ID: 1077392646

View in Genome Browser
Species Human (GRCh38)
Location 11:2307184-2307206
Sequence CCCTGCTGGCCCCCAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077392646_1077392656 20 Left 1077392646 11:2307184-2307206 CCTGTGCTTGGGGGCCAGCAGGG 0: 1
1: 0
2: 2
3: 40
4: 327
Right 1077392656 11:2307227-2307249 CCCTCTGGCCCAGCTTCCCCTGG 0: 1
1: 1
2: 9
3: 59
4: 668
1077392646_1077392652 5 Left 1077392646 11:2307184-2307206 CCTGTGCTTGGGGGCCAGCAGGG 0: 1
1: 0
2: 2
3: 40
4: 327
Right 1077392652 11:2307212-2307234 CAGCTCTTTCCACGCCCCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077392646 Original CRISPR CCCTGCTGGCCCCCAAGCAC AGG (reversed) Intronic
901855444 1:12041669-12041691 CCCTGCGGGCCTCCAAGCCTGGG + Intergenic
902286987 1:15413296-15413318 CGCTCCTGGCCCCCAAGGAAAGG - Intronic
902398529 1:16145146-16145168 CCCTGCTGGCGCCTCAGCCCTGG - Intronic
902971505 1:20055669-20055691 CACTGCTAGTCCCAAAGCACTGG - Intronic
903404976 1:23088606-23088628 CCATTCTGGCCCCCAAACAAGGG - Exonic
904858371 1:33516831-33516853 GTATGGTGGCCCCCAAGCACTGG - Intronic
905539440 1:38748191-38748213 CCCTGCTGGGTACCAAGCACTGG + Intergenic
905932576 1:41800015-41800037 CCCTGCCTGCCCCAAAGCCCAGG - Intronic
906204447 1:43979489-43979511 CCCTGCTGAGCCCCGAGCGCCGG + Intronic
906642549 1:47450102-47450124 CGCCGCTGGCCCCAAAGTACCGG + Intergenic
907110958 1:51925960-51925982 CTCAGCTGGCCCCCCAGCAGGGG - Intronic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
911095606 1:94052498-94052520 CCCTGCTGAGCCTCATGCACAGG + Intronic
912467765 1:109885894-109885916 CCCTCCTGGGCTCCCAGCACAGG - Intergenic
912682537 1:111738583-111738605 CCCTGCTGGCAGACAAGCCCAGG + Intronic
913973428 1:143434473-143434495 CCCTGCTGAATGCCAAGCACTGG + Intergenic
914067817 1:144260080-144260102 CCCTGCTGAATGCCAAGCACTGG + Intergenic
914111338 1:144706274-144706296 CCCTGCTGAATGCCAAGCACTGG - Intergenic
915309491 1:155000184-155000206 CCCTGCTGGGCCCCAGGGGCCGG - Intergenic
916281924 1:163061239-163061261 CCGTGCAGGTTCCCAAGCACAGG - Intergenic
920256533 1:204659046-204659068 CCCTGCTGGTCTCACAGCACTGG - Intronic
922203563 1:223427407-223427429 ACCTACTGTCCGCCAAGCACAGG + Intergenic
922843791 1:228666639-228666661 CCCTGCTGGCTTCCAAACAGGGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923558661 1:235021780-235021802 CCCATCTGGCCCCAAAGAACAGG - Intergenic
924602794 1:245506238-245506260 CCCTCCTGACCCCAAAACACAGG - Intronic
1063094610 10:2898697-2898719 CCCTGCCAGCTCCCAAGCCCTGG + Intergenic
1063428090 10:5965263-5965285 CCCTGCTGGACACCATGCACAGG + Intronic
1064057067 10:12106631-12106653 CCCTACTGACCCCTGAGCACAGG - Intronic
1065186117 10:23172624-23172646 CCCTGCGGTCCCCCAAGCATCGG - Intergenic
1065917624 10:30366173-30366195 ACCTGTTGGCCCCCTAGCCCAGG + Intronic
1069474628 10:68721589-68721611 CCCTCCTGGCCCCCCGGCCCGGG + Intronic
1070140652 10:73734894-73734916 GCATGCCGGCCCCCAAACACAGG + Intergenic
1070230149 10:74557697-74557719 CCCTGCTGGCTTACAAGCATGGG + Intronic
1071523720 10:86346405-86346427 CCCAGCTGCCCTCCAAACACAGG - Intronic
1072189935 10:93070733-93070755 CCCTGGTGTCTCCCAAGCTCAGG - Intergenic
1072640441 10:97207303-97207325 CCCTGCTGGCTCCCCAGGGCGGG + Intronic
