ID: 1077397700

View in Genome Browser
Species Human (GRCh38)
Location 11:2332932-2332954
Sequence AGACGGGCCCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077397700_1077397713 15 Left 1077397700 11:2332932-2332954 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 1077397713 11:2332970-2332992 CAGCTCATTGAGAACGGGCCAGG 0: 416
1: 98
2: 8
3: 5
4: 116
1077397700_1077397714 25 Left 1077397700 11:2332932-2332954 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 1077397714 11:2332980-2333002 AGAACGGGCCAGGATGACAATGG 0: 368
1: 806
2: 723
3: 375
4: 374
1077397700_1077397709 9 Left 1077397700 11:2332932-2332954 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 1077397709 11:2332964-2332986 GCCCAACAGCTCATTGAGAACGG 0: 406
1: 1143
2: 373
3: 77
4: 235
1077397700_1077397711 10 Left 1077397700 11:2332932-2332954 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 1077397711 11:2332965-2332987 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1077397700_1077397715 28 Left 1077397700 11:2332932-2332954 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 1077397715 11:2332983-2333005 ACGGGCCAGGATGACAATGGCGG 0: 344
1: 728
2: 777
3: 340
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077397700 Original CRISPR AGACGGGCCCAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr