ID: 1077396475

View in Genome Browser
Species Human (GRCh38)
Location 11:2325982-2326004
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077396475_1077396477 -3 Left 1077396475 11:2325982-2326004 CCTGTCATCATCCACAGATAACC No data
Right 1077396477 11:2326002-2326024 ACCACTCCGTTTTGAGAAACAGG No data
1077396475_1077396480 3 Left 1077396475 11:2325982-2326004 CCTGTCATCATCCACAGATAACC No data
Right 1077396480 11:2326008-2326030 CCGTTTTGAGAAACAGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077396475 Original CRISPR GGTTATCTGTGGATGATGAC AGG (reversed) Intergenic
No off target data available for this crispr