ID: 1077404566

View in Genome Browser
Species Human (GRCh38)
Location 11:2377398-2377420
Sequence GCGCGGGGGCGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1894
Summary {0: 6, 1: 6, 2: 31, 3: 276, 4: 1575}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077404566_1077404579 4 Left 1077404566 11:2377398-2377420 CCCGCGCCCCCGCGCCCCCGCGC 0: 6
1: 6
2: 31
3: 276
4: 1575
Right 1077404579 11:2377425-2377447 TTCTTCGCGCCCCCGCCCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 78
1077404566_1077404581 13 Left 1077404566 11:2377398-2377420 CCCGCGCCCCCGCGCCCCCGCGC 0: 6
1: 6
2: 31
3: 276
4: 1575
Right 1077404581 11:2377434-2377456 CCCCCGCCCCTCGGCCCGCCAGG 0: 1
1: 1
2: 4
3: 97
4: 638
1077404566_1077404588 25 Left 1077404566 11:2377398-2377420 CCCGCGCCCCCGCGCCCCCGCGC 0: 6
1: 6
2: 31
3: 276
4: 1575
Right 1077404588 11:2377446-2377468 GGCCCGCCAGGCCCCCTTGCCGG 0: 1
1: 0
2: 2
3: 30
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077404566 Original CRISPR GCGCGGGGGCGCGGGGGCGC GGG (reversed) Exonic
900113727 1:1020057-1020079 GCGGGCGGGCGGGGGGGGGCGGG - Intergenic
900126052 1:1069409-1069431 GCGCTGGGGGGAGGGGCCGCCGG - Intergenic
900162825 1:1232416-1232438 GCGCGGGCGCGGGGGGAGGCGGG - Exonic
900162831 1:1232426-1232448 GCGGCGGCGCGCGCGGGCGCGGG - Exonic
900213165 1:1467396-1467418 GGTCGGGGGCCCGGGAGCGCAGG - Intronic
900218376 1:1494452-1494474 GGTCGGGGGCCCGGGAGCGCAGG - Intronic
900218392 1:1494506-1494528 GGTCGGGGGCCCGGGAGCGCAGG - Intronic
900221679 1:1512480-1512502 GCGGCGGGGCGGGGCGGCGCGGG + Intronic
900221683 1:1512488-1512510 GCGGGGCGGCGCGGGCGGGCGGG + Intronic
900225733 1:1532929-1532951 GGTCGGGGGCCCGGGAGCGCAGG - Intronic
900227612 1:1540387-1540409 GGCCGGGGCCGGGGGGGCGCCGG - Intronic
900237594 1:1600123-1600145 GCGCGGGGGCGGGTCGGAGCGGG - Intergenic
900240707 1:1616034-1616056 GCTCGGGGGCGCGGGACCGCCGG - Intronic
900244271 1:1630316-1630338 GCGCGGCGGGCCGGGGGCGGGGG - Exonic
900283912 1:1890496-1890518 GGCCGGGGCCCCGGGGGCGCGGG - Intronic
900349758 1:2228712-2228734 CCGGGGGGGCCCGGGCGCGCGGG + Exonic
900353400 1:2247994-2248016 ACGGGGGGGCGCGGTGGCGGGGG + Intronic
900386698 1:2413925-2413947 CCAAAGGGGCGCGGGGGCGCTGG - Intergenic
900389351 1:2427308-2427330 TCGTGGGGGCCCGGGGCCGCAGG + Intronic
900393556 1:2444026-2444048 GCGCGGGGGCGCCGCAGCCCTGG + Intronic
900414742 1:2529779-2529801 GCGGCGGGGCGCGGGGGAGCCGG + Intronic
900460495 1:2800269-2800291 GCGCGGGGAGGTGGGGCCGCTGG + Intronic
900577982 1:3393845-3393867 GCGGGGCGGGGCGGGGGCGGGGG - Intronic
900581717 1:3412835-3412857 GGGCGGGGCCGCGGCGGTGCTGG + Intronic
900583533 1:3421247-3421269 GCTCAGGGGCTCGGGGGCCCTGG + Intronic
900607877 1:3531813-3531835 GGGCGGGGGAGGGGGGCCGCGGG + Intronic
901019106 1:6246944-6246966 GGGCGGGCGCGCGGGGGGACAGG + Intergenic
901061681 1:6474649-6474671 GGGCGGGGGCTCGTGGGGGCGGG - Intronic
901088233 1:6625125-6625147 GCGGGGAGGGGCGGGGCCGCTGG - Intronic
901088287 1:6625298-6625320 AGGCGGGGACCCGGGGGCGCGGG + Intronic
901109772 1:6785439-6785461 GGGCGGGTGCGCGGCGGCGGCGG + Exonic
901332768 1:8423730-8423752 GCGCGGGGCCCGGGGGGCGCGGG + Intronic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
901577253 1:10210813-10210835 GCCGCGGCGCGCGGGGGCGCGGG - Exonic
901628955 1:10638965-10638987 GCGCGGGGCCGGGGGCGCCCAGG + Exonic
901875904 1:12167046-12167068 GCGCGAGGGCGCGAGGGCAGGGG + Exonic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902044332 1:13513727-13513749 GCCCGGGCGTGCGGGGGCGATGG + Exonic
902089643 1:13893097-13893119 GCGCGGGGACGCGGGAGCCCAGG + Intergenic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902410000 1:16206917-16206939 GCGCGGGGACCCGGCGGGGCGGG - Intronic
902586105 1:17439294-17439316 GCGCAGGGACGCCGGGGAGCTGG - Intronic
902586195 1:17439809-17439831 GCCGGGCGGGGCGGGGGCGCCGG - Intergenic
902813453 1:18902492-18902514 GCGCGGCGGAGCGCGGGCGCCGG + Exonic
902842865 1:19086332-19086354 GGGCGGGGGGGCGGGGGTGGGGG + Intronic
902893339 1:19461087-19461109 GGGCGGGGGCGGGGGGGGGAGGG + Intronic
903078130 1:20787375-20787397 GCGAGGGGGCGCGCGGGGACGGG + Intergenic
903078132 1:20787385-20787407 GCGCGGGGACGGGCGGACGCCGG + Intergenic
903155610 1:21440445-21440467 GCGCGGGGGCGGGTGGGAGGTGG + Intronic
903184764 1:21622665-21622687 GCGCGGTGTCCCGGGGCCGCGGG - Intronic
903190275 1:21652169-21652191 GCGCGGCGGCTCGAGGGGGCGGG - Intronic
903193478 1:21669144-21669166 GCGCGGGCGGGCGGGGACGGAGG - Intronic
903233967 1:21937560-21937582 GGGCGGGGGACCGGGGGCCCGGG + Intergenic
903233993 1:21937634-21937656 GCGCGGGGAAGCGGGGGAGCCGG - Intergenic
903349744 1:22710695-22710717 TCGCGGCGGCGCGCGGCCGCCGG + Intergenic
903349992 1:22711420-22711442 GCGGGGGGCGGGGGGGGCGCCGG + Intronic
903468349 1:23568091-23568113 GGGTGGGGCCGCCGGGGCGCGGG - Intergenic
903555032 1:24187162-24187184 GCGCGGGGCCGCGGGAGGGAGGG - Intronic
903596989 1:24502743-24502765 GCGGGGGCGCGCGGGGGCCGGGG - Intronic
903596991 1:24502745-24502767 GGGCGGGGGCGCGCGGGGGCCGG - Intronic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903813254 1:26046369-26046391 CCGCGCGGGAGAGGGGGCGCAGG - Intergenic
903907816 1:26697850-26697872 GTGAGGGGGTGAGGGGGCGCTGG + Intronic
903925230 1:26826923-26826945 GCGCGGCGGGGCGGGGGCGGCGG - Exonic
904181365 1:28668884-28668906 GGGCGGGGGGGCGGGCGCGGGGG + Intronic
904181377 1:28668921-28668943 GCGAGGGCGGGCGGGCGCGCAGG + Intronic
904528847 1:31155131-31155153 GGGCGCGGGCGCGGGGCCGGAGG + Intergenic
904598792 1:31662666-31662688 GCGGGGGGGGGGGGCGGCGCTGG - Intronic
904618951 1:31764146-31764168 GGGCGGGGGAGCGGGGGAGCGGG - Intronic
904772208 1:32886632-32886654 GCCCCGGGTGGCGGGGGCGCTGG + Intronic
904775087 1:32901431-32901453 CCGCGGGGGCGCTGCGGGGCCGG - Intronic
904837773 1:33349958-33349980 GCGGGGAGGGGCGGGGCCGCGGG + Intronic
905028545 1:34866787-34866809 GCGCGGGGGAGCGGGGTTGGGGG - Intronic
905066867 1:35192148-35192170 GCGCGGGGGCGGGGGCGAGGAGG + Intronic
905124612 1:35708038-35708060 GCGGGGCGGCGCGTGGGGGCGGG + Intergenic
905337555 1:37256066-37256088 GAGCGGGGGAGGGGGGGCGGTGG - Intergenic
905337559 1:37256074-37256096 GGGCGGGGGAGCGGGGGAGGGGG - Intergenic
905448915 1:38045075-38045097 GCCCGGGGGGGCAGGGGCGGGGG + Exonic
905505585 1:38476582-38476604 GAGCGGAGGGGCAGGGGCGCGGG - Intergenic
905518385 1:38578708-38578730 GGGCGGGGTCGGGCGGGCGCGGG + Intergenic
905617153 1:39409030-39409052 GCGCGGCGGCGCGGGGAAGGGGG + Intronic
905862534 1:41361188-41361210 GCGCGGAGGCGGGGGGGCTAGGG - Intergenic
906032418 1:42732315-42732337 GCGGGGGGCGGCGGGAGCGCTGG - Intergenic
906125052 1:43422657-43422679 GCGGGGGGGTGGGGGGGCGGGGG - Intronic
906130661 1:43453543-43453565 GCTGGGGGGTGCCGGGGCGCGGG - Intronic
906197133 1:43936244-43936266 GCGAGGGGGCGGGGCGGGGCTGG + Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906495736 1:46302885-46302907 GCTCGGGGGCGCGGGGGGCGAGG - Intronic
906517478 1:46448210-46448232 GCGCGCGGCCTCGGGAGCGCTGG + Intergenic
906534495 1:46544100-46544122 GCGCAGGGGCGGGGGGGCCCAGG - Intergenic
906615832 1:47232239-47232261 GGGCGGGGGAGCGGGGGCCGCGG - Intergenic
907051099 1:51330403-51330425 GCTGGGAGGCCCGGGGGCGCGGG - Intronic
907278006 1:53327613-53327635 CCGCGGGGGCGGGGGGCCGAGGG + Intronic
907294288 1:53439612-53439634 GCGAAGGGGCGCCGGGGCGAAGG - Intergenic
907341337 1:53738328-53738350 GCGCCGCGGCGCGGGGGCCTGGG - Intergenic
907767352 1:57424134-57424156 GCGGCGGGGCGGGGGGCCGCGGG - Intronic
907849002 1:58236098-58236120 GCGGGGTGGGGCGGGGGGGCGGG - Intronic
907909726 1:58815415-58815437 GCGCCGGGCCGCGGGGGAGGCGG + Intergenic
908501103 1:64744889-64744911 GCGCGGGCGCGCCTGTGCGCCGG + Intergenic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
908534760 1:65067159-65067181 GCGGCGGAGCGCGGGGGCGGCGG - Intergenic
908534874 1:65067566-65067588 GCGGCCGGGCGCGGGGGCGGCGG - Intergenic
908557014 1:65266020-65266042 GCTCGGGGGCTTGGGTGCGCAGG + Intronic
910199976 1:84690001-84690023 GCGCGGGGACGTGGGGGAGGAGG - Intronic
910337680 1:86154133-86154155 GCGGGGTGGGGCGGGGGGGCTGG - Intronic
911072969 1:93846972-93846994 GCGCGGCGGCGCTCGCGCGCAGG + Intronic
911133827 1:94418432-94418454 GCGAGGGGACGCGGCGGCGGCGG - Intergenic
912185511 1:107270703-107270725 GGGTGGGGGGGCGGGGGCGGGGG - Intronic
912401601 1:109397928-109397950 GCGGGGGTGGGCGGGCGCGCCGG - Exonic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
912716830 1:111989374-111989396 GTGGGTGGGCGCTGGGGCGCCGG - Intergenic
914001649 1:143699686-143699708 GGGTGGGGGTGCGGGTGCGCGGG - Intergenic
914490000 1:148146127-148146149 GCCCTGGGGCCCGGGGGCGCGGG + Intronic
914703024 1:150150616-150150638 GGACGGGGCGGCGGGGGCGCAGG + Intronic
915213387 1:154325723-154325745 GCGGGGGCGCCCGGGAGCGCGGG + Intronic
915559229 1:156676767-156676789 GCGGGGCGGCGCGGGGCAGCGGG + Exonic
915571440 1:156747245-156747267 GGGCGGGGGGGGGGGGGCGGGGG - Intronic