1073266405 10:102230773-102230795 CCCTGCAGGGCCCCAGGCCCTGG + Exonic
1074124007 10:110514044-110514066 CCCTCCTGACCCCTAACCACTGG + Intergenic
1075037429 10:119080846-119080868 CCCTGCTGCCGCCCAGGCCCCGG + Intergenic
1075931027 10:126296075-126296097 TCCTGATGGTCCCCACGCACGGG - Intronic
1076061881 10:127419421-127419443 CCTTCCTGGACCCCAAGAACTGG + Intronic
1076073996 10:127517732-127517754 CCTTGCTAGCCTCCTAGCACAGG - Intergenic
1076405832 10:130212113-130212135 CCCTGGTGGCCACTCAGCACTGG + Intergenic
1076851602 10:133095998-133096020 CCCTGCTGGCACCCACCCACAGG + Intronic
1077392646 11:2307184-2307206 CCCTGCTGGCCCCCAAGCACAGG - Intronic
1077432497 11:2522764-2522786 CCCTGCTGGCTCCCAACCCCCGG + Intronic
1077486062 11:2838955-2838977 CCCGCCTGGCCCCCAAACAGAGG + Intronic
1079081011 11:17413779-17413801 CCCTGCAGTGCCCCAAGCACGGG - Intronic
1079355056 11:19723737-19723759 CCCTGCTGGGCCGGCAGCACGGG - Intronic
1079370428 11:19847507-19847529 CCTGGCTGGTCCCCAAGCTCAGG - Intronic
1080226907 11:29972277-29972299 CCCTCCTGCCCCCCAAGTTCAGG + Intergenic
1081631981 11:44695537-44695559 CCCTGCTGACCCCCAAGGCCTGG + Intergenic
1081679285 11:44990368-44990390 CCCTACTGGATCCGAAGCACAGG - Intergenic
1081692797 11:45089487-45089509 CCCAGCTGGCCTCCAAGGCCAGG + Intergenic
1082005121 11:47414981-47415003 CACTGCTGGTCCCCAGGCCCGGG + Intronic
1083603418 11:63962504-63962526 ACCTGCTGGCCCCTCAGGACTGG + Intergenic
1083840131 11:65299522-65299544 CCCTGCCGGCCCCCAACCTTGGG - Intronic
1083920739 11:65780540-65780562 CCCGGAAGGCCCCCAAGCGCTGG + Exonic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1090223153 11:125048661-125048683 TCCCCCTGGCCCCCAAACACAGG + Intergenic
1090731706 11:129578341-129578363 CGGAGCTGGCCCCCCAGCACTGG + Intergenic
1091603977 12:1935020-1935042 CCCTGCTGGCAGCCAGGCCCGGG + Intergenic
1091605719 12:1949726-1949748 CCCTCCTGACCCCGGAGCACAGG + Intronic
1091795513 12:3295527-3295549 GACTGCTGGCCTCCAAGCAGGGG + Intergenic
1092670358 12:10854645-10854667 CCCTACTGGGGCCCAAGAACTGG + Intronic
1095349360 12:41189857-41189879 CCCTGCGAGCCCCCAGGCAGCGG + Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096583240 12:52601756-52601778 ACCTGCTGGCCTCCAATTACTGG + Intergenic
1096613612 12:52819000-52819022 CCCTGCTGGCCTCCTACCCCAGG + Intergenic
1096841845 12:54384703-54384725 CCCTGCTGGCTCCAGAGCAATGG + Intronic
1097181697 12:57175374-57175396 CCCTGCTGGGCCCCAAGTCCTGG - Intronic
1097473699 12:60027335-60027357 CCCTCCTGTCCCCCAAGCACAGG + Intergenic
1097552863 12:61098251-61098273 CCCTGCTGGGCCCCAGGCCAGGG + Intergenic
1098260481 12:68665078-68665100 CCATGCTGGCCTCAAACCACCGG - Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099861814 12:88231604-88231626 GCCTGCTTGCCTCCAAACACTGG + Intergenic
1101411856 12:104475493-104475515 CCCTGCTGTTTCCCTAGCACAGG - Intronic
1101430984 12:104627002-104627024 CCCTCCCTCCCCCCAAGCACTGG + Intronic
1102238033 12:111306964-111306986 CCGCGCTGGCCTCCAAGGACAGG + Exonic
1103715853 12:122944963-122944985 CCCAGATGCCCCCCAGGCACAGG - Intronic
1103811600 12:123618383-123618405 CCCTGCTGGGACCCAGGCAAGGG + Intronic
1103984569 12:124758685-124758707 CCCAGCTGGCCTCCCCGCACCGG + Intergenic
1104188692 12:126457563-126457585 CCCTCTTGGCCCTCCAGCACTGG + Intergenic
