ID: 1077402972

View in Genome Browser
Species Human (GRCh38)
Location 11:2368089-2368111
Sequence CCCAGGTGCAGCATAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077402972_1077402976 -8 Left 1077402972 11:2368089-2368111 CCCATGGCTATGCTGCACCTGGG No data
Right 1077402976 11:2368104-2368126 CACCTGGGGACATGAAGCCTAGG No data
1077402972_1077402977 -7 Left 1077402972 11:2368089-2368111 CCCATGGCTATGCTGCACCTGGG No data
Right 1077402977 11:2368105-2368127 ACCTGGGGACATGAAGCCTAGGG No data
1077402972_1077402981 17 Left 1077402972 11:2368089-2368111 CCCATGGCTATGCTGCACCTGGG No data
Right 1077402981 11:2368129-2368151 AGCTCAGCCAGCTCTGGTCACGG No data
1077402972_1077402980 11 Left 1077402972 11:2368089-2368111 CCCATGGCTATGCTGCACCTGGG No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077402972 Original CRISPR CCCAGGTGCAGCATAGCCAT GGG (reversed) Intergenic
No off target data available for this crispr