915977461 1:160400547-160400569 GCGCAGGGGGGAGGGGGCGGAGG - Intergenic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
916107305 1:161441294-161441316 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916108892 1:161448712-161448734 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916108950 1:161448925-161448947 GCGCCGGGGCGCGTCGCCGCTGG - Intergenic
916110480 1:161456093-161456115 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916110538 1:161456306-161456328 GCGCCGGGGCGCGTCGCCGCTGG - Intergenic
916112065 1:161463503-161463525 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916112123 1:161463716-161463738 GCGCCGGGGCGCGTCGCCGCTGG - Intergenic
916113652 1:161470884-161470906 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916113710 1:161471097-161471119 GCGCCGGGGCGCGTCGCCGCTGG - Intergenic
916651767 1:166839896-166839918 GCCCGGGGGCGCGGCGGCGGTGG + Intronic
916666994 1:166975589-166975611 GGGCGGCGGGGCGGAGGCGCGGG - Intronic
916714743 1:167439435-167439457 GCGAGGGCGCGCAGGGGAGCCGG + Intronic
916773634 1:167937011-167937033 GAGCGGGGGCCCCGGGGCGGAGG + Intronic
916792634 1:168137046-168137068 GCGCGGGTGGGGAGGGGCGCCGG - Intronic
917797525 1:178542735-178542757 CGGCGGGGGCGCGGGGGCGTCGG - Intronic
917906603 1:179591820-179591842 GCGCTGGTGCGCAGGCGCGCGGG + Exonic
917962302 1:180154774-180154796 GGGCGGGGGCTCGGGGGCGGGGG + Intergenic
917962389 1:180155190-180155212 GCGGCGGGGCACGGGGGAGCGGG - Intronic
918066573 1:181105503-181105525 GCGGGGCGGGGCGGGGGCGGGGG + Intergenic
918244013 1:182643318-182643340 GCGCGGGGGCGGGGGGGCTGGGG - Intergenic
919895707 1:202008455-202008477 GTGCGGGGGCGGGGGGGCGGGGG + Exonic
920255623 1:204652258-204652280 GCGGGGGGGCGGGGGGGGGGCGG - Intronic
920528460 1:206685204-206685226 GCCCGGGGACGCCGGGGCACAGG - Exonic
920572132 1:207025084-207025106 GGGCGGGGGCGGGGAGGCGGGGG + Intronic
920912907 1:210233874-210233896 GGGCTGGAGCGCGGGGGCCCGGG + Intronic
921029698 1:211326758-211326780 GGGCGCGGGCGGAGGGGCGCGGG - Intronic
921039597 1:211416877-211416899 GCGGCGGGGCGCGCGGGCTCCGG - Intergenic
921138752 1:212285757-212285779 AGGCGGGGGCACGGGGGTGCGGG - Exonic
921189874 1:212699785-212699807 GCGCGCGGGCGGGGCGGGGCGGG - Exonic
921207115 1:212858418-212858440 GCGGGGGAGCGAGGTGGCGCCGG + Exonic
921383838 1:214551019-214551041 GCGCGGGGTGGCCGGGCCGCAGG - Intronic
921390538 1:214609087-214609109 GCCCTGGGGCCCAGGGGCGCGGG - Intronic
922766395 1:228158681-228158703 GGGCCGCGGCGCGGGGGCGGGGG - Exonic
922809242 1:228406716-228406738 GCGCGGGGACTCCAGGGCGCAGG + Exonic
922817111 1:228457670-228457692 GCGCGTGGGCGCCGGCGCCCCGG - Exonic
922821407 1:228487919-228487941 GGGCGGGGGCGGAGAGGCGCAGG - Intronic
922841996 1:228650244-228650266 GCGCTGGGTCGCTGGGTCGCTGG + Intergenic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
922958553 1:229625807-229625829 GCGCGGGCGGGCGGGGGCCGGGG - Intronic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
922958617 1:229626008-229626030 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
923400760 1:233614037-233614059 GGGCGGGCGCGCGGGGGAGCGGG + Exonic
923401573 1:233619921-233619943 GGGCGGGGGGGCGGGGGGGCAGG + Intronic
923401575 1:233619923-233619945 GCGGGGGGGCGGGGGGGCAGGGG + Intronic
923490417 1:234478940-234478962 GCGCGCGGCAGCGGGGGCGCAGG - Exonic
923684141 1:236142399-236142421 GGGCCGGGGCGGGGGCGCGCGGG + Intergenic
923684145 1:236142405-236142427 GGGCGGGGGCGCGCGGGCCGGGG + Intergenic
923684151 1:236142419-236142441 GGGCCGGGGCGGGGGCGCGCGGG + Intergenic
924289659 1:242524518-242524540 GCGGGCGGGGGCGGGGGCGGGGG + Exonic
924381975 1:243473921-243473943 GCGGGGGGGGGGGGGGGGGCCGG + Intronic
924436568 1:244048626-244048648 GGGCGGGGGCGGGGGGGGGGCGG - Intergenic
924436574 1:244048634-244048656 GGGTGGGGGGGCGGGGGCGGGGG - Intergenic
924801253 1:247331106-247331128 GCGCCGGTGCTCGGGGGGGCGGG - Intronic
924803866 1:247347578-247347600 GAGCGGGGGGGGGGGGGGGCGGG - Intergenic
1062843695 10:689419-689441 GCGCGGAGGGCTGGGGGCGCGGG - Intronic
1062857516 10:786651-786673 GTGCGGGGGCGGGGTGGGGCGGG + Intergenic
1062858003 10:789159-789181 GCTCCGGGGCCAGGGGGCGCTGG + Intergenic
1062874158 10:931730-931752 GCGCGGGTCCGCGCGGGGGCGGG - Intergenic
1062932675 10:1363280-1363302 GCCCGGGGCCGCGGGGGTGGCGG + Exonic
1063115129 10:3067490-3067512 GGGCGGGGGCGCGGGCGGGGCGG + Intronic
1063146379 10:3298510-3298532 GGAGGGGGGCGCGGGGGCACTGG + Intergenic
1063417653 10:5887670-5887692 GGGCGGGGGCGCGGGTGCAGTGG - Intronic
1063417654 10:5887678-5887700 GGGGGTGGGGGCGGGGGCGCGGG - Intronic
1063458957 10:6203455-6203477 GCGGGGCGGGGCGGAGGCGCGGG + Intronic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1063663886 10:8050656-8050678 GCGCCGGGGCTCCGGGGCTCCGG + Intergenic
1064009597 10:11725035-11725057 GGGCGGGGGGGCGGGGGCAGGGG + Intergenic
1064009600 10:11725043-11725065 GGGCGGGGGCAGGGGGGAGCTGG + Intergenic
1064086530 10:12349762-12349784 GCGCGCTGGGGAGGGGGCGCCGG - Exonic
1064185922 10:13161708-13161730 GCGCGGGGTCCCGGGAGCTCGGG + Intronic
1064230919 10:13528878-13528900 GGGCCGGGGCGCGGCGGCGGCGG + Intronic
1064244319 10:13657149-13657171 GCGCGGGGGTGCGGGGGGCGCGG - Exonic
1065025063 10:21534015-21534037 GCGCGGGGGCGCGCACGCGGGGG - Intergenic
1065046592 10:21751883-21751905 GCGGGGGGGGGGGGGGGGGCGGG + Intergenic
1065204387 10:23343847-23343869 GGGCCGGGGCGCGAGGGCTCCGG + Intronic
1065968196 10:30785371-30785393 GCGCGGGGACACGGGGTCCCAGG + Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1066126464 10:32347199-32347221 GCGCAGCGGCGCGGGCACGCGGG + Intronic
1066460463 10:35608300-35608322 GCGCGTGCACCCGGGGGCGCCGG - Exonic
1066464238 10:35639521-35639543 GGGCGGGGGCGCGGGCGCCACGG - Exonic
1067091356 10:43267107-43267129 GCGGGGGAGCGGGCGGGCGCGGG + Intergenic
1067103714 10:43351276-43351298 GGGCGGGGGAACGGGGGCCCGGG - Intergenic
1067227404 10:44385007-44385029 GCGCGGGCGGGCGGGCGGGCGGG + Exonic
1067453767 10:46398358-46398380 GCGCGCGGGGGCGGGCGCGCGGG + Intergenic
1067583460 10:47461388-47461410 GCGCGCGGGGGCGGGCGCGCGGG - Intronic
1067633464 10:47986736-47986758 GCGCGCGGGGGCGGGCGCGCGGG - Intergenic
1068538642 10:58267951-58267973 GCGGGAGGGGGCGGGGGCGCAGG - Intergenic
1068783263 10:60944059-60944081 GCGCGCGGTCGCGGGTGTGCGGG + Exonic
1068900982 10:62268833-62268855 GCGCGGCGGGGCGGGGGAGAGGG + Intergenic
1069470726 10:68687131-68687153 AGGCGGGGGCGGGGGGGCGGGGG - Intronic
1069738521 10:70672902-70672924 GCGCGGGGGCCCGTGGGGTCCGG + Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1069898552 10:71694276-71694298 GCGAGGGGGAGCTGGGGCACGGG - Intronic
1070570786 10:77638178-77638200 GCGCAGGGGCGCCCGGGCGGAGG - Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1070954261 10:80454224-80454246 GCGCGGAGGGGCGGGGCCGGAGG - Exonic
1070954264 10:80454232-80454254 GCGGAGGGGCGCGGAGGGGCGGG - Exonic
1071997740 10:91163567-91163589 GCGCCGGGGCGCGCGGCTGCCGG - Intronic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1072591664 10:96832864-96832886 GCGTGGGGGAGGGGTGGCGCAGG - Intronic
1073088531 10:100912703-100912725 GCGCGGGGGCGGAAAGGCGCGGG - Intronic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073441461 10:103555220-103555242 GTGGGGGCGCGTGGGGGCGCGGG + Intronic
1073905784 10:108277441-108277463 GAGCGGGGGGGTGGGGGGGCGGG + Intergenic
1074121582 10:110497764-110497786 GGGCGGGGCAGCGGGGGCGAGGG - Intergenic
1074121772 10:110498535-110498557 GGGAGGGGACCCGGGGGCGCCGG - Intronic
1074169734 10:110920000-110920022 GCGAGCCGGCGCGAGGGCGCGGG + Intronic
1074503349 10:114044991-114045013 GCGGCGGGGCGCGGGGGTCCGGG - Exonic
1074829912 10:117241093-117241115 GAGCGGCGGCGGCGGGGCGCTGG + Exonic
1074864649 10:117537684-117537706 GCCCGAGGGCGGGGGAGCGCTGG - Intergenic
1075031970 10:119029834-119029856 GCGGGGGGGCGCGGCCGCGGCGG - Exonic
1075430299 10:122374772-122374794 CCGCGGCGGCGCGGGTGCTCCGG + Exonic
1076163737 10:128265980-128266002 ACGGTGGGGCGCGGGGTCGCTGG + Intergenic
1076314074 10:129528522-129528544 GAGCGGGGGCGTGGGTGCGATGG + Intronic
1076314183 10:129529179-129529201 GAGCGGGGGCGTGGGTGCGATGG + Intronic
1076371479 10:129958900-129958922 GCGGCGGGCGGCGGGGGCGCGGG - Intronic
1076373910 10:129971355-129971377 GTGCGTCGGCGCGGGGGCGGGGG + Intergenic
1076404670 10:130203874-130203896 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1076404676 10:130203884-130203906 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1076480597 10:130782802-130782824 GCGCAGGGGCGGGGGGCAGCAGG - Intergenic
1076722050 10:132397056-132397078 GGCCGGGGGCGCGCGGCCGCGGG - Intergenic
1076792921 10:132786252-132786274 CGGCGGGGGCGCGCGGGCGGGGG - Intergenic
1076880884 10:133238532-133238554 GTGCTGGGGGGCGGGGGCGGGGG - Intronic
1076909281 10:133379220-133379242 GCGAGGGGGCGGGGAGGCGCTGG - Exonic
1077008548 11:370048-370070 CGGCGGGGGCCCCGGGGCGCGGG + Intronic
1077009221 11:372796-372818 GGGCTGGGGCGGGGGGGCGGCGG + Intronic
