTTTGGGG - Intronic
1181796290 22:25313595-25313617 CTTGAAATGGAATAGCTTGCTGG - Intergenic
1181836847 22:25617337-25617359 CTTGAAATGGAATAGCTTGCTGG + Intronic
1184281586 22:43440574-43440596 CAGGAACTGACAGTTCTTGCAGG - Intronic
950861384 3:16150436-16150458 CAGGGAATGAAAGAGAATGCAGG + Intergenic
951082792 3:18471332-18471354 CAGAAAAGGAAAGTGCTTACTGG + Intergenic
951789160 3:26460380-26460402 CAGGAAATAAAAAAACTTGGGGG + Intergenic
952053507 3:29415343-29415365 CAATAAATGGAATAGCTTGCAGG + Intronic
953911012 3:46893062-46893084 AAGGAAATGAAATATCATGCGGG - Intronic
955069969 3:55564263-55564285 GAGGAAATGAAAAAGCTTGGAGG + Intronic
955404815 3:58619459-58619481 CAGGAACTGAAAGAACTTCTTGG - Intronic
956506905 3:69950742-69950764 AAGGAAATAACAGAGCTTTCTGG + Intronic
956517736 3:70068169-70068191 CAGGAAAAGAAAATGCTTGTTGG - Intergenic
956736905 3:72245215-72245237 GAGGAAATGGAGGAGCTGGCTGG - Intergenic
958872036 3:99570898-99570920 TAGGAAAGGAAAGACCTTTCTGG - Intergenic
958957853 3:100480506-100480528 CAGGAAAAGCAAGAGGTTGGGGG - Intergenic
959223825 3:103556498-103556520 AAGGAAATGACAGAAATTGCAGG - Intergenic
960823336 3:121757628-121757650 CAGGAAACCAAAAAGCTGGCAGG + Intergenic
962146800 3:132848104-132848126 CAGGAAATCAAAGAGCTTGAAGG + Intergenic
962176697 3:133162899-133162921 CAGCATATGAAACAGTTTGCTGG + Intronic
963740541 3:149075926-149075948 CATTTAAAGAAAGAGCTTGCAGG - Exonic
964034804 3:152182687-152182709 TAGGAAATGAAAGAGCCTCTGGG + Intergenic
964960788 3:162422728-162422750 TAGCAAATGAAAGAGCATGGTGG - Intergenic
965671519 3:171152712-171152734 CAGGAAATGAAAGAATTTCTAGG + Intronic
967684763 3:192407420-192407442 AAGGAAGTGAAAGAGCATGAGGG + Intronic
967723877 3:192843729-192843751 CAGGAAGTGAAATAACCTGCAGG - Intronic
968313099 3:197700258-197700280 CAGGAAATGACAGAACTTAATGG + Intronic
969125014 4:4940720-4940742 CAGTAAATGGAAGAAATTGCAGG - Intergenic
969487675 4:7481374-7481396 CAGGGAAGGAAAGAGCTGGGTGG + Intronic
970036009 4:11736868-11736890 CAGGAACTGAAGGAGCTTCTGGG + Intergenic
971560720 4:28077144-28077166 CAGGAAGTGCAAGAGGTTGGGGG + Intergenic
972078409 4:35116528-35116550 CAGGAATTAAAAGCACTTGCTGG - Intergenic
972196145 4:36656207-36656229 CAGGAAGTGCAAGGGCTTGGGGG + Intergenic
972244162 4:37226882-37226904 CAGGTAATGAATGAGTGTGCAGG + Intergenic
975430858 4:74289339-74289361 CAGCAAATGCAAGACCTTGAGGG + Intronic
976426755 4:84912968-84912990 CTGGAAATGAGAGTGCTTTCTGG + Intronic
976438219 4:85043525-85043547 CAGGAAATGCAAGGGGTTGGGGG + Intergenic
976499799 4:85774535-85774557 CAGGAAATGAAAGAGATTTCCGG + Intronic
976675940 4:87703537-87703559 CTGGAATTGGAAGAGATTGCTGG - Intergenic
978017931 4:103770899-103770921 CTGGAAAAGAATGAGCTTGAAGG + Intergenic
978526563 4:109673202-109673224 CAGCAAGTGAAAGACCTTCCAGG - Intronic
981184882 4:141789260-141789282 CTGGAAATGAAAGAGCTGAGAGG - Intergenic
981512655 4:145574526-145574548 CAGGAAGTGCAAGAGGTTGGGGG + Intergenic
983511404 4:168612904-168612926 CTGGAATTCAAAGAGCTTTCTGG + Intronic
984457113 4:179984413-179984435 CAGGAAAAAAAAAAGCTTGAAGG - Intergenic
985003547 4:185509986-185510008 CAGGAAGTGAAGGAGCAAGCTGG - Intronic
985028730 4:185767200-185767222 TTGAAAATGAAAGAGCTGGCCGG + Intronic
985736133 5:1584515-1584537 CTGGAAATGAAAGATCTGGAGGG + Intergenic
986173962 5:5336239-5336261 CAGGAACTGAAGGAGATTCCTGG - Intergenic
986573485 5:9189172-9189194 TAGCAAATGCAGGAGCTTGCTGG + Intronic
986739646 5:10694839-10694861 CAGGAAAGCACAGAGCCTGCAGG + Intronic
987035590 5:14015176-14015198 CTGGAGGTGAAGGAGCTTGCAGG + Intergenic
988042371 5:25905860-25905882 CAGGAAATGTCAAAGATTGCTGG - Intergenic
988396964 5:30707815-30707837 CAGGAATTGGAAGAGTTTGGAGG + Intergenic
988882931 5:35523277-35523299 CAAGAAATCAAAGAGATTCCAGG - Intergenic
989313317 5:40047064-40047086 AAGGAAATGAAATGGCTTCCTGG - Intergenic
990128710 5:52552137-52552159 CAGCAAATGAAAGAGTAGGCTGG + Intergenic
990772705 5:59267864-59267886 AGGGAAATGGAAGGGCTTGCAGG + Intronic
992128131 5:73664067-73664089 CAGGAAAAGACAGGGCTTTCTGG - Intronic
992516680 5:77501083-77501105 CAGGAAGTGCAAGGGGTTGCAGG + Intronic
993208079 5:84910537-84910559 AAGGAGATGGAAGAGCTTGAAGG + Intergenic
993215970 5:85022637-85022659 CAGGGATTGGAAGAGCTTGGGGG - Intergenic
993751469 5:91673692-91673714 GAAGAAATGAAAGAGCAAGCTGG + Intergenic
994175737 5:96708897-96708919 CAGGAAGTAAAATAGCATGCGGG - Intronic
995775211 5:115717704-115717726 CAGAAAATGGACGAGCTAGCTGG - Intergenic
996165488 5:120217091-120217113 CAGAAAAAGAAAGAGATGGCAGG - Intergenic
996641916 5:125765096-125765118 CAACAAATGAAAGAGCCTGGAGG - Intergenic
997779224 5:136640343-136640365 AAGGAAATTAAATAGCTTGCTGG + Intergenic
997848368 5:137308655-137308677 CAGGAGATGAAAGAGCTGAGAGG - Intronic
1000051162 5:157564002-157564024 CAGGAAATGAAGGAGATTAGAGG - Intronic
1000334579 5:160232594-160232616 CATGAGATTAAAAAGCTTGCTGG + Intronic
1004056956 6:12148863-12148885 CAGGAAATAAAAGAGTTTCCTGG - Intronic
1004070728 6:12294979-12295001 CAGGAAAAGAGAGAGCTTTTTGG - Intronic
1004439613 6:15636445-15636467 TAAGAAATGAAAGAGTTGGCTGG - Intronic
1004514031 6:16306761-16306783 CGGCAAATCAAAGAGCTGGCTGG + Exonic
1006082328 6:31574731-31574753 CAGGGAGTGAAAGAGCCTCCAGG + Intergenic