1105255161 13:18739454-18739476 CCCTCCTAGCCCCACAGCACAGG - Intergenic
1109441357 13:62379332-62379354 CCCTGCTGGCCCCGGGGCAATGG + Intergenic
1110244087 13:73301899-73301921 ATTTGCAGGCCCCCAAGCACTGG + Intergenic
1112870332 13:103963141-103963163 CCCTTCTAGTGCCCAAGCACAGG + Intergenic
1113679630 13:112234370-112234392 CACTTCTGGCCAGCAAGCACTGG + Intergenic
1113785416 13:112999878-112999900 GCCTGCAGGCCCCAGAGCACAGG + Intronic
1113906194 13:113820290-113820312 CCCTGCTCGGCCCCCACCACAGG - Intergenic
1114419624 14:22570439-22570461 CTCTGCTGCCCCCCAATGACTGG + Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1117545441 14:56791167-56791189 CCCTGCAGGCACCAAAACACAGG + Intergenic
1119326366 14:73761932-73761954 GCCTGCAGACCCCCAAGCAGAGG + Intronic
1120186263 14:81396451-81396473 CCTTTGTGACCCCCAAGCACTGG - Intronic
1121407171 14:93726110-93726132 GCCTGCTGCCCTCCAAGCCCAGG - Intronic
1122080272 14:99262292-99262314 GCCTGCTGTCCCCAGAGCACAGG + Intronic
1122816091 14:104314812-104314834 CCCTAGGGGCCCCCAGGCACCGG - Intergenic
1122919372 14:104873798-104873820 CCCTGCTGGACCCCATCCCCTGG + Intronic
1122973393 14:105161414-105161436 CCCTGCTGGCCCTGAAGCCCAGG - Intronic
1123087077 14:105721633-105721655 CCCTGCCCGCTCCCAAGAACGGG + Intergenic
1123948166 15:25248856-25248878 CCCTGCTGGCCACCAAACCTTGG - Intergenic
1124365473 15:29068326-29068348 CCATGCTGGCCCCTAAGCAATGG + Intronic
1124721509 15:32115014-32115036 CACTGCTGGCCACCAAGCTGGGG - Intronic
1124963350 15:34414663-34414685 CCATGCTGGCCCCTAAGCAATGG + Intronic
1124979970 15:34560889-34560911 CCATGCTGGCCCCTAAGCAATGG + Intronic
1125786437 15:42322542-42322564 CCCTGCTGGCACCAAAGGAGGGG + Intronic
1128772713 15:70294358-70294380 CCCTGCTGGGTGCCAAGCATGGG + Intergenic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1130306470 15:82715052-82715074 CCCTGCAGGACCCCAACCAGTGG + Intergenic
1132295337 15:100730300-100730322 CCCTGCTGGCCTGCAGCCACAGG + Intergenic
1132725477 16:1336498-1336520 CCCTGCCAGCCCCCGAGCCCTGG - Intronic
1132725893 16:1338247-1338269 CCCTGATGGACCCCCAGCTCTGG + Intronic
1132748222 16:1445719-1445741 CCCTGCCAGCCACCAAGCGCAGG - Exonic
1132851131 16:2025528-2025550 CCCTGCCCCCACCCAAGCACAGG - Intronic
1132971596 16:2691894-2691916 GGCTGCTGGCCCCTGAGCACAGG + Intronic
1133025508 16:2987454-2987476 CCCTGCCAGGCCCCCAGCACAGG + Intergenic
1133275224 16:4634240-4634262 CCCTGCTGGCTCACATGGACTGG - Intronic
1135538496 16:23312485-23312507 GCATGCTGACCCCCAGGCACTGG + Intronic
1136775016 16:32867269-32867291 CCCTCTTGGCCCCCTAGCCCAGG - Intergenic
1136895602 16:33994243-33994265 CCCTCTTGGCCCCCTAGCCCAGG + Intergenic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1137743843 16:50806453-50806475 CCCTGCTGCCTCCCAAGCCTGGG - Intergenic
1138533157 16:57646012-57646034 CACTGCCCGCCCCCGAGCACAGG - Intronic
1139612634 16:68069891-68069913 CCCTGCAGGCCTCCAAGAGCTGG + Intronic
1139653373 16:68373652-68373674 TCCTGCTGGACCCCCTGCACCGG + Intronic
1139973516 16:70791088-70791110 TCCTGCTGGGCTCCCAGCACAGG + Intronic
1140735656 16:77895781-77895803 GCCTGCTGCGCGCCAAGCACCGG + Intronic
1141464132 16:84195589-84195611 CCGTGCTGGCCCCCCAGCCAGGG + Exonic