1077018482 11:407194-407216 GGGCGGGGGCGGGGGAGGGCGGG + Intronic
1077043679 11:535321-535343 GGCCGGGGGCGCGGGGCCGGCGG - Intronic
1077049646 11:560957-560979 GCCCGGGTGCGCCGCGGCGCTGG + Intronic
1077053162 11:576727-576749 GCGGGCGGGCGCGCGCGCGCTGG + Intronic
1077065534 11:639555-639577 GCGCCGGGGCGCGGGCGGGGAGG - Intronic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077065542 11:639571-639593 CGGGCGGGGCGCGGGGGCGCCGG - Intronic
1077076885 11:706086-706108 GGGCGGGCGCGCGGGGGAGGAGG - Intronic
1077107894 11:849811-849833 GCGCGCGGGGTCGGGGGCGCGGG + Intronic
1077107896 11:849813-849835 GCGCGGGGTCGGGGGCGCGGGGG + Intronic
1077142799 11:1031779-1031801 GGGCCGGGGCCCGGGGGCTCGGG - Intronic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077419735 11:2444727-2444749 GGGGGTGGGGGCGGGGGCGCAGG + Intronic
1077437512 11:2549910-2549932 GCGCTGGGTGGCGGGGGCGGTGG - Intronic
1077480608 11:2812746-2812768 GCGTGGGGCCTCGGGGGCGTGGG - Intronic
1077496331 11:2888266-2888288 GCGCGGGGTTGGGGGGGCGGGGG + Exonic
1077575336 11:3378877-3378899 GCGCCGGGGCGCGCGGGGCCCGG + Intronic
1077877556 11:6320603-6320625 GCGGGAGGGCGCGAGGGCGTGGG + Exonic
1077923092 11:6655862-6655884 GGGCGGAGGGGCGGGGGCTCGGG - Intergenic
1077923105 11:6655891-6655913 GCGGGTGGGGGCGGGGGCGGGGG - Intergenic
1078771760 11:14358622-14358644 GCCAGGGGGCGGGAGGGCGCGGG - Intronic
1079035135 11:17014260-17014282 GGGTGGGGGCGCGGGGGCGGGGG - Intronic
1079035149 11:17014280-17014302 ACCCGGGGACGCGGGGACGCGGG - Intronic
1079035152 11:17014288-17014310 GCGCGAGGACCCGGGGACGCGGG - Intronic
1079035200 11:17014433-17014455 GGGGGAGGGGGCGGGGGCGCGGG + Intronic
1079056165 11:17208114-17208136 GCGCTGGGGCGCACGGGCCCGGG + Intergenic
1079251678 11:18791838-18791860 GCCCGGGGGCGGGGCGGAGCCGG - Exonic
1079408156 11:20163022-20163044 GGGCGGGGGCGAGGGGGCGAGGG + Intergenic
1080360916 11:31512786-31512808 GGGCGGGGGAGGGGGGGCGGAGG - Intronic
1080384825 11:31805140-31805162 GCGCGGGGTCGCGGGCCGGCCGG - Intronic
1081831976 11:46121706-46121728 GGGCCGAGGCGCGGGGGCCCGGG - Intergenic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1082787420 11:57324632-57324654 GCGCGTGTGCGCGGAGGCGGAGG - Intronic
1082787483 11:57324811-57324833 GCGCGGGGGCGGTCGGGCGAAGG - Intronic
1083303798 11:61752674-61752696 GCCCGGGGGCGCGGCATCGCCGG - Exonic
1083317919 11:61827874-61827896 ACGCGGGAGGGCGGGGGAGCCGG + Exonic
1083323925 11:61863791-61863813 GCGCGGGGCTGCGGGGAGGCGGG + Intronic
1083419760 11:62546212-62546234 TCGCGGAGGCGCGGAGGCGCTGG + Intronic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1083436336 11:62646214-62646236 GCGCGGGGTCGTCGGGGCGGGGG - Intronic
1083457111 11:62786693-62786715 GCCAGGGGGCGCGGGGCCGGAGG + Exonic
1083572659 11:63768643-63768665 GCCCCGGGGCGGCGGGGCGCGGG + Exonic
1083572665 11:63768651-63768673 GCGGCGGGGCGCGGGGCCGCGGG + Exonic
1083572668 11:63768659-63768681 GCGCGGGGCCGCGGGGCCGGCGG + Exonic
1083660019 11:64247565-64247587 GGGCGGGGGAGGGGCGGCGCCGG - Intergenic
1083667882 11:64285383-64285405 GAGCAGGGCCGCGGGCGCGCCGG + Intronic
1083667887 11:64285391-64285413 CCGCGGGCGCGCCGGGGCGAGGG + Intronic
1083684782 11:64369640-64369662 GCGGGGCGGAGCGGTGGCGCCGG + Intronic
1083747713 11:64744866-64744888 GCGCGGGGGCGGGGGCGGGGCGG - Intronic
1083758425 11:64803264-64803286 GCCCGGGGGCGGGGCCGCGCCGG + Intergenic
1083763539 11:64831638-64831660 GCGAGGGGGAGCGGGAACGCTGG - Exonic
1083766714 11:64844817-64844839 GGGCGGAGGCGCGCGGGGGCGGG + Intergenic
1083766804 11:64845143-64845165 GGGCGGGGGCGGGGGGGCGATGG - Intergenic
1083922324 11:65787526-65787548 GCGGGCGGGCGGGCGGGCGCAGG + Intronic
1083945696 11:65921376-65921398 GCTGAGGGGCCCGGGGGCGCTGG - Exonic
1083958837 11:66002708-66002730 GCGCGTGGGAGCCGGGCCGCGGG + Intronic
1083995225 11:66268452-66268474 GGGAGTGGGCGCGGAGGCGCGGG + Intergenic
1084146150 11:67266423-67266445 GCTCCGGGGCGCGGGCGCGCGGG + Exonic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084190098 11:67494810-67494832 GCGAGTGGGCGAGGGGGCGAGGG + Intronic
1084193342 11:67508872-67508894 GCGCGGGGCCTTGGGGGTGCGGG - Intergenic
1084257944 11:67955446-67955468 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1084319157 11:68363952-68363974 CGGCTGGGGCGCGGGGGCGAGGG + Intronic
1084319161 11:68363960-68363982 GCGCGGGGGCGAGGGTGCGGGGG + Intronic
1084319168 11:68363974-68363996 GTGCGGGGGCTGGGGGGAGCGGG + Intronic
1084319172 11:68363982-68364004 GCTGGGGGGAGCGGGGGCGCGGG + Intronic
1084319191 11:68364029-68364051 GCGTGGGGGTGCGCGGGCGTGGG + Intronic
1084517289 11:69643766-69643788 GCCCGGGGGCGCGGGGAAGCCGG - Intronic
1084538897 11:69774705-69774727 GCGCGAAGGGGCGGGGGCGGGGG - Intronic
1084786936 11:71448116-71448138 GCGAGGGGCCGCTGGGGCTCCGG - Intronic
1084814814 11:71639783-71639805 GCGCGGGGGTCCGGGGGTGCCGG + Intergenic
1084814823 11:71639800-71639822 TGCCGGGGGCGCGGGGGTGCCGG + Intergenic
1085044011 11:73343102-73343124 GGGCGGGGGCGCCGGGGTGGCGG - Intronic
1085574423 11:77589761-77589783 GCGGGGAGGCGGGGAGGCGCGGG - Exonic
1086361852 11:86068606-86068628 TCGCGCGGGCGCCGGGGAGCGGG + Intronic
1086361855 11:86068614-86068636 GCGCCGGGGAGCGGGGGCCGCGG + Intronic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1087634440 11:100687133-100687155 GCGAAGGGGCGGGGTGGCGCTGG + Intergenic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1087761815 11:102110665-102110687 GGGCGGAGGCGCCGGGGCGGGGG + Exonic
1088686738 11:112290200-112290222 GTGCCGGGGGGCGGGGACGCGGG + Intergenic
1089533942 11:119149462-119149484 GCACGCGGGCCCGGGGGTGCCGG + Intronic
1090238636 11:125166566-125166588 GCGCGGCGGGGCGGGAGCGGTGG + Intronic
1090375166 11:126283163-126283185 GGGCGGGGTCGCGGGGGACCGGG + Intronic
1090699334 11:129279694-129279716 GCGCGCGGCCGAGGGGGCGGGGG + Intergenic
1090788364 11:130069622-130069644 GCGCGGGGGCGTGCGCGCGGCGG - Intergenic
1090788590 11:130070389-130070411 GGGCGGGCGCCCGGGGGCACTGG - Intronic
1090788744 11:130070933-130070955 GCGGGAGGGGGCGGGGGCGGCGG + Intronic
1091048475 11:132347211-132347233 GCGGGGGGGGGGGGGGGCGGGGG - Intergenic
1091225980 11:133956633-133956655 GCGCGAGGGGCCGAGGGCGCCGG + Intronic
1091286672 11:134412055-134412077 GCGCGCGGGAGGGAGGGCGCGGG + Intergenic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1091460884 12:642908-642930 GCCCGGGAGCGCGAGGGCGCAGG - Intronic
1091558565 12:1594088-1594110 GCGCTGGGGGGAGGAGGCGCGGG + Exonic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091558809 12:1594835-1594857 GCGCGGGGGAGCGGGAGCGGCGG - Intronic
1091558811 12:1594843-1594865 TTGCGCGGGCGCGGGGGAGCGGG - Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1091616470 12:2053961-2053983 GCGCGGGGGGCAGAGGGCGCCGG + Intronic
1091680468 12:2523137-2523159 GGGCGGGAGGGCGGGGGCGGTGG + Intronic
1091712721 12:2753175-2753197 GCCTGGGAGCGCGAGGGCGCGGG + Intergenic
1091823113 12:3491077-3491099 GGGGGCGGGCCCGGGGGCGCTGG + Intronic
1091915658 12:4270657-4270679 GCGCGGGGGTGGGGGGCGGCGGG - Intergenic
1092045939 12:5431963-5431985 GGGGGGGGGCTCTGGGGCGCGGG + Intergenic
1092428176 12:8390234-8390256 GCGCGGGGGTCCCGGGGTGCCGG - Intergenic
1092429257 12:8396387-8396409 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1092461974 12:8695188-8695210 GCGGGGCGGGGCGGGGGGGCGGG - Intronic
1092487347 12:8914409-8914431 GCGCGGGAGGGAGGGGGCGGAGG + Intronic
1092502839 12:9065155-9065177 GGGCGGGGGCGGGGGGGGGGGGG - Intergenic
1092743250 12:11649917-11649939 GCGCGGGGCGGCGGGGGCGTGGG - Exonic
1092810407 12:12266978-12267000 GCGCGGGGGAAGCGGGGCGCCGG - Intronic
1092843344 12:12562962-12562984 GGGGGCGGGCGCGCGGGCGCGGG - Intergenic
1092999371 12:13980949-13980971 GCGCGGGGGTGAGTGTGCGCGGG - Intergenic
1093077707 12:14774596-14774618 GCGAGTGGGCGCCGGGGCGCCGG + Exonic
1093435326 12:19129675-19129697 GCGCGGGGGCGCGCCGGGCCGGG + Intergenic
1093435387 12:19129906-19129928 GCACGGGGGCCCGCGGGGGCGGG + Intronic
1093488625 12:19680708-19680730 GGGCGGGGGCGGGGGGGGGTGGG + Intronic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094041669 12:26125928-26125950 GCGCGGGGGGGCGGGGGGATGGG - Intronic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1094588679 12:31800995-31801017 GGGCGGGGGCGGGAGGGCGTCGG + Intergenic
1094704001 12:32896969-32896991 GGGCGGGGGCGGGGGCGGGCCGG + Intergenic
1094838696 12:34334105-34334127 GCGCGGGGGCCAGGGGACCCTGG + Intergenic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096073566 12:48788936-48788958 CCGCGGGGGCGGCGGGGCGGGGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096191629 12:49623605-49623627 GCGCGGGGGTGGAGGGGCTCGGG + Intronic
1096250976 12:50032570-50032592 GCGGGGTGGCGTGGGGGCGCGGG + Intronic
1096264343 12:50111501-50111523 GCGAGGGCGGGAGGGGGCGCTGG - Intergenic
1096396507 12:51270218-51270240 GGGCGGGGGCGCCGGAGAGCCGG - Intronic
1096435874 12:51591009-51591031 CCGCGGGGGCGCGGGCGGGCGGG + Intronic
