ID: 1077395698

View in Genome Browser
Species Human (GRCh38)
Location 11:2320055-2320077
Sequence TAGGCTGGGAAGGAAAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077395691_1077395698 15 Left 1077395691 11:2320017-2320039 CCTTGGCTGGAAACAGCAGTACG No data
Right 1077395698 11:2320055-2320077 TAGGCTGGGAAGGAAAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077395698 Original CRISPR TAGGCTGGGAAGGAAAGTGC CGG Intergenic
No off target data available for this crispr