1141482860 16:84318439-84318461 GCCGGCTGTCCCCCATGCACGGG + Intronic
1141555020 16:84831375-84831397 CCCTGCCATCCCCCAAGCATTGG + Intronic
1141679981 16:85538198-85538220 CCCGGCTGGCCCGCCAGCAATGG + Intergenic
1142145375 16:88490818-88490840 CCCTGCTGTCCCCCAGGAAGGGG + Intronic
1142418037 16:89953778-89953800 CCTTCCTGGGCCCCAAGCAAAGG - Intronic
1203077434 16_KI270728v1_random:1129378-1129400 CCCTCTTGGCCCCCTAGCCCAGG - Intergenic
1143350238 17:6282770-6282792 CTCTGCAGGCCACCAGGCACTGG + Intergenic
1143374591 17:6459774-6459796 CCCTCCTGGTCACCCAGCACGGG + Intronic
1143591165 17:7886356-7886378 CCCTGCTGTTCCCCAAGCAGGGG - Intronic
1145176752 17:20707351-20707373 CCCAGCTGGTCCCCCAGCCCAGG + Intergenic
1145933680 17:28702936-28702958 CTCTGCTGAGCCCCAAGCAAAGG - Intergenic
1145988301 17:29062259-29062281 CCCAGCCTGCCCCCAAGCATCGG + Intergenic
1146355145 17:32127352-32127374 CCCTGCTGGTCCCCCAGCTCAGG - Intergenic
1147319863 17:39639672-39639694 CCCTGCTGGCTCCCAAGTCAAGG - Intronic
1148086668 17:44997818-44997840 CCCTGCTGGTCCCCCAACCCTGG + Intergenic
1148786801 17:50149635-50149657 CCCGGCCGCCCCCCAAGCCCCGG - Exonic
1149058279 17:52390606-52390628 TCCTGCTGACCCACAAGCCCAGG - Intergenic
1151670739 17:75570477-75570499 CCCGGCTGGCCCCCCAGGAGAGG + Exonic
1151727989 17:75895465-75895487 CCCTGCTGACCCCCAGGGCCTGG + Intronic
1152065929 17:78112500-78112522 CCCTGTTCGCCTCCAAGCACAGG + Exonic
1152244398 17:79177595-79177617 CCATGCTGCCCACCAAGCCCAGG + Intronic
1152313820 17:79568130-79568152 CCCTGCCAGCCCCCAAGCTGGGG + Intergenic
1152635667 17:81429635-81429657 GCCTGCTGGCCCCCACTCTCCGG - Intronic
1152828753 17:82484242-82484264 TCCTGCTGCACCCCAGGCACTGG + Intronic
1153977820 18:10284935-10284957 CCCAGCTGTCCCTCAGGCACAGG - Intergenic
1154110861 18:11567442-11567464 CCCAGCTGGCTCCCCAGCAAGGG - Intergenic
1154139727 18:11812367-11812389 CCCTGCAGGTTCCCAAGTACAGG - Intronic
1154309105 18:13253965-13253987 CGCAGCAAGCCCCCAAGCACAGG - Intronic
1154312060 18:13274363-13274385 CCCTGCTGGCCCCTACACAGGGG + Intronic
1155403083 18:25459985-25460007 CTCTGCTGGTCCCAAAGGACTGG - Intergenic
1155540203 18:26862244-26862266 CAATGATGGCCCCCAGGCACTGG + Exonic
1155912782 18:31523879-31523901 CTATGCAGGACCCCAAGCACTGG + Intronic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1157522078 18:48352344-48352366 CCCTGCTGGCTGCTAACCACTGG + Intronic
1158017670 18:52803960-52803982 CCATGCTGGTGCCCAAGGACTGG - Intronic
1160209248 18:76862442-76862464 CCCTGCTTGGGCCCAAGCACCGG - Intronic
1160222377 18:76986503-76986525 CCATGCTCACTCCCAAGCACAGG - Intronic
1160673185 19:375955-375977 GCCTGCTGTCCCCCATACACCGG + Exonic
1160805901 19:992048-992070 ACCTGCTGGGCGCCGAGCACGGG + Exonic
1160827391 19:1086941-1086963 CCCACATGGCCACCAAGCACTGG + Exonic
1160909571 19:1468487-1468509 CCCTACAGCCCCCCAAGCACAGG + Exonic
1160993596 19:1871799-1871821 CCCTGCAGGACCCCACGCAGGGG - Intergenic
1161308000 19:3577965-3577987 CCCGCCTGTCCCCCAGGCACGGG + Exonic
1163105934 19:15123089-15123111 CCCCACTGGCCCCCAAGGACTGG + Intronic
1163475085 19:17521136-17521158 CCCTGCTGGCCGCCACTCTCCGG + Exonic
1163496572 19:17649404-17649426 CCTAGCTGGCCCCCAACCCCAGG + Intronic
1163637667 19:18444959-18444981 CCTTGCTGGGCACCAAGCCCAGG - Intronic