1096476769 12:51913447-51913469 GGGCGGGGGAGCGGGTGGGCAGG + Intronic
1096491422 12:52015034-52015056 GGGCGGAGGCGGGGGCGCGCCGG + Exonic
1096495458 12:52037164-52037186 GCGCGGGCGGCCGCGGGCGCGGG + Intronic
1096495464 12:52037172-52037194 GGCCGCGGGCGCGGGGGCGGGGG + Intronic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096647681 12:53047439-53047461 GGGCGGGCGCCAGGGGGCGCGGG + Intronic
1096647683 12:53047447-53047469 GCCAGGGGGCGCGGGGCCGCCGG + Intronic
1096726251 12:53565484-53565506 GGGCGGGGGCGGGGGGGAGGGGG + Intronic
1096741255 12:53695657-53695679 GCGAGGGCGCGCTGGGGCGGGGG + Intergenic
1096741259 12:53695665-53695687 GCGCTGGGGCGGGGGCGGGCGGG + Intergenic
1096788108 12:54029400-54029422 GGGGGGGGGGGCGGGGGGGCGGG - Intronic
1097046152 12:56189189-56189211 GGGGAGGGGCGCGGGAGCGCAGG + Intronic
1097158081 12:57027116-57027138 GAGCGGGGGCGATGAGGCGCAGG + Intronic
1097699060 12:62801914-62801936 GCGCGGAGGGGTGGGGGCCCCGG - Exonic
1097896161 12:64825879-64825901 GCGCTGGGGGGCGGGGGCCGGGG - Intronic
1098029016 12:66235315-66235337 GCGCGGGGCAGCCTGGGCGCGGG + Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098893479 12:76032011-76032033 GGACGGGGGCGCGGAGGCGGGGG + Exonic
1098991183 12:77065852-77065874 GCGGGGCGGCGCGGGGCGGCGGG + Intergenic
1100468974 12:94873603-94873625 GCCCCGGGGTGCGGGGGCGGGGG - Intergenic
1100985657 12:100199839-100199861 GCGCGAAGGCGCGGGGGCCGGGG - Intronic
1101350954 12:103929829-103929851 GCGGGGGGGCGGGGGGGTGGCGG - Intergenic
1101606073 12:106248199-106248221 GCGCGGGGGTGGCTGGGCGCGGG + Intronic
1101750844 12:107581309-107581331 GCGCGGGGGCGGGCGGGGGGCGG + Intronic
1101970720 12:109310084-109310106 GGGCGGGGCAGCGGCGGCGCGGG - Intergenic
1102278392 12:111599519-111599541 GGGCGGGCGCGCCGAGGCGCCGG + Exonic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1102652062 12:114448996-114449018 GGGCGGGGGCGGGGGGGTGCGGG - Intergenic
1102676884 12:114665290-114665312 GCGGGGGGGTGGGGGGGCGATGG + Intergenic
1102687624 12:114736614-114736636 GCCAGGGGGCGCGGGGGAGGAGG - Intergenic
1102973567 12:117190190-117190212 CAGCCGGGGCGCGGGGCCGCTGG + Intronic
1103107818 12:118246105-118246127 GCGGGGGGGCACGGAGGCCCTGG + Intronic
1103196171 12:119045473-119045495 GCGGGGGGGAGCGGGGGAGTGGG - Intronic
1103595502 12:122022416-122022438 GCGCGGCGGCCCGGAGGCGGCGG + Intronic
1103749866 12:123151150-123151172 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1103764368 12:123270814-123270836 GCGCGCGGGCGTGGGGGCAGTGG - Intronic
1103856327 12:123973105-123973127 GGGCTGGGGGGCGGGGGCGGAGG + Exonic
1103856480 12:123973595-123973617 GTGCGGGGGAGCGGGGCCGGGGG + Exonic
1103954091 12:124567109-124567131 GCCCGCGTGCTCGGGGGCGCCGG - Intronic
1104001543 12:124863678-124863700 GCGCTGGGCTGCCGGGGCGCTGG - Exonic
1104448892 12:128853689-128853711 GGGCCGGGGGGCGGGGACGCGGG + Intronic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1104624244 12:130338846-130338868 GGGCCGGGGTGCGGGGGTGCAGG + Intronic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1104854301 12:131894894-131894916 GGCCGGGGGCGCGGGGCCGGGGG - Exonic
1104929249 12:132329473-132329495 GTGAGGGGGGCCGGGGGCGCCGG + Intergenic
1105019959 12:132809425-132809447 GGGCGGGGGGGCGGGGGTGGGGG - Intronic
1105049685 12:133037499-133037521 TCGCGAGGCCGCGGGCGCGCGGG + Intronic
1105071288 12:133235742-133235764 GCGCGGGGGCAGGGGGGGCCTGG - Exonic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1106157641 13:27172191-27172213 GCGGGGAGGCGCGGGGGTGGCGG + Intergenic
1106735926 13:32587170-32587192 GCGCGGGGACCCGGCGGCGGGGG - Intronic
1106776695 13:33016371-33016393 GGGCGGGCGCGGCGGGGCGCGGG + Intergenic
1107133500 13:36920309-36920331 GCGCGGCGGCGGGCGGGGGCGGG - Intronic
1107605151 13:42049012-42049034 TGGAGAGGGCGCGGGGGCGCTGG + Intronic
1107605229 13:42049193-42049215 GGGGCGGGGCCCGGGGGCGCTGG + Intronic
1108408305 13:50125434-50125456 GGGGGCGGGCGCGGCGGCGCGGG - Intronic
1108577736 13:51804021-51804043 GCGGCGGGGCGCGGGGCCCCGGG - Intronic
1108784116 13:53873656-53873678 GGGTGGGGGGGCGGGGGGGCAGG - Intergenic
1110572977 13:77026710-77026732 GGGGGGGGGCGCGGGGGCCGGGG - Intronic
1110630312 13:77698591-77698613 GCACCGGGGAGCGGGGGCGGGGG + Intronic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1111951180 13:94711022-94711044 GCGCAAGGGCGCGGGCGAGCAGG - Exonic
1112012028 13:95301005-95301027 GCAGGGGGACGCGGGGACGCGGG - Intronic
1112208256 13:97347082-97347104 GCGCCGGGGTGCAGGGGCGGCGG - Intronic
1112287165 13:98114341-98114363 GTGCGGGGGCTGGGGGGCGGTGG + Intergenic
1112290903 13:98143394-98143416 GGCCGAGGGCGCGGCGGCGCCGG - Intronic
1112507165 13:99982013-99982035 TCGAGGCGGCGCGGAGGCGCAGG + Exonic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1112752563 13:102597228-102597250 GCGCGGGGGCGCGGGCGGCCGGG + Intronic
1112752566 13:102597236-102597258 GCGCGGGCGGCCGGGGACGCGGG + Intronic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113120045 13:106916441-106916463 GCGGGGTGGGGCGGGGGGGCCGG - Intergenic
1113201065 13:107867593-107867615 GCGCGGGGGCGGGCGGCGGCGGG + Intergenic
1113378929 13:109786103-109786125 GCGAGGGGCGGAGGGGGCGCGGG + Exonic
1113473216 13:110561536-110561558 GGGAGAGGGCGCGGGGGCGCTGG - Exonic
1113556391 13:111239122-111239144 GCACGGGGGTGTGGGGGAGCAGG - Intronic
1113653880 13:112056336-112056358 GAACGCGGGGGCGGGGGCGCGGG + Intergenic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113660465 13:112103841-112103863 GGGGGCGGGGGCGGGGGCGCGGG + Intergenic
1113737632 13:112689882-112689904 GGGCGGAGGCGCGAGGGGGCAGG + Intergenic
1113775632 13:112943465-112943487 GGGCCGGGGCGCGGCGGCCCGGG + Intronic
1113813130 13:113154140-113154162 GCGTGGGGGAGGCGGGGCGCGGG + Intergenic
1113813138 13:113154156-113154178 GCGCGGGGGAGGCGGGGCGCGGG + Intergenic
1113813146 13:113154172-113154194 GCGCGGGGGAGGAGGGGCGTGGG + Intergenic
1113813206 13:113154296-113154318 GCGCGGGGGAGGCGGGGCGCGGG + Intergenic
1113813214 13:113154312-113154334 GCGCGGGGGAGGCGGGGCGCGGG + Intergenic
1113813222 13:113154328-113154350 GCGCGGGGGAGGCGGGGCGCGGG + Intergenic
1113813230 13:113154344-113154366 GCGCGGGGGAGGCGGGGCGCGGG + Intergenic
1113813238 13:113154360-113154382 GCGCGGGGGAGGCGGGGCGCGGG + Intergenic
1113813246 13:113154376-113154398 GCGCGGGGGAGGCGGGGCGCGGG + Intergenic
1113820660 13:113209878-113209900 GAGCGGGGGCGCCGGGGCGCCGG + Intronic
1113841567 13:113364186-113364208 AGGCGGGGGCGGGGGGGGGCAGG + Intergenic
1113869253 13:113548026-113548048 GGGCGGGGGCGGGGGGGCTTGGG + Intronic
1113917778 13:113884428-113884450 GGGCCAGCGCGCGGGGGCGCCGG + Intergenic
1114516057 14:23301252-23301274 GCGTGGGGGCGTGGGGGCGGGGG - Intronic
1114516063 14:23301260-23301282 GCGTGGGGGCGTGGGGGCGTGGG - Intronic
1115197027 14:30812341-30812363 GGAAGGGGGCGCGGGGGCGCCGG + Intergenic
1115761661 14:36582648-36582670 GCGGGGCGGGGCGGGGGCGGAGG - Intergenic
1115852662 14:37599856-37599878 GCGCGCGGCCGCGGGGACCCAGG - Intronic
1116426573 14:44798874-44798896 GCGAGGAGGCGGGGGGGCGGGGG - Intergenic
1116656993 14:47665801-47665823 GCGGGGGGGAGGGGGGGCGAGGG - Intronic
1116656997 14:47665809-47665831 GGGCGGGGGCGGGGGGGAGGGGG - Intronic
1116657003 14:47665817-47665839 GCGGGGTGGGGCGGGGGCGGGGG - Intronic
1116861788 14:50001327-50001349 GCGGGGCGGGGCGGGGGCGGGGG + Intronic
1116887140 14:50232024-50232046 GCGCGGGGGTGCGGGGCCTGGGG + Intergenic
1116916622 14:50532214-50532236 GGGCCGGGCCGCGAGGGCGCGGG - Intronic
1116973796 14:51094664-51094686 GCACGGGGTAGTGGGGGCGCTGG + Exonic
1117119708 14:52553622-52553644 GGGCGGGTGCGCGGGGCCGCCGG + Intronic
1117157039 14:52951271-52951293 GCGGGGCGGCGCGGGGGTGGCGG + Intronic
1117315354 14:54566833-54566855 GCGGCGCGGCGCGGGGGAGCCGG + Intergenic
1117315357 14:54566841-54566863 GCGCGGGGGAGCCGGGGCTCTGG + Intergenic
1117315404 14:54567107-54567129 GCGAAGGGGCGCGGGGGTGGGGG - Intronic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1117675642 14:58152317-58152339 GCGCAGGGGGGCGTGGGCGACGG - Intronic
1117680647 14:58199954-58199976 GTGCGGGGGCGCGGAGGCCGCGG - Intronic
1117964064 14:61189140-61189162 TCGCGGGGGCGCTGGGGCGCTGG - Intronic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1118366768 14:65102734-65102756 GGGGGGGGGCGGGGGGGGGCGGG + Intergenic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1119383018 14:74240503-74240525 GCCCGGGGACGCGCGGGCTCGGG + Intronic
1119403250 14:74378560-74378582 GCGCGGGGGCCCGGAGGCCCTGG - Intergenic
1120168065 14:81221041-81221063 GCGCAGGCGCGCCGGGGCGGAGG + Intronic
1120190553 14:81436218-81436240 GGGCGGGGGCGGGGGCGGGCCGG - Intronic
1121050443 14:90816340-90816362 GCGAGGGGGCGCCGCGGCGGCGG - Exonic
1121127526 14:91417726-91417748 GCGCGGGGGAACGGGGACGCGGG - Exonic
1121226176 14:92323396-92323418 GCGAGTGGGCGCGGCGGCGCGGG + Intronic
1121368016 14:93332625-93332647 GGGCTGAGGCGCGGCGGCGCCGG - Intronic
1121368044 14:93332706-93332728 GCGTGGGGGCGCCGGGGCTGGGG - Intronic