1008871521 6:56277976-56277998 CAGCAAATGAAAGATGTTCCAGG - Intronic
1010225210 6:73482479-73482501 AACGATATGAAAGAGCTTGTTGG + Exonic
1012250001 6:96969450-96969472 CAGGAAATGAGAGAACTTAAGGG - Intronic
1015803893 6:137089571-137089593 CAGGTAATGAAAGGGCTGGAGGG + Intergenic
1015917340 6:138230882-138230904 CAGATAATGAAAGAGCTCACAGG - Intronic
1017859638 6:158383636-158383658 CTGGACTTGAAAGAGCTTGAGGG + Intronic
1018278273 6:162156580-162156602 CAGAAAATGAAAGAGCAGGCTGG - Intronic
1019469237 7:1209581-1209603 CAGGAAAGCTAAGAGCCTGCAGG - Intergenic
1019961238 7:4461623-4461645 CAGAAACTGAAAGAGCGTGGGGG + Intergenic
1020972608 7:14964576-14964598 CAGTAAATCAATGATCTTGCAGG + Intronic
1021307150 7:19045921-19045943 CAGGAAATGCAAGAGGTCGGGGG + Intronic
1021963760 7:25897440-25897462 CAGGAAAACAAATAGCTGGCAGG - Intergenic
1022310292 7:29190699-29190721 CAGCAAAAGAAAGAACTTGACGG - Intronic
1023280045 7:38560035-38560057 CAGGAAATGAAAGATTTTGTGGG - Intronic
1023346894 7:39279640-39279662 CAGGAAATGCCAAAGATTGCTGG - Intronic
1023461062 7:40397737-40397759 GAGGAGGAGAAAGAGCTTGCTGG + Intronic
1023604705 7:41918976-41918998 CAGGTTATGAAAGAGGTGGCTGG + Intergenic
1024620336 7:51151667-51151689 CAGGAAATTACAGGGCTTACTGG - Intronic
1024653442 7:51428632-51428654 CAGGAAACAAAAGATCTTTCTGG + Intergenic
1024722739 7:52156034-52156056 CAGGAAAGGGAAAAGCTTCCTGG - Intergenic
1025280474 7:57623349-57623371 CAGGAAATGAGTGAGTTTGCAGG - Intergenic
1025304257 7:57842158-57842180 CAGGAAATGAGTGAGTTTGCAGG + Intergenic
1025710958 7:63909188-63909210 TGGAAACTGAAAGAGCTTGCAGG - Intergenic
1025848447 7:65221069-65221091 CAGAAAAAGAAAGAAATTGCAGG + Intergenic
1026944528 7:74307200-74307222 AAGGAAACCAAAGAGCTGGCAGG - Intronic
1028033235 7:85945492-85945514 CAGGAAATTGAAGAGAATGCAGG - Intergenic
1029472887 7:100765620-100765642 AAAGAAAAGAAAGAGCTTGCAGG - Intronic
1031612560 7:123844959-123844981 CAGGAAGTGTAAGAGATTGGGGG - Intronic
1031971584 7:128068620-128068642 CAGGAAATGAAACAAGTTCCTGG + Intronic
1032328535 7:130955369-130955391 GAGGAAAAGAAAGAATTTGCTGG + Intergenic
1032892617 7:136215517-136215539 AAGAAAATTAAAGATCTTGCTGG - Intergenic
1033771039 7:144552090-144552112 CAGGAAATTAAATAGCCTGCAGG + Intronic
1033937252 7:146602422-146602444 CAGCAAAGGAAAGAACATGCAGG + Intronic
1037812552 8:22095595-22095617 CTGGAAATGAAAGGGCTGGATGG - Intronic
1043437819 8:80251743-80251765 CAGGGAAGGAAAGAGCCTTCCGG + Intergenic
1043478410 8:80627709-80627731 TAGGAAATGTAAGTTCTTGCAGG + Intergenic
