ID: 1077395773

View in Genome Browser
Species Human (GRCh38)
Location 11:2320438-2320460
Sequence CAGTGAAGTCCTATAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077395773_1077395776 -9 Left 1077395773 11:2320438-2320460 CCATATCCTATAGGACTTCACTG No data
Right 1077395776 11:2320452-2320474 ACTTCACTGCAGTCTTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077395773 Original CRISPR CAGTGAAGTCCTATAGGATA TGG (reversed) Intergenic
No off target data available for this crispr