1121449971 14:94000956-94000978 GGGCGGGAGGGCGGGGGGGCGGG + Intergenic
1121528137 14:94633599-94633621 GCACGGGGGCGGGGCGGGGCGGG - Intergenic
1122130857 14:99604040-99604062 GCGCGCGGGCGGGGGGCGGCCGG + Intergenic
1122130917 14:99604244-99604266 GGGCGGGGCGGCGGGGGCTCCGG - Intergenic
1122221235 14:100240060-100240082 CGGCGGGGGCGCGGCGGCGGCGG + Intronic
1122275120 14:100587200-100587222 GGGCGCGGGCGCGGGCGCGGAGG - Intronic
1122558127 14:102592439-102592461 GGGCGGCGGGGCGGGGGAGCGGG - Intergenic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122582082 14:102777395-102777417 GGGCGGGGCGGCGGGCGCGCCGG + Intergenic
1122750326 14:103928305-103928327 GCGCGGCGGGGCGGGGCCGGCGG + Intergenic
1122960980 14:105093528-105093550 GCGCGCGGGGCCCGGGGCGCGGG - Intergenic
1122975254 14:105168330-105168352 GAGCGGGGCGGCGGGGGCGGCGG - Intronic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1122993329 14:105249091-105249113 GCGCGGGGGCCGCGGGGCACGGG - Intronic
1122993333 14:105249099-105249121 GCGCGCGGGCGCGGGGGCCGCGG - Intronic
1122993336 14:105249107-105249129 GCGTGGGCGCGCGCGGGCGCGGG - Intronic
1123025070 14:105420334-105420356 GCGGGGGGGCGCGGGGCCTGCGG + Intronic
1123038054 14:105479250-105479272 GGGCAGGGGCGCGGGGTCGGGGG + Intronic
1123500808 15:20878815-20878837 GCGCAGGGGCAGGTGGGCGCGGG - Intergenic
1123558059 15:21452510-21452532 GCGCAGGGGCAGGTGGGCGCGGG - Intergenic
1123594287 15:21889791-21889813 GCGCAGGGGCAGGTGGGCGCGGG - Intergenic
1123898050 15:24848208-24848230 GAGCTGGGGGGCGGGGGCGGCGG + Intronic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1124129388 15:26971202-26971224 GCGAGCGGGCGCGGGTGCCCAGG - Intergenic
1124226975 15:27903108-27903130 GAGAGGGGGCGCAGGAGCGCTGG - Intronic
1124226978 15:27903116-27903138 GCCCAGGGGAGAGGGGGCGCAGG - Intronic
1124340274 15:28885866-28885888 GCGCCGGGGCCAGGGGGCGCAGG + Intronic
1124612066 15:31215747-31215769 GCTCGGGGCGGCGGGGGCCCGGG - Intergenic
1124640361 15:31392820-31392842 GCGGGCGGGGGCGGGGGCGGGGG - Intronic
1124696753 15:31870328-31870350 GCGCGGGGACGCGGGGGGCGCGG - Intronic
1124696758 15:31870336-31870358 GGGCCGGGGCGCGGGGACGCGGG - Intronic
1124696927 15:31870932-31870954 GAGCGGGCTCGCGGGCGCGCGGG - Intergenic
1124957219 15:34367297-34367319 GAGCAGGGGCGCCAGGGCGCTGG - Intergenic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1125301024 15:38253073-38253095 CCGGGGGGGCGCGGGGGCAGCGG - Exonic
1125516488 15:40323932-40323954 GCGGCGGAGCGCGGGGCCGCCGG + Intergenic
1125665416 15:41426686-41426708 GGGCGGGGGGGGGGGGGGGCGGG - Intronic
1125674168 15:41493807-41493829 GCGCGGGCGTGCAGCGGCGCAGG + Intronic
1126346289 15:47697769-47697791 GCGGGGGGAAGTGGGGGCGCAGG - Intronic
1126786190 15:52179614-52179636 GCCCTGGGGCCCGGGCGCGCAGG - Intronic
1126997729 15:54463264-54463286 GCGGGGGGGGGGGGGGGGGCCGG + Intronic
1127225612 15:56925235-56925257 GCGGGGGGGTGGGGGGGCGGTGG - Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1128028802 15:64461217-64461239 GGGAGGGGGGGCGGGGGCGGTGG + Intronic
1128115429 15:65102171-65102193 ACGCGGGGGCGGCGGGGTGCTGG + Exonic
1128115433 15:65102179-65102201 GCGGCGGGGTGCTGGGGCGCGGG + Exonic
1128161099 15:65423118-65423140 GCGCGCGGGCGCAGGGTCCCCGG - Intergenic
1128161102 15:65423126-65423148 GGGCCGTGGCGCGCGGGCGCAGG - Intergenic
1128322564 15:66703496-66703518 GCGGGGAGGCGCCGGCGCGCAGG + Exonic
1128547750 15:68579231-68579253 CCGCGGCGGAGCGGGGGCGCGGG - Exonic
1128582596 15:68819731-68819753 GAGCTGGGGCGAGGGGGCACCGG + Intronic
1128877643 15:71215205-71215227 GCGCAGGGGCGCCAGGCCGCTGG - Exonic
1129082336 15:73052234-73052256 GCGCGGAGCCGAGGGGGTGCGGG + Intronic
1129082387 15:73052407-73052429 GGGCGGGGGGGGGGGGGCGGTGG - Intronic
1129150286 15:73684190-73684212 GCGGGGCGGGGCGGGGGCGGGGG + Intronic
1129189138 15:73927413-73927435 CGGCGTGGGCGCGGGGGCGGCGG + Exonic
1129440648 15:75578841-75578863 GCGCGGGGACGCGGAAGCGGAGG - Exonic
1129483029 15:75843132-75843154 GGCCGGGGGCGGGGGCGCGCGGG + Intergenic
1129676556 15:77634899-77634921 CCGCTGGGGGGCGGGGGCGGGGG + Intronic
1129862399 15:78872804-78872826 GCGCAGGGGCGCGTGCGCGGCGG + Exonic
1130296163 15:82648067-82648089 GCGCGAGGGGGCGGAGGCGAGGG - Intronic
1130302840 15:82693183-82693205 GGGCGGGGGGGTGGGGGCGGGGG - Intronic
1130302844 15:82693189-82693211 GGGCGGGGGCGGGGGGGTGGGGG - Intronic
1130411726 15:83653838-83653860 GCGCGGGGCCGCGGCGACGGCGG - Intergenic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1130656422 15:85794706-85794728 GAGCGGGGGCGCGGGTGCTGCGG + Intronic
1130706384 15:86236933-86236955 GGGGGGGGGCGGGGGGGGGCGGG + Intronic
1131475384 15:92734215-92734237 GCGCGGCGGGGCGGAGGCGGAGG - Intronic
1131701553 15:94942651-94942673 GGGCGGGGGCGGGGGGGGGGAGG - Intergenic
1132055545 15:98648487-98648509 GCGAGCGGGCGCGTGTGCGCGGG + Intergenic
1202966409 15_KI270727v1_random:179682-179704 GCGCAGGGGCAGGTGGGCGCGGG - Intergenic
1132478521 16:154178-154200 GCGGGGAGGGGCGGGGTCGCGGG + Intronic
1132480574 16:164707-164729 GCGGGGCGGGGCGGGGCCGCGGG + Intronic
1132480611 16:164778-164800 GCGGGGCGGGGCGGGGTCGCGGG + Intronic
1132512625 16:352112-352134 GTGCGGGGGCCCGGGAGAGCCGG - Intronic
1132514574 16:360176-360198 GGGCGGGGGCGCAGGTGGGCCGG - Intergenic
1132514577 16:360184-360206 GCACAGGTGGGCGGGGGCGCAGG - Intergenic
1132544799 16:528111-528133 GCGCGGGCTCGGCGGGGCGCAGG + Intronic
1132557503 16:579012-579034 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1132585773 16:705300-705322 GGGCCGGGGCGCGGGGCTGCGGG + Intronic
1132683854 16:1154155-1154177 GGCCGGGCGCGCGGGGGTGCAGG + Intronic
1132734716 16:1379689-1379711 GCGCGGAGGGGGCGGGGCGCGGG - Intronic
1132741268 16:1414506-1414528 GCGCGGAGGCCGGGGGGCGCGGG + Intronic
1132741272 16:1414514-1414536 GCCGGGGGGCGCGGGGGCGGCGG + Intronic
1132741294 16:1414576-1414598 GGGCGCGGGCGGGGGGCCGCAGG + Intronic
1132778519 16:1610524-1610546 CCGCGGGGACTCGGCGGCGCCGG + Intronic
1132778869 16:1612315-1612337 GCCGGGGTGCGCGGGCGCGCGGG - Exonic
1132805141 16:1771796-1771818 CCGGGGGGGCGCGGGGGGGGCGG - Intergenic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1132838061 16:1964582-1964604 GCGGGGGGGCCCGGGGGCCCTGG - Exonic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1132851509 16:2026946-2026968 GCGGGGGAGCTCGGGGGCGGCGG - Exonic
1132885118 16:2179095-2179117 GCGCGGGCGCGCCGGGGGACGGG + Exonic
1132893155 16:2214415-2214437 GGCCTTGGGCGCGGGGGCGCCGG + Exonic
1132934530 16:2473975-2473997 GCGCGGGGGGCCGGGGGCCCGGG + Exonic
1132943560 16:2520258-2520280 GCGGGCGGGCGGGCGGGCGCCGG + Intronic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1132968558 16:2673452-2673474 GCGCGGGGGCGGGGCGTCGCGGG - Intergenic
1133370052 16:5240119-5240141 GCGCGGGGGTCCGGGGGTGCCGG + Intergenic
1133370061 16:5240136-5240158 TGCCGGGGGCGCGGGGGTGCCGG + Intergenic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134509327 16:14833860-14833882 GGGCCAGGGCGCGGGGCCGCTGG + Exonic
1134697032 16:16232675-16232697 GGGCCAGGGCGCGGGGCCGCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1135040521 16:19114161-19114183 ACGGCGGCGCGCGGGGGCGCCGG + Intronic
1135521589 16:23182549-23182571 GCGCGGCCGGGCTGGGGCGCAGG + Intergenic
1136037220 16:27549626-27549648 GCGGGCGGGCGGGCGGGCGCAGG - Intronic
1136367767 16:29816708-29816730 GTCCGGGGGCGAGGAGGCGCAGG + Exonic
1136377992 16:29876719-29876741 GGGCGGGGCCGAGGGGACGCGGG + Intronic
1136383087 16:29905983-29906005 GCGGGGGTGGGCGGGGGCGGAGG + Exonic
1136390616 16:29962068-29962090 GAGCGGGGCCGCGAGGGGGCGGG - Intronic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1136428353 16:30183745-30183767 GCGCGGGTGGGCCGGGGCGAGGG + Intronic
1136478353 16:30526703-30526725 GAGCGGGGGCCGGGGGCCGCCGG - Intronic
1136479960 16:30534914-30534936 GAGCGGGGGCGCGGGGAGGGGGG - Intronic
1136540010 16:30923818-30923840 GCGCGCGGGCTGGGGGGGGCGGG + Intronic
1136540218 16:30924370-30924392 GCGGGGGGGCCGGGCGGCGCGGG - Intronic
1136625323 16:31458760-31458782 GGGCGGGGCGGCGGGGGAGCGGG - Intronic
1136627799 16:31472457-31472479 GCCCGCGGGCGCCCGGGCGCGGG + Intronic
1136636855 16:31529593-31529615 GGGCGGGGGCGCGCGGGGGGAGG + Intergenic
1136636873 16:31529632-31529654 GAGCGGGGGCGGGGGTGCGCGGG + Intergenic
1136779040 16:32885746-32885768 GCCCGGGGGCGCGCGGGCGTCGG + Intergenic
1136891578 16:33975772-33975794 GCCCGGGGGCGCGCGGGCGTCGG - Intergenic
1137267972 16:46884347-46884369 GCGCAGGGGCCGGGCGGCGCGGG + Intergenic
1137454732 16:48609742-48609764 CCGCGGGCGCGCGGGGGCGGCGG + Intronic
1137617624 16:49856689-49856711 GCGCGGGGGCGCTCAGGCGGCGG + Intronic
1137618146 16:49858718-49858740 CCGCGGGGGCGTGGGGGGGGGGG - Intergenic
1137988620 16:53130968-53130990 GCGTGGCGGCGCGGGGGAGGCGG + Intronic
1138160394 16:54747783-54747805 GCGGGGGGGGGGGGGGGCGGGGG - Intergenic
1138591115 16:58000311-58000333 GCGCGGGGGGGCGGCCGGGCCGG + Intronic