1163834462 19:19564728-19564750 CCATTCTGTCCCCAAAGCACAGG + Intronic
1164525247 19:29008733-29008755 CCCTGCTGGAGCCACAGCACAGG + Intergenic
1165812105 19:38617916-38617938 CCCTGCTGGCCCCTGGGCGCAGG - Exonic
1166139137 19:40796592-40796614 CCCTGCTGGGGCCCAGGCCCAGG + Exonic
1166733484 19:45071358-45071380 TCCTGCTGCGCCCCAGGCACTGG + Intergenic
1166990949 19:46692467-46692489 CCCTGCTCGCCCCCCAACTCTGG + Intronic
1167277225 19:48545731-48545753 CCCACCTGCCCCCCAAGCCCTGG - Intergenic
1167498355 19:49831842-49831864 CCCTGGTAGCCCCAAAGCTCAGG - Intronic
925480874 2:4272672-4272694 CCCTTGTGGCCCCCCTGCACTGG + Intergenic
925851166 2:8083594-8083616 CTCTGCTGGCTCCCTAGAACGGG + Intergenic
926783780 2:16499955-16499977 CCCTGTTGTACTCCAAGCACAGG - Intergenic
927298654 2:21484759-21484781 TCCTGCTGCACCCAAAGCACAGG - Intergenic
927492961 2:23532676-23532698 CCATGCTGACCCCAAACCACAGG - Intronic
927937742 2:27085079-27085101 CCCTGCTGGATCCCCAGCCCAGG - Intronic
928327266 2:30329336-30329358 CCCTCCTGACCCCCCAGCATAGG - Intergenic
928411887 2:31060716-31060738 ACCTGCTGGGCCCCAAGCACCGG - Intronic
928445860 2:31332846-31332868 CCCTGGTGCCCCCCAGGCCCAGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
934178123 2:89595440-89595462 CCCTGCTGAATGCCAAGCACTGG + Intergenic
934288423 2:91669731-91669753 CCCTGCTGAATGCCAAGCACTGG + Intergenic
938278599 2:130049575-130049597 ACCTGCTGGGCTCCAAGCCCTGG - Intergenic
938329576 2:130440434-130440456 ACCTGCTGGGCTCCAAGCCCTGG - Intergenic
938360372 2:130681069-130681091 ACCTGCTGGGCTCCAAGCCCTGG + Intergenic
938436775 2:131287777-131287799 ACCTGCTGGGCTCCAAGCCCTGG + Intronic
939561625 2:143739160-143739182 CACTGTTTGCCCCTAAGCACAGG - Intronic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
944117649 2:196206723-196206745 TCCTGCTTGCCCCAGAGCACAGG - Intronic
946325106 2:218981026-218981048 CCCTGCTTTCCCCTAACCACGGG + Intergenic
946471478 2:219964816-219964838 CCCTGCTGGCACCAAAGCAGTGG + Intergenic
947162356 2:227227272-227227294 CTCTGCTGGCCACAAGGCACTGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947602843 2:231465000-231465022 CCCTGCTTGCCCGCGAGCATGGG + Intronic
947747332 2:232515349-232515371 CCTTGCTGTCTCCCAAGCTCAGG + Intergenic
947999439 2:234555643-234555665 CCCTGATGGCCACCACGCAAAGG + Intergenic
948502296 2:238404674-238404696 CCCTGCCGGCTGACAAGCACCGG - Intergenic
948595816 2:239078752-239078774 CCCTGCTGGCGGGCAAGCCCAGG - Intronic
948837268 2:240631797-240631819 CCGTGCTGGCCCACACTCACAGG - Intergenic
1168747144 20:253355-253377 CCCTGCTGGCACCTTAGCTCTGG + Intergenic
1168800752 20:642258-642280 CCCCGCTGGCCCCCCACCACAGG - Intergenic
1168800795 20:642349-642371 CCCCGCTGGCCCCCCCCCACAGG - Intergenic
1169399115 20:5264854-5264876 TCCTGCTGTCTCCCATGCACGGG - Intergenic
1170038777 20:12018493-12018515 CCCTATTCGGCCCCAAGCACAGG + Intergenic
1170809816 20:19665216-19665238 CACTGTTGGCGCCCAAGCCCTGG - Intronic
1171350126 20:24495499-24495521 CCCTCCTGGCCCCAGACCACAGG - Intronic
1172847502 20:37938597-37938619 CCCTGCTTGCCCCACAGCTCAGG - Intronic
1172892177 20:38273363-38273385 CCCTGCTGGCCCCAAAGGCATGG + Intronic
1173176610 20:40769648-40769670 CCCTGATGTCCCCAAAGCAGAGG - Intergenic
1174343897 20:49915497-49915519 CGCTGCTGGCCCCCGGGTACTGG - Intronic
1174725663 20:52859198-52859220 CCCCACTAGCCCCTAAGCACTGG + Intergenic
1175198604 20:57263500-57263522 CACTGCCGGCCCATAAGCACTGG + Intronic
1175597640 20:60247999-60248021 CCCTGCTAGACCCCATGAACAGG - Intergenic
1176415901 21:6474641-6474663 TCCTGCTGCCCCCGGAGCACGGG + Intergenic
1178902090 21:36606136-36606158 CTCTGCAAGCCCCGAAGCACTGG - Intergenic
1178907210 21:36646635-36646657 CCATGCTGGCCTCAAAGCAGAGG - Intergenic
1179163041 21:38913305-38913327 CCCAGCTGGCCTCAGAGCACGGG + Intergenic
1179502855 21:41820919-41820941 CCCTGCTGCGCCCCCAGCTCTGG + Intronic
1179691401 21:43082975-43082997 TCCTGCTGCCCCCGGAGCACGGG + Intergenic
1179893463 21:44349413-44349435 CCCTGCTGGCCTCCATGTCCAGG - Intergenic
1179908283 21:44435294-44435316 CCCTCCCGGCCCCTGAGCACTGG - Intronic
1179925532 21:44532080-44532102 GGCTGCTGGCCCCCAAGCCCTGG + Intronic
1179939030 21:44626568-44626590 TCCTGCTGCCTCCCAAGCAAAGG + Intronic
1179979436 21:44888576-44888598 CCCTGCTGGGCCCACAACACTGG + Intronic
1179984029 21:44911426-44911448 CCCAGCTCTCCTCCAAGCACAGG - Intronic
1180158468 21:45988849-45988871 CTTTGCTGACCCCCAGGCACAGG - Intronic
1180975916 22:19848353-19848375 CTCTTCTGGCCCCCACACACTGG - Exonic
1181713593 22:24707316-24707338 TCCTGCTGGCCACCAGGCAGGGG - Intergenic
1182271381 22:29156106-29156128 CCCTGCTTGCCCCCAGGAAGGGG + Intronic
1182359003 22:29735708-29735730 CCCTGAATGCCCCCAAACACTGG + Intronic
1183251660 22:36734438-36734460 CCCTGCTGCAGCCCCAGCACAGG - Intergenic
1183742651 22:39677441-39677463 CCCTGCTGCACCCCCACCACGGG - Intronic
1184021900 22:41826634-41826656 CCCTGCAGCCCCCCACCCACAGG - Intergenic
1184357540 22:43992564-43992586 CCAAGCTGGGCCCCAAGCCCGGG - Intronic
949708262 3:6843298-6843320 CCCTGCTGGCACCAAAGCAGTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950220480 3:11191632-11191654 CCATGCTGGCCCCCAGGTTCTGG - Intronic
952631207 3:35469535-35469557 TCCTACTGGCCACCAAGGACAGG - Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954417238 3:50399238-50399260 CCCTTCTGGGCCACCAGCACTGG - Intronic
958022383 3:88013470-88013492 CCCTACTGGTCCCCAACCCCAGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960717051 3:120586221-120586243 CCCTTATGGCCCCCAAGTAGAGG - Intergenic
962174726 3:133141196-133141218 CCCTGCTGGCACCATAGCTCTGG - Intronic
962251536 3:133838959-133838981 CCATGCTGCCCTCCATGCACAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
966749331 3:183306895-183306917 CCCTGCTGGCCCCTCAGCAAGGG + Intronic
966910940 3:184559649-184559671 CCCTGCAGTCCCCCATGCCCCGG - Intronic
967986732 3:195100749-195100771 CCCTCCTCGCCCCCAAGCCTTGG + Intronic
968512415 4:1001434-1001456 CCTTGCTGTCCCCCCAGCACAGG - Intronic
968616494 4:1579800-1579822 CCCTGCGGGCCCCGCAGCGCTGG - Intergenic
968703691 4:2068743-2068765 CCCTGCTGGGCCCCAGGCCCCGG + Exonic
968914781 4:3492626-3492648 CCCTTCCAGCCCCCAAGCCCCGG - Intronic
969299462 4:6289109-6289131 CTCTTCTGTCCGCCAAGCACCGG - Exonic
969657578 4:8507079-8507101 GCCTGCTGGCCTCCAGGCCCAGG - Intergenic
969831125 4:9797953-9797975 CCCTGCTGAATGCCAAGCACTGG - Intronic
970794065 4:19891235-19891257 GCCTGCCTGCCTCCAAGCACTGG + Intergenic
970972070 4:21996516-21996538 CACTGCTGCCCCCCAAACCCTGG - Intergenic
