ID: 1077395652

View in Genome Browser
Species Human (GRCh38)
Location 11:2319837-2319859
Sequence GACTCTCTGCAGTCTTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077395648_1077395652 3 Left 1077395648 11:2319811-2319833 CCAGGGTCCAGGGTCATATGCTG No data
Right 1077395652 11:2319837-2319859 GACTCTCTGCAGTCTTGTGGTGG No data
1077395647_1077395652 10 Left 1077395647 11:2319804-2319826 CCATTCACCAGGGTCCAGGGTCA No data
Right 1077395652 11:2319837-2319859 GACTCTCTGCAGTCTTGTGGTGG No data
1077395650_1077395652 -4 Left 1077395650 11:2319818-2319840 CCAGGGTCATATGCTGTAGGACT No data
Right 1077395652 11:2319837-2319859 GACTCTCTGCAGTCTTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077395652 Original CRISPR GACTCTCTGCAGTCTTGTGG TGG Intergenic
No off target data available for this crispr