1139364850 16:66427088-66427110 GGGCGGCGGCGCGGGGACGACGG + Intergenic
1139364902 16:66427238-66427260 GCGCAGGGGCGGGGCGGGGCGGG - Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139489593 16:67279298-67279320 GCCCGGGGGTGCGGCGGGGCGGG + Exonic
1139548519 16:67660950-67660972 GCGGGGCGGCGCGGGCGGGCCGG + Exonic
1139754592 16:69132401-69132423 GGGCGAGGGCGCGAGGGAGCGGG - Intronic
1139896225 16:70289746-70289768 GCGGGGGGGGGCGGGGGGGGCGG - Intronic
1140033848 16:71358603-71358625 GCGCGGCGCGGCGGGGGCGGCGG - Intergenic
1140442635 16:74999293-74999315 GGGCGGGCGCGGGGAGGCGCCGG - Exonic
1141054495 16:80803658-80803680 GCGCGGGGGAGGAGGGGGGCGGG - Intronic
1141054502 16:80803666-80803688 GGCCGGGGGCGCGGGGGAGGAGG - Intronic
1141054657 16:80804127-80804149 GTACGGGGACGCGGGGGCGCGGG - Intronic
1141665294 16:85462683-85462705 CGGCGGGGGCGCCGCGGCGCGGG + Intergenic
1141686838 16:85575035-85575057 GGGCGGGGGAGAGGGGGAGCGGG - Intergenic
1141694608 16:85613615-85613637 GGGCGGGGACTCGGGGGCTCCGG + Intronic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1141989586 16:87602461-87602483 GCGGGGGCGCGCGGGCGGGCGGG + Intronic
1142125836 16:88409868-88409890 GGGGGGGGGGGGGGGGGCGCGGG + Intergenic
1142197126 16:88744132-88744154 AGGCGGGGGCGCGGGGCCCCTGG - Intronic
1142293222 16:89202002-89202024 GCCCGGGGGCGCGCGGGCTCCGG + Intergenic
1142313864 16:89330665-89330687 GGGGGGGGGGGCGGGGGCGGAGG + Intronic
1142377315 16:89712562-89712584 GCCTGGGGGTGCGTGGGCGCGGG - Intronic
1142395220 16:89828250-89828272 GGCTGGGGACGCGGGGGCGCGGG - Intronic
1142395407 16:89828773-89828795 GCGCGGGAGCCCGAGGCCGCGGG + Exonic
1203081453 16_KI270728v1_random:1147835-1147857 GCCCGGGGGCGCGCGGGCGTCGG + Intergenic
1142549928 17:732391-732413 GGGCGGGTGGGCGGGGGCGGAGG - Exonic
1142637721 17:1268408-1268430 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1142848140 17:2691948-2691970 GGGCGGGGGCGTGGCGGGGCGGG - Intronic
1142860094 17:2755937-2755959 GCGCGGGGACGCGGGGTGGTGGG - Intergenic
1143036920 17:4004766-4004788 GCGCCGGGACGCGGCGGCTCTGG + Exonic
1143063354 17:4222209-4222231 CCGCGGGGCGGCGGGGGCGGCGG - Intronic
1143116639 17:4585009-4585031 GCCCGGGGGAGCGCGTGCGCTGG + Intronic
1143223744 17:5282642-5282664 GGGCGGAGGCGGGGGCGCGCGGG + Intronic
1143247798 17:5500779-5500801 GCGCGCGGGCGGGAGGGCGCAGG - Intronic
1143321201 17:6070386-6070408 GCGGGCGGGCGAGCGGGCGCCGG - Intronic
1143390510 17:6556672-6556694 GGGCGGGGGTGCGGGCCCGCGGG - Intergenic
1143485375 17:7251322-7251344 GAGCTGGGCCGCGGGGGCCCCGG - Exonic
1143562809 17:7705428-7705450 GCGCTCTGCCGCGGGGGCGCGGG + Exonic
1143582237 17:7834193-7834215 GGGCTGGGGAGCGGGGGTGCGGG + Intergenic
1143635762 17:8163009-8163031 GGGCGGGGGCGGGGCGCCGCGGG + Intronic
1143669019 17:8383603-8383625 GCCAGGAGGCGCGGGGACGCCGG + Intergenic
1143702413 17:8671007-8671029 GGGCGGGGGCGGGGGGGGGGCGG + Intergenic
1143724012 17:8833081-8833103 GAGCTGGGGTGCGTGGGCGCTGG - Intronic
1143736735 17:8916478-8916500 TGGCGGGGGCGGGGGGGCGGGGG - Intronic
1143746938 17:9002109-9002131 GCGGGGGGCGGTGGGGGCGCCGG - Intergenic
1143876740 17:9997242-9997264 GCGGGTGGGGGCGGGGGCGGTGG + Intronic
1144586907 17:16492421-16492443 GGGCCGTGGCGCGGGGGCGAGGG + Intergenic
1144695885 17:17303605-17303627 GCGGGGCGGCGCGGGGCGGCGGG + Exonic
1144695888 17:17303613-17303635 GCGCGGGGCGGCGGGCGGGCTGG + Exonic
1144769573 17:17752200-17752222 GCGGGGCGGCGCGCGGGCGCAGG + Intronic
1144964082 17:19064555-19064577 GGGGGGGGGGGCGGGGGGGCGGG + Intergenic
1145023041 17:19446809-19446831 GCGGGGGGGCCCGGAGGCCCTGG - Intergenic
1145031504 17:19507904-19507926 GCGAGGGGACGCCGGGGTGCGGG - Intronic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145190606 17:20840778-20840800 GCCCTGGGGCCCGGGGGCGCGGG + Intronic
1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG + Intronic
1145243607 17:21253326-21253348 GCGCGGCGGGGCTGGAGCGCGGG + Exonic
1145291608 17:21551226-21551248 GCGCGGGCTCGCCGGGGCTCGGG + Exonic
1145828219 17:27893265-27893287 GGGCGGGGGCGCGGGGGCAGCGG - Intronic
1146057750 17:29589583-29589605 GAGCGGCGGCGGGGCGGCGCGGG - Intronic
1146058699 17:29593543-29593565 GAGCCGGGGCCCGGGGCCGCGGG - Exonic
1146062057 17:29612824-29612846 CCGCGGGCGCGCGGGGCCACGGG + Intronic
1146322630 17:31858906-31858928 CCGCGGGGCCGCGGGGCTGCGGG - Intronic
1146322787 17:31859353-31859375 AAGCGGGGGCGGGGCGGCGCAGG + Intergenic
1146398540 17:32486913-32486935 GAGCGGGAGCGCGGCGGCGGCGG + Exonic
1146398696 17:32487404-32487426 GCGGAGGGGCGCAGGGGCGCAGG + Intronic
1146445358 17:32928280-32928302 GGAAGGGGACGCGGGGGCGCGGG + Intronic
1147037753 17:37694433-37694455 GCGGGGGGGGGGGGGGGCGGCGG - Intronic
1147143735 17:38473676-38473698 GTGCGGGGGCGGGTGGGCGTGGG + Intronic
1147168602 17:38605707-38605729 GGGCGGGGGCGCGGGGGGCGGGG + Exonic
1147168699 17:38606043-38606065 GCCCGGGGCGGCGGGGGCGGGGG + Intergenic
1147179172 17:38674053-38674075 TCCCGAGGGTGCGGGGGCGCAGG + Exonic
1147705375 17:42422043-42422065 ATGTGGGGGCGCGGGGGCGCAGG + Intronic
1147705379 17:42422051-42422073 GCGCGGGGGCGCAGGGTCTGGGG + Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147924526 17:43938444-43938466 GCGGGGGGTGGGGGGGGCGCGGG + Intronic
1148122665 17:45222021-45222043 GGGCGGGGGCGAGGGGGCAGCGG - Exonic
1148323720 17:46771752-46771774 GCGGCGCGGCGCGGGGGCGGGGG - Intronic
1148406872 17:47423701-47423723 GCGCCGGGACCCGCGGGCGCCGG + Intronic
1148493472 17:48037823-48037845 GCGCGGAGGCGGGGCGGCGGCGG - Intronic
1148502319 17:48101214-48101236 GGGAGGGGGCGCGGCGGCGGCGG - Intronic
1148551915 17:48555664-48555686 GGGCGGGGGCGGGGGGGCGGGGG - Intronic
1148581544 17:48747422-48747444 GCGCGGGCTCTCGGCGGCGCGGG - Intergenic
1148602065 17:48901762-48901784 GGGCGGGGGTGGGGGGGCGGGGG - Intergenic
1148615785 17:48998498-48998520 GCGGGGTGGCGCGGCGGCGGCGG + Intronic
1148722534 17:49764023-49764045 GGGCCGGGGCGCGGAGGGGCCGG - Exonic
1148782587 17:50130062-50130084 GAGCGAGGGGGCGGGGGCGGGGG + Intergenic
1148807912 17:50273450-50273472 CCGCCGGGGCGCGGGCGAGCAGG - Intronic
1148899601 17:50866109-50866131 GCGCGGCAGGGCGGGGGCGCGGG + Exonic
1148899604 17:50866117-50866139 GGGCGGGGGCGCGGGAGGGTCGG + Exonic
1149296414 17:55265707-55265729 GCGCGGGGCCGGGGCGCCGCGGG - Intronic
1149712672 17:58756706-58756728 GCGGGAGGGCGCCGGGGCTCAGG - Intronic
1149893690 17:60412408-60412430 GGGCGGTGGGGCGGGGGAGCAGG + Intronic
1149994770 17:61400598-61400620 GCGCGGGCGGGCGGGCGGGCTGG + Intronic
1150217120 17:63476997-63477019 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1151296908 17:73192829-73192851 GCGGGGGCGGGCGCGGGCGCGGG - Intronic
1151296914 17:73192845-73192867 GGGCGGGCGCGAGGGGGCGGGGG - Intronic
1151296920 17:73192853-73192875 GCGCGAGGGGGCGGGCGCGAGGG - Intronic
1151296926 17:73192867-73192889 GCGCGAGGGGGCGGGCGCGAGGG - Intronic
1151296932 17:73192881-73192903 GCGCGAGGGGGCGGGCGCGAGGG - Intronic
1151296938 17:73192895-73192917 GCGCGAGGGGGCGGGCGCGAGGG - Intronic
1151296944 17:73192909-73192931 GCGCGAGGGGGCGGGCGCGAGGG - Intronic
1151296950 17:73192923-73192945 GCGCGAGGGGGCGGGCGCGAGGG - Intronic
1151472330 17:74326123-74326145 GCGCGGGGAGGGGCGGGCGCCGG + Intergenic
1151511922 17:74566018-74566040 GGGCGGGGGGGCAGGGGGGCGGG + Intergenic
1151559173 17:74861557-74861579 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1151812453 17:76452695-76452717 GGGCGGGGGCTGGGCGGCGCGGG - Intronic
1151854395 17:76710765-76710787 GCGCAGGGGCGGGACGGCGCCGG + Exonic
1151983162 17:77526261-77526283 GCTGGGGGGGTCGGGGGCGCCGG - Intergenic
1152352514 17:79791479-79791501 ACTCGGGGGCGGGGGTGCGCGGG + Intergenic
1152362436 17:79838973-79838995 GGGCGGGGGCCCGGGGGCCGAGG - Intronic
1152362995 17:79840929-79840951 GCACGGGGGCTCGGGCGAGCAGG + Intergenic
1152396277 17:80035693-80035715 GAGCTGGGGCGGGGGCGCGCGGG - Intronic
1152421387 17:80195252-80195274 GCTGGGGGGCGCGGGGCTGCTGG - Exonic
1152426452 17:80220845-80220867 GCGCGCGGGCGCCGGGGCCCTGG + Intronic
1152541914 17:80981135-80981157 GGGCGCGGGGGCGGGGGCACGGG - Intergenic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152544073 17:80992060-80992082 ACGCGGGGGGCCGAGGGCGCGGG - Intronic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152606862 17:81295649-81295671 GCGCCAGGGCACGGGGGCGGGGG + Intergenic
1152639463 17:81443628-81443650 GAGCTGGGGAGCCGGGGCGCAGG - Intronic
1152654345 17:81513006-81513028 GCGCAGGGTCGCGAGCGCGCGGG - Intronic
1152655919 17:81519225-81519247 GGGAGGGGGCGCAGGAGCGCGGG - Intronic
1152697319 17:81803766-81803788 GCGCGCGGGCGTGGGGGCCGTGG - Intergenic
1152697322 17:81803774-81803796 GCGGAGGGGCGCGCGGGCGTGGG - Intergenic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1152718498 17:81911230-81911252 GGGGCGGGCCGCGGGGGCGCCGG - Intronic
1152729050 17:81961023-81961045 GCGGGCGGGAGCGGGGGCGAGGG - Exonic
1152729194 17:81961467-81961489 GCGGGGGGGGGCGGCGGCGCCGG - Intronic