973144285 4:46805121-46805143 TCGCGCTGGCCTCCAAGCACCGG + Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
975486960 4:74944469-74944491 CTCTGCTGGGCCTCCAGCACAGG - Intronic
975754795 4:77561919-77561941 TTGTGCTGGCCCACAAGCACTGG - Intronic
976688469 4:87842508-87842530 GCCTGATCGACCCCAAGCACGGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983484555 4:168318432-168318454 CCCTGCTGGCCCGGAAGGCCGGG - Intronic
983643801 4:169969538-169969560 CACTGCTGGCCCTGGAGCACTGG + Intergenic
985576498 5:675685-675707 CCCTGCTGGTCCCCTTGCTCTGG + Intronic
985886782 5:2686304-2686326 CCTTCCTGGCCCCTGAGCACCGG + Intergenic
985967934 5:3351906-3351928 CCAAGCTGGCCACCAAGCAGGGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987196400 5:15530810-15530832 CCCAGCTGGCCCCAAAGCATGGG - Intronic
989320108 5:40124013-40124035 CCATGCTGGGCCACAAGCATGGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995766400 5:115624627-115624649 CCCTGCTGACCCCCTTGCTCTGG + Intronic
997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG + Intronic
999171553 5:149599359-149599381 CCCTGCAGGCCCTCAGGCAGGGG + Intronic
999413980 5:151378855-151378877 CCCTTCTGGCCCTCAGGCCCAGG - Intergenic
999451232 5:151679667-151679689 TCCTGCTGGCAGCCAAGGACGGG - Intronic
1000190832 5:158909046-158909068 CCCTGCTGGCTTCCCAGCCCGGG - Intronic
1001595894 5:172898541-172898563 CCCTGATGGCGCCAAAGCCCAGG + Intronic
1004262279 6:14118381-14118403 ACCTGCTGGCCCACAACCACAGG - Intronic
1005860034 6:29893250-29893272 CCCTGCATGCCCCTAACCACTGG - Intergenic
1006020748 6:31116329-31116351 CCCTGCTCCCCACCAGGCACCGG - Exonic
1006435208 6:34022549-34022571 CCCTCCCGGCCCCAAACCACAGG - Exonic
1006898999 6:37488088-37488110 CCCTGCGGGGTCCCCAGCACTGG + Intronic
1007165055 6:39823377-39823399 ACCTGCTGGTCTCCAAGCTCAGG + Intronic
1007262797 6:40575495-40575517 CCATTTTGGCCCCCAAGCAAGGG - Intronic
1007751738 6:44075427-44075449 CCTTGGTGGCCCCCAGGCACAGG - Intergenic
1009705075 6:67239255-67239277 CCCTACTGGGCACCAGGCACAGG + Intergenic
1011264727 6:85503519-85503541 ACCTCCTGGCCCCCAACCACAGG - Intergenic
1013368181 6:109450063-109450085 CCCTTCTGGCCCCTGGGCACTGG - Exonic
1013429282 6:110041405-110041427 CCCTGATGGCTTCCAAGCAGGGG - Intergenic
1017043308 6:150324897-150324919 CCCAGCTGTCCTCCCAGCACAGG - Intergenic
1017877109 6:158534128-158534150 CCCTCCAGGCACCCATGCACTGG + Intergenic
1019552511 7:1610227-1610249 CCCTTGTGGACCCCACGCACTGG + Intergenic
1021808453 7:24379348-24379370 CCCTGTTGGCACCTAAGCAGCGG + Intergenic
1022505396 7:30906252-30906274 CCCTGCTGGCCCGAAAGGGCAGG - Intergenic
1022505722 7:30907794-30907816 CCCTGCTGGCCCCAGAGGAATGG + Intergenic
1026910125 7:74086746-74086768 CCCTGCTGGCACCCAGACAGGGG + Intronic
1029571602 7:101373294-101373316 CCTTGGTGTCCCCCAGGCACTGG - Intronic
1029607042 7:101605519-101605541 CCCTGCTGGCCCCGGAGGCCTGG - Intergenic
1029974138 7:104816811-104816833 CCCTGCTGGCCTCCTAGCCTCGG + Intronic
1030096643 7:105906519-105906541 GCCTTCTGTCCCCCAAACACTGG - Intronic
1033230801 7:139595943-139595965 CCCTGCTGGCTCCTTTGCACTGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035319170 7:158017423-158017445 CCCTCTCTGCCCCCAAGCACTGG - Intronic