1043625553 8:82253515-82253537 CTGGAAATAAATGAGATTGCTGG - Intergenic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1044782678 8:95759420-95759442 GAGGACATGAGAGAGCCTGCAGG + Intergenic
1046614956 8:116466053-116466075 AAGGAAATGAAAGAGAGTGGTGG + Intergenic
1050080696 9:1912824-1912846 CTGTAAATGAGAGAGCTTGGAGG - Intergenic
1050298118 9:4227594-4227616 CAGTAACTGCAAGAGCTTTCAGG + Intronic
1051064749 9:13089244-13089266 CAAGAAATGCAAGAGATTGGGGG - Intergenic
1051319907 9:15891789-15891811 CAGAGAATGAACGAGCATGCAGG + Intronic
1056191821 9:84192086-84192108 CAGGAAATGAGAAAACTTTCTGG - Intergenic
1056498781 9:87187885-87187907 CTGGAAATGAAAGTGCTAACGGG - Intergenic
1057506828 9:95641141-95641163 TAAGAAATGAAAGAGCAAGCAGG - Intergenic
1058504336 9:105653330-105653352 CAGAAAAAGACAGAGCTAGCGGG + Intergenic
1059264728 9:113016274-113016296 CAGGATATAAAAAAACTTGCAGG - Intergenic
1060085620 9:120697833-120697855 CAGAAAATGTATGAGTTTGCTGG + Intronic
1062282333 9:135757613-135757635 CTGGAAATGAAATGGCTGGCAGG + Intronic
1186061958 X:5718689-5718711 AAGGAAAAGAAAGAGCTAGTAGG - Intergenic
1186451703 X:9679545-9679567 CAGGAGAACAAAGAGCTTGGTGG - Intronic
1187000185 X:15168569-15168591 CAGGAAATGAAAGTGGTTGGGGG - Intergenic
1187297633 X:18017448-18017470 AAGGAAACGAAAGAGCTGGCAGG + Intergenic
1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG + Intergenic
1189809298 X:44765925-44765947 ATAGAAATGACAGAGCTTGCTGG - Intergenic
1191051165 X:56194273-56194295 CAGGAAGTGAAAGGGGTTGGGGG + Intergenic
1191684058 X:63870790-63870812 GAGGAAAGGAAAGAGTTTGAGGG + Intergenic
1191778483 X:64843782-64843804 CAGGGAATGAAAAAGTCTGCAGG - Intergenic
1192139094 X:68632397-68632419 CCGCAAATGAAAGAACTGGCAGG - Intergenic
1194796415 X:98216523-98216545 GAGGAAATAAAAGACCTTGAGGG - Intergenic
1194798923 X:98247418-98247440 CAGGAATTGACAGGGCTTGGGGG - Intergenic
1194882852 X:99274742-99274764 CATGAAGTGAAAGACCTGGCTGG + Intergenic
1195255653 X:103087038-103087060 CAAGAAATGAAAGACCTTAGCGG - Intronic
1196022529 X:111005434-111005456 CAGGAAATGCAAAAGCCTGCTGG + Intronic
1196700448 X:118662191-118662213 CAGGAAATAAAACAGATGGCAGG - Intronic
1197530527 X:127618471-127618493 CACGATATGAAAGAGCCTGCAGG + Intergenic
1197712424 X:129681085-129681107 CAGGAAAGCAGAGAGCTAGCTGG - Intergenic
1200021474 X:153214246-153214268 CAGGGCAGGAAAGAGCTTTCCGG + Intergenic
1200376504 X:155786452-155786474 CAGGAAAGGAAAGAACTTAAAGG - Intergenic
1200756482 Y:6995021-6995043 CAGGAGCTGCAAGAGCATGCAGG - Intronic
1201553752 Y:15246720-15246742 TGGGAAATGAAAGAGCTGGAAGG - Intergenic
1201583144 Y:15532192-15532214 CAGGAAATGCAAGGGGTTGGGGG - Intergenic