1152744171 17:82031574-82031596 GGGCGGGGGCGGGGGCGGGCGGG - Intergenic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1152793252 17:82293284-82293306 GCGCGGGGAGGGGAGGGCGCGGG + Intergenic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1152855991 17:82664723-82664745 GCCCGGGTGCGGGAGGGCGCAGG - Intronic
1152923988 17:83079423-83079445 GGGCGCGGGCGCCGGGGCGGGGG - Intergenic
1153219436 18:2848159-2848181 GTGTGGGGTCGCGGGGGCGTAGG + Intronic
1153238739 18:3012803-3012825 GCGCGGGGAGCCGGGGGCGTCGG - Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153480492 18:5543113-5543135 GCGCGGGAGCACGGGCGGGCCGG - Intronic
1153563773 18:6398740-6398762 TTGCGGGGGGGCGGGGGCGGGGG + Intronic
1153794456 18:8609645-8609667 CCGAGGGGGCGCCGGGGCCCGGG + Exonic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1153911309 18:9708480-9708502 GCGAAGGGGCGCGAGAGCGCGGG - Intronic
1153935166 18:9914440-9914462 GCGCCGGGGCGTGGGGGAGGGGG - Intronic
1154130504 18:11733141-11733163 GCGCTGTGGCACAGGGGCGCTGG + Intronic
1154202333 18:12308179-12308201 GAGCGGCGGGGCGGGGGCGGGGG + Exonic
1154202335 18:12308187-12308209 GGGCGGGGGCGGGGGCGCGGAGG + Exonic
1154241513 18:12657786-12657808 GCGAGGGGCCGCGGGAGCCCGGG - Exonic
1154334985 18:13457787-13457809 GCACAGGGGAGCGGGGGCCCAGG - Intronic
1154954680 18:21242402-21242424 CCGCGGGGACTCCGGGGCGCGGG + Intronic
1155054147 18:22170360-22170382 GTGCGGCGCCGCGGGGACGCCGG + Intronic
1155392614 18:25351812-25351834 GGGCGGGGGCGCGGCGCCGGCGG + Intronic
1155570344 18:27185372-27185394 GCGGGCGGGGGCGGGGGCGCGGG - Intergenic
1155570348 18:27185378-27185400 GCCCGGGCGGGCGGGGGCGGGGG - Intergenic
1155877070 18:31101519-31101541 GCGCCGGGGCGGGAGTGCGCCGG - Intronic
1155877076 18:31101535-31101557 GCGCCGGGGCGGGAGTGCGCCGG - Intronic
1155877087 18:31101567-31101589 GCGCCGGGGCGGGAGTGCGCCGG - Intronic
1157384169 18:47247865-47247887 GCCCTGGGGGGCGCGGGCGCAGG - Intronic
1157384231 18:47248082-47248104 GGGCGTGGGCGCGGGCGCGGGGG - Intronic
1157473688 18:48008317-48008339 ACGCGGGGGCGCTGGGCCGGGGG + Intergenic
1157610490 18:48952130-48952152 GAGGGGGGGTGCGGGGGGGCGGG - Intergenic
1158141654 18:54261996-54262018 GGGCTGGGGCGCGGGGGTGGGGG + Intergenic
1158980160 18:62752240-62752262 GGGTGGGGGCGCGGGGGGCCTGG - Intronic
1159489074 18:69106207-69106229 GCGCTGGAGTGCGGTGGCGCTGG + Intergenic
1159586559 18:70288723-70288745 GCGGAGGGGCGCGGGGGTGGGGG + Intergenic
1159670147 18:71212522-71212544 GCGGCGGGGGGCGGGGGCGGCGG + Intergenic
1159670188 18:71212591-71212613 GCGGCGGGGGGCGGGGGCGGTGG + Intergenic
1160025434 18:75211804-75211826 GCGCGGGGACGCGGGGCCCCGGG - Intronic
1160163334 18:76491563-76491585 GCGCCGGGGGGCGGGGGCGGCGG + Intronic
1160164299 18:76496152-76496174 GGGCGGGCGCGCGGGGGCGGGGG + Intronic
1160164303 18:76496160-76496182 GCGCGGGGGCGGGGGAGGGGCGG + Intronic
1160204518 18:76822323-76822345 GGGCGCGGGCGCGGGCGCGGTGG - Intergenic
1160204665 18:76822755-76822777 GAGCGGCGGGGCGGGGGCGGGGG + Intronic
1160499296 18:79394413-79394435 GCGTGGGGGCGCGGCCTCGCTGG + Intergenic
1160499790 18:79395996-79396018 GGGCGCGGGCACCGGGGCGCGGG + Intronic
1160499887 18:79396367-79396389 GCGCAGGGGTCCGGGGGCGGAGG - Intronic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160500718 18:79400133-79400155 GCGCGAGGGGGCGGGGGCGGGGG + Intronic
1160518226 18:79490091-79490113 CCACGGGGGGGCGGGGGCGGGGG - Intronic
1160540290 18:79617308-79617330 GGGCGGGGTCCCGGGGGGGCGGG - Intergenic
1160540301 18:79617324-79617346 GGGCGGGGTCCCGGGGGGGCGGG - Intergenic
1160540340 18:79617389-79617411 GGGCGGGGTCCCGGGGGGGCGGG - Intergenic
1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG + Exonic
1160616143 18:80130729-80130751 GGGCGGGGGGGCGGGGGCTGGGG - Intronic
1160631263 18:80247584-80247606 GCGGGGCGGGGCGCGGGCGCGGG - Intergenic
1160668436 19:344511-344533 GCGCGGCGGCGCGGGGCGGGCGG - Intronic
1160668525 19:344724-344746 GCGCGGACGCGCGGGGGCGGGGG + Intronic
1160680346 19:409227-409249 TCCCGCGGGGGCGGGGGCGCGGG - Intergenic
1160690987 19:460673-460695 GCGCGGGGTCGCGGGGGTCGCGG - Exonic
1160698822 19:496841-496863 GCGCGGAGGGGAGGGGGCGCAGG + Intronic
1160698933 19:497167-497189 GCGCGGAGGGGAGGGGGCGCAGG + Intronic
1160726785 19:620961-620983 GGCAGGGGGCGCGGGGGCGCCGG + Intronic
1160726796 19:620982-621004 GGGGGAGGGCGCGGGGGCGCCGG + Intronic
1160726807 19:621003-621025 GGGGGAGGGCGCGGGGGTGCCGG + Intronic
1160732097 19:645953-645975 GCCCGGGGACGCAGGGGTGCGGG + Intergenic
1160736151 19:663239-663261 GCGGGGCGGAGCGGGGGCGCGGG + Exonic
1160763641 19:797760-797782 GCGCGGAGGGGGAGGGGCGCGGG - Intronic
1160776808 19:860435-860457 GCGCGGGGGCGGGGGGGGAGGGG - Intronic
1160791514 19:925786-925808 GCCCGGGGGCGCTGGGGAGCCGG - Intronic
1160824896 19:1074891-1074913 GGGCGGGGGCGGGCGGGGGCGGG + Intronic
1160831932 19:1108300-1108322 GGGGGAGGGCGCGGGGGCGGGGG - Exonic
1160847753 19:1173911-1173933 TCGCCGGGGGGCGGGGGGGCAGG + Intronic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160858935 19:1229506-1229528 GGCCGGGGCCGCGCGGGCGCCGG + Exonic
1160860862 19:1236818-1236840 GAGCGGCGGGGAGGGGGCGCGGG + Intronic
1160860866 19:1236826-1236848 GGGAGGGGGCGCGGGGGCGGCGG + Intronic
1160868596 19:1266906-1266928 GGGCCGAGGCGCGGGGGCGGCGG + Intronic
1160868600 19:1266914-1266936 GCGCGGGGGCGGCGGGAGGCTGG + Intronic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160927693 19:1555015-1555037 GGGCAGGGGGGCGGGGGCGAGGG - Exonic
1160930529 19:1567835-1567857 GCGCTCGGGCTGGGGGGCGCTGG - Exonic
1160930665 19:1568192-1568214 GGGCGGGGCGGCGGCGGCGCGGG + Intergenic
1160944384 19:1634438-1634460 GCGCAGGGGCGCTGGGGAGAGGG + Intronic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1160996682 19:1885302-1885324 GCGCGGCCGCGCGGGGTCCCGGG - Intronic
1160996709 19:1885360-1885382 GCCCTGGGGCCCGGGGGCGCGGG - Exonic
1161006893 19:1941489-1941511 GAGTGTGGGGGCGGGGGCGCCGG - Intronic
1161051135 19:2164486-2164508 GCGGTAGGGCTCGGGGGCGCCGG - Intronic
1161101746 19:2424951-2424973 GGCCGGGGGCGTGGGGGCTCGGG + Intronic
1161101817 19:2425276-2425298 GCCCGGGGCCGCGGTGGTGCGGG + Intronic
1161175872 19:2841848-2841870 GCGCAGGGACGCGGGGACCCCGG - Intronic
1161175877 19:2841864-2841886 GCGTGGGGGGTCGGGAGCGCAGG - Intronic
1161203673 19:3029315-3029337 CCGCGGGCGCGTGGGGGCGGCGG - Intronic
1161203699 19:3029372-3029394 GCCGGGGGGGGCGCGGGCGCGGG - Intronic
1161207206 19:3047301-3047323 GGGCGGGCGGGCGGAGGCGCGGG - Intronic
1161266414 19:3366691-3366713 TGCGGGGGGCGCGGGGGCGCCGG - Intronic
1161273766 19:3404411-3404433 GGGAGGGGGCGCGGAGGCGTGGG + Intronic
1161388075 19:4007541-4007563 GCGAGCGGGGGGGGGGGCGCTGG + Intergenic
1161401286 19:4067111-4067133 GCGGGGGGGCGCGCCGGGGCGGG - Intergenic
1161450643 19:4343633-4343655 GCGCGGGGCTGCAGGGGCGCGGG + Intronic
1161471259 19:4457709-4457731 GCCCGGCGGCGGGGGGCCGCGGG + Exonic
1161471267 19:4457717-4457739 GCGGGGGGCCGCGGGGGCGGGGG + Exonic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161494926 19:4581500-4581522 GCGCGAGGGCGGGAGGGCGCGGG + Intergenic
1161560393 19:4969509-4969531 GGCCGGGGGCGCGCGGGGGCTGG + Intronic
1161688949 19:5719822-5719844 GCGGGGGGCAGCGCGGGCGCCGG - Exonic
1161977196 19:7613203-7613225 GGGCGGGGGCGGGTGGGGGCGGG + Intronic
1162033161 19:7925937-7925959 GCGCGCCGGGGCGGGGGCGGTGG - Intronic
1162128250 19:8510890-8510912 CCGCGGGGGCGCCGGGGCGGTGG + Exonic
1162312100 19:9913771-9913793 GAGGGGGGGCTCGGGGACGCGGG + Intronic
1162321023 19:9970628-9970650 GCCGGGGGGCCCGGGGGCGCCGG + Exonic
1162403007 19:10457428-10457450 GGGCGGGGGGGGGGGGGGGCAGG + Intronic
1162504963 19:11078226-11078248 GGGTGGGGGCGTGGGGGCGGTGG - Intergenic
1162560975 19:11418238-11418260 GGGCGGGGGCGGGGGGGTGGGGG - Intronic
1162591981 19:11597821-11597843 ACGCGGGGCTGCGGGGCCGCAGG - Intronic
1162808683 19:13151788-13151810 GGGGGGGGGCGCGGAGGGGCGGG - Intronic
1162861172 19:13506504-13506526 GGGGCGGGGCGCGGGGGCCCGGG + Intronic
1162861176 19:13506512-13506534 GCGCGGGGGCCCGGGGAGGAGGG + Intronic
1162931958 19:13961970-13961992 GCGGCGGAGGGCGGGGGCGCGGG + Exonic
1162931963 19:13961978-13962000 GGGCGGGGGCGCGGGGGCTGGGG + Exonic
1162975895 19:14206826-14206848 GAGCGGGTGCGCCGGGGAGCGGG - Intergenic
1163019002 19:14472860-14472882 GCGCGGGCGCAGGGGGGCGCAGG + Intronic
1163099099 19:15082769-15082791 GAGCGGGGGGGAGGGGGCGGGGG + Intergenic
1163127352 19:15251445-15251467 GGGGGGGGGGGCGGGGGCGCGGG + Intronic
1163138710 19:15332143-15332165 GCGCGGGGGCGGGGAGGCCGGGG - Intronic
1163320552 19:16572271-16572293 GCGCGAGGGCGCGCGGGTGGCGG - Exonic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163370380 19:16897861-16897883 GGCCGGGGGTGCGGGCGCGCGGG + Intronic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1163547452 19:17948437-17948459 GCGCGGGGGAGCGGGTGCTGGGG + Intergenic
1163634964 19:18433474-18433496 GGGCGGGGGCGCGTCGGCGGGGG + Intronic
