ID: 1077400175

View in Genome Browser
Species Human (GRCh38)
Location 11:2351741-2351763
Sequence CAGGACCACCTGGAGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077400175_1077400180 -5 Left 1077400175 11:2351741-2351763 CCCCAAGTCTCCAGGTGGTCCTG No data
Right 1077400180 11:2351759-2351781 TCCTGCCCCCATGGCTTTGCCGG 0: 4
1: 8
2: 48
3: 183
4: 1099
1077400175_1077400184 1 Left 1077400175 11:2351741-2351763 CCCCAAGTCTCCAGGTGGTCCTG No data
Right 1077400184 11:2351765-2351787 CCCCATGGCTTTGCCGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077400175 Original CRISPR CAGGACCACCTGGAGACTTG GGG (reversed) Intergenic
No off target data available for this crispr