ID: 1077402980

View in Genome Browser
Species Human (GRCh38)
Location 11:2368123-2368145
Sequence TAGGGTAGCTCAGCCAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077402968_1077402980 22 Left 1077402968 11:2368078-2368100 CCCCTGGGCGTCCCATGGCTATG No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data
1077402969_1077402980 21 Left 1077402969 11:2368079-2368101 CCCTGGGCGTCCCATGGCTATGC No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data
1077402972_1077402980 11 Left 1077402972 11:2368089-2368111 CCCATGGCTATGCTGCACCTGGG No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data
1077402970_1077402980 20 Left 1077402970 11:2368080-2368102 CCTGGGCGTCCCATGGCTATGCT No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data
1077402974_1077402980 10 Left 1077402974 11:2368090-2368112 CCATGGCTATGCTGCACCTGGGG No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data
1077402978_1077402980 -6 Left 1077402978 11:2368106-2368128 CCTGGGGACATGAAGCCTAGGGT No data
Right 1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077402980 Original CRISPR TAGGGTAGCTCAGCCAGCTC TGG Intergenic
No off target data available for this crispr