1035319230 7:158017742-158017764 CCCTGCTGGCCGCCCAGCCCTGG - Intronic
1035368292 7:158362339-158362361 CCACCCTGGCCCCAAAGCACAGG + Intronic
1035543817 8:463444-463466 CCCTGCTGGCCCCCAGCCTGAGG + Intronic
1036047353 8:5158831-5158853 CCCTATTGGTGCCCAAGCACAGG + Intergenic
1036143998 8:6236028-6236050 CCCTGCTGGGCCCTAACCGCAGG - Intergenic
1036956109 8:13190238-13190260 CACTCGTGGCCACCAAGCACTGG - Intronic
1037482064 8:19314094-19314116 CCCTGCAAGCCCCCAGGCCCCGG - Intronic
1037674355 8:21041245-21041267 CCCTGCTGGCCACCTGGCCCTGG - Intergenic
1039828584 8:41195186-41195208 CCCTACTGGCTCCCAGGCTCGGG - Intergenic
1041167036 8:55101560-55101582 CGCTGCTGGCCTCCGAGCCCGGG + Intergenic
1041914834 8:63128274-63128296 CCCCGCTGGGCCTCAGGCACTGG + Intergenic
1048255827 8:132904521-132904543 CCCTGCTGGCCCCCACGGCCAGG - Intronic
1049003066 8:139838337-139838359 CCCTGCTGGACTGCAAGCTCTGG + Intronic
1049363732 8:142226529-142226551 CCCTGGTGGCCCCCAGAGACAGG + Intronic
1049543956 8:143220970-143220992 CCCTGCTGGCCCCGGAGCTCCGG - Intergenic
1049563906 8:143327547-143327569 CCCTGCTCGGCCACAACCACGGG + Intronic
1049607048 8:143534611-143534633 CCCTGCTGGCCTCCCAGAGCTGG + Intronic
1049778576 8:144417396-144417418 GCCTGCTGCCCCCCAAGCTGTGG + Intergenic
1052881440 9:33603092-33603114 ACCTGCTGGGCTCCAAGCCCTGG + Intergenic
1053480523 9:38413320-38413342 CCCTGAGGGCACCCAAGCACTGG - Exonic
1056863041 9:90204757-90204779 CCATGCTGTCCCCTAAGCACAGG - Intergenic
1056880481 9:90387046-90387068 CCCAGCTGGCCCCTGAGCTCTGG - Intergenic
1058001357 9:99869298-99869320 CCCTGATGGCTTCCAAGCAAAGG + Intergenic
1059459995 9:114423584-114423606 CCCTGCTACCCCCAAAGGACTGG + Intronic
1061179256 9:129014217-129014239 CCTTGGTGGCCCCCGAGCTCTGG - Intronic
1061398299 9:130355200-130355222 CCCTGCCGGCCCCACAGCCCAGG - Intronic
1061489990 9:130939376-130939398 CCCTGCGGGCCCCCGAGGTCTGG + Intergenic
1062116405 9:134811507-134811529 CCCTGCTGGCCCCGAGGCCCCGG - Exonic
1062447734 9:136602679-136602701 CCCTGCAGGCCCCCCAACCCCGG + Intergenic
1062517486 9:136943816-136943838 CCAGGCTGACCCCCAAGCGCAGG + Intronic
1185915618 X:4031366-4031388 CCCTGCTGGCCATGATGCACTGG + Intergenic
1186274736 X:7927200-7927222 CCCTGCCGGCCTCCAAGCCGCGG - Intronic
1186673671 X:11793489-11793511 CCCTCTTGTCCCCCAAGCTCTGG + Intergenic
1190216573 X:48482778-48482800 CCCTGCTGGCCCCTGAGGTCTGG + Exonic
1190336633 X:49266711-49266733 CCCTGCAGGCCTCCAAGCAGGGG - Intergenic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1195068806 X:101260528-101260550 CCATGATGTCCTCCAAGCACAGG - Exonic
1195683785 X:107567893-107567915 CACTGCTGTCCCTCCAGCACAGG - Intronic
1195942069 X:110175052-110175074 CCCTCCTGCTCCCCAAGCCCTGG - Exonic
1197716797 X:129714967-129714989 ATCTGGTGGGCCCCAAGCACAGG + Intergenic
1198023867 X:132685675-132685697 CACTTCTGGCCCCCAACCATAGG + Intronic
1199556452 X:149114230-149114252 CCCTGCCGGCCCACAAGGGCCGG + Intergenic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic
1200091345 X:153637537-153637559 CCCTGCTGCCCCCCATCCCCGGG - Intergenic
1200955294 Y:8938368-8938390 TCATGCTGGCCCTCGAGCACTGG - Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic
1202099181 Y:21287978-21288000 CCCTGCTGCCTCCCTAGCACAGG + Intergenic