ID: 1077402978

View in Genome Browser
Species Human (GRCh38)
Location 11:2368106-2368128
Sequence ACCCTAGGCTTCATGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077402978_1077402981 0 Left 1077402978 11:2368106-2368128 CCTGGGGACATGAAGCCTAGGGT No data
Right 1077402981 11:2368129-2368151 AGCTCAGCCAGCTCTGGTCACGG No data
1077402978_1077402980 -6 Left 1077402978 11:2368106-2368128 CCTGGGGACATGAAGCCTAGGGT No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077402978 Original CRISPR ACCCTAGGCTTCATGTCCCC AGG (reversed) Intergenic
No off target data available for this crispr