1163715503 19:18870206-18870228 GCCTGGGGGCACGGGGGCGCGGG + Exonic
1163720586 19:18896410-18896432 GCGCGGTGGGGTGGGGGAGCGGG - Intronic
1163725158 19:18919192-18919214 GCGCAGGGGCGCGGGGACGCTGG - Intronic
1163725161 19:18919200-18919222 GTGCGGCCGCGCAGGGGCGCGGG - Intronic
1163820469 19:19493723-19493745 GGGAGGGGGCGCGGGGGCAGTGG - Intronic
1164155746 19:22596038-22596060 GCGGGCGGGGGCGGGGCCGCAGG - Intergenic
1164551142 19:29213173-29213195 GCGCAGGCGCGAGGAGGCGCGGG + Exonic
1164642122 19:29833683-29833705 GCGTGGGGGCGGGGGGGAGCTGG - Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648138 19:29873750-29873772 GCGCGGGCGCGGGGGCGCGGGGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164658573 19:29942450-29942472 GAGGGCGGGCGCGCGGGCGCTGG + Exonic
1164958384 19:32405922-32405944 GCGCCGGGACGCGCGGGCGAGGG + Intronic
1165058606 19:33194385-33194407 GCGGGGCGGCCCGGGGACGCCGG + Intronic
1165080220 19:33302497-33302519 GTGCGCGGGCGCGGGCGAGCAGG - Exonic
1165080300 19:33302783-33302805 CCACGTGGGCGCGGGGGCGACGG - Intergenic
1165305229 19:34999508-34999530 GGGCGGGGGAGGGGGGACGCAGG + Intronic
1165349729 19:35269173-35269195 GCGCGGGGGCACGGCCGGGCCGG - Intronic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165349924 19:35269726-35269748 GGGCGGGCGGGCGGGCGCGCCGG + Intronic
1165392354 19:35545832-35545854 GCGCGGGGCGGAGAGGGCGCGGG + Intronic
1165750488 19:38256428-38256450 GGGCGGGGGCTCGGGCTCGCCGG + Exonic
1165774039 19:38394762-38394784 GAGCGGAGGAGCGGCGGCGCTGG - Exonic
1165840738 19:38788088-38788110 GCGGGGGGGGGGGGGGGGGCGGG - Intergenic
1165901658 19:39172217-39172239 GCGCAGGGGGGCGGGGGTGGGGG + Intronic
1165902091 19:39173762-39173784 GAGCGGGGGCCAGGGGGCCCAGG - Exonic
1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG + Intergenic
1166043831 19:40218045-40218067 GCCCGGGGGCGGGGGCGGGCAGG + Exonic
1166094460 19:40530467-40530489 GGGAGGGGGCGCGCGGCCGCCGG + Intronic
1166106677 19:40601226-40601248 GCGCGGGGGCGCGTGGGGCTGGG - Intronic
1166306856 19:41940248-41940270 GCCCGGGGGCGGAGGGGCGGGGG + Intergenic
1166347766 19:42177012-42177034 GCGCGGGCGGGCGGGCGGGCAGG + Intronic
1166673446 19:44725212-44725234 GGGCGGGGGCGGGGGAGGGCAGG - Intergenic
1166675317 19:44737491-44737513 GGGTGGGGGCGGGGAGGCGCTGG - Intergenic
1166830979 19:45639451-45639473 GGGCAGGGGCGCGGCGGCCCGGG - Intronic
1166836047 19:45668721-45668743 ACGTGGAGCCGCGGGGGCGCGGG + Intronic
1166836050 19:45668729-45668751 CCGCGGGGGCGCGGGTGAGTGGG + Intronic
1166975121 19:46601343-46601365 GCGCGGACGCGCGGCGGAGCTGG + Exonic
1167072981 19:47231243-47231265 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
1167080791 19:47274978-47275000 GCGAGGGCCCGCGGGGGCGCTGG + Exonic
1167149853 19:47702287-47702309 GCGTGGGGGTACGAGGGCGCGGG - Exonic
1167266532 19:48485586-48485608 GGGCTGGGGGGCGGGGGCCCGGG + Exonic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167602958 19:50465173-50465195 GCGGAGGGGCGCTGGGGCGGTGG - Intronic
1167633490 19:50639820-50639842 GCGCGGGGCTGCGGCGGCGGCGG - Intronic
1167643781 19:50695247-50695269 GCCGGGGGGCGCGGGGGCGCGGG + Intronic
1167643786 19:50695255-50695277 GCGCGGGGGCGCGGGGCGCGGGG + Intronic
1167792021 19:51689094-51689116 GGGCGGGCGAGCGGGAGCGCCGG + Intergenic
1167916325 19:52742930-52742952 ACGGGGGGGCGGGGGGGAGCTGG + Intergenic
1168223993 19:54981504-54981526 GCGGGGGGGAGGGGGGGCACGGG - Intronic
1168251740 19:55145977-55145999 GCGGGGGGGCGGTGGGGCGGTGG - Intronic
1168251745 19:55145985-55146007 GGCCGGGGGCGGGGGGGCGGTGG - Intronic
1168251947 19:55146624-55146646 GGGTGGGGGGGCGGGGACGCTGG - Intronic
1168307220 19:55442325-55442347 GCCGGGGGCCGCGGGGGCGAGGG - Exonic
1168339118 19:55613794-55613816 CGGCGGGGGGCCGGGGGCGCAGG - Exonic
1168536098 19:57172069-57172091 GCGGGGGCGCGCGAGGGGGCGGG + Intergenic
1168694421 19:58396598-58396620 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
1202710754 1_KI270714v1_random:18293-18315 GGGCGGGCGGGCGGGGGCGGCGG + Intergenic
925069623 2:956236-956258 GCGCAGGGGCGGGGCGGGGCAGG - Intronic
925730598 2:6917517-6917539 GCGCGGGCGCGGGGAGGCGCGGG + Exonic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
926077461 2:9952199-9952221 GCGGGGAGGCCCGGGGGCGTTGG - Intronic
926109105 2:10170790-10170812 GGGCGGGGGCGTGGGGGTGCGGG - Intronic
926126098 2:10272789-10272811 GCCCGGAGGCACGGGAGCGCAGG - Intergenic
926154756 2:10447839-10447861 GCGCGGGGCCGCAGGGTCTCCGG + Intronic
926300256 2:11596922-11596944 GTGAGAGGGGGCGGGGGCGCAGG + Intronic
926422933 2:12716835-12716857 GGGCGGGGGCGGGGCGGGGCCGG + Intergenic
927156510 2:20224342-20224364 GCGCCCGGGCTCGGCGGCGCTGG + Intronic
927156873 2:20225546-20225568 GGGCGGGGACCCGGGGGCGATGG + Intergenic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927713981 2:25341296-25341318 GCCCGGGGGAGCGGGGGAGGGGG - Intronic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
927751415 2:25673583-25673605 GCGCGAGGGCGCGAGGGCGGAGG + Exonic
927881501 2:26692834-26692856 GGCCGGGGGCGCCGGGGGGCCGG + Exonic
927917310 2:26945499-26945521 GCGGGGGGGGACGGGGGGGCGGG - Intronic
927956769 2:27212306-27212328 GCGCTGCGGGGCGGGGCCGCGGG + Exonic
927988344 2:27429034-27429056 GCGGGTGGGGGCGGGGGCGGGGG + Intronic
928186442 2:29115354-29115376 GCTGGGGAGTGCGGGGGCGCGGG + Intronic
928602774 2:32916570-32916592 GGGGGGGGGGGCGGGGGCGGGGG + Intergenic
928602780 2:32916578-32916600 GGGCGGGGGCGGGGGGGGGGAGG + Intergenic
929778829 2:44944497-44944519 GAGCGGCGGCGCGGGGGAGCCGG + Intronic
929778833 2:44944505-44944527 GCGCGGGGGAGCCGGGTGGCGGG + Intronic
929789795 2:45014074-45014096 GCGGAGGGGCGCGGGCGCGGCGG + Intergenic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
930096398 2:47570116-47570138 AGGCGGAGGCGCGGGCGCGCTGG - Exonic
930730703 2:54725017-54725039 GCCCCGGCGCGCGGGGGGGCGGG + Exonic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
931613085 2:64125081-64125103 GGGGGTGGGGGCGGGGGCGCGGG + Intronic
931711001 2:64989166-64989188 ACCCGAGGCCGCGGGGGCGCGGG - Intronic
931731936 2:65160960-65160982 AAGCGGGGGGGCGGGGGGGCGGG + Intergenic
931731938 2:65160962-65160984 GCGGGGGGGCGGGGGGGCGGGGG + Intergenic
932236581 2:70125329-70125351 GCGCAGGGGCGCCTGCGCGCAGG + Intergenic
932345869 2:70994839-70994861 GGGCGGGGACGCGGCGGCGGCGG - Exonic
932591526 2:73070800-73070822 CCCCGGCGGCGCGGGGGCCCGGG + Intronic
933508919 2:83214783-83214805 GGTCGGGGGAGAGGGGGCGCAGG - Intergenic
933893455 2:86790717-86790739 GGGCGGGGGGCGGGGGGCGCGGG - Intronic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
934566987 2:95346619-95346641 CCCCGCGGGCGCCGGGGCGCGGG - Intronic
934966820 2:98730995-98731017 GCGGGGGCGGGAGGGGGCGCGGG - Intronic
935219815 2:101002541-101002563 GCGCAGGGGCGCGGGTGCGTGGG + Intronic
935746573 2:106194341-106194363 GGGCGGGGGCGCGCGGCGGCAGG - Intergenic
935971498 2:108534404-108534426 GCGCGGGGGCGCGGGAGGGGGGG - Intronic
935971506 2:108534412-108534434 GGCCGGCCGCGCGGGGGCGCGGG - Intronic
936104530 2:109613746-109613768 CCGCGGGGGCCGGGGAGCGCGGG + Intronic
936433243 2:112482180-112482202 GCGCCCGGGCGCGGCGCCGCCGG + Exonic
936512206 2:113157466-113157488 GCGCCTGGGCGCGGGGCCGTGGG + Intronic
936531265 2:113278322-113278344 GCTCAGCGGCGCGGGGGCTCGGG + Intronic
936537737 2:113324976-113324998 GGGCGGGGCCGAGGGGGCGGAGG - Intergenic
936569839 2:113603745-113603767 GCGCAGGCGCGCCGAGGCGCAGG + Intergenic
936569845 2:113603777-113603799 GCGCAGGCGCGCCGAGGCGCAGG + Intergenic
937018931 2:118633073-118633095 GCGGGGCGGGGCGGGGGCGGGGG - Intergenic
937221740 2:120346062-120346084 GCCCGGGCGGGCGCGGGCGCGGG + Intergenic
937221748 2:120346072-120346094 GCGCGGGCGCGGGCGGGGGCGGG + Intergenic
937301893 2:120847752-120847774 GGGCAGGGGCGGGGGGGCGGTGG + Intronic
937439828 2:121906308-121906330 GAGCGGGGGGGTGGGGGCGGTGG - Intergenic
937478237 2:122234142-122234164 TGGCGGGGGGGCGGGGGGGCGGG + Intergenic
938034867 2:128027626-128027648 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
938266950 2:129934493-129934515 GCGCGGGGACTCGGGGGGGGGGG - Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938338994 2:130523040-130523062 GCGCGCGGGTTGGGGGGCGCGGG + Intronic
938350844 2:130597710-130597732 GCGCGCGGGTTGGGGGGCGCGGG - Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
938392411 2:130916238-130916260 AGGCGGGGACGCGGGGGCGCTGG - Intronic
938460314 2:131492402-131492424 GCTAGGGGGCGCGGCGGGGCGGG - Exonic
939003988 2:136765388-136765410 GCCGCGGGGCGCGGGGCCGCGGG - Intergenic
939153803 2:138501753-138501775 GCGCGTGCGCGCGGCGGCGGCGG - Intergenic
939534991 2:143416824-143416846 GCGTGGGGGCGTGGGGGTGGGGG - Intronic
939534997 2:143416832-143416854 GCGTGGGGGCGTGGGGGCGTGGG - Intronic
939612924 2:144332278-144332300 GCGCGGGGAGCCGGGGGCGGGGG - Intronic
940009518 2:149038941-149038963 TCGCGGGGCCGCGGGGCCGCGGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
940145759 2:150542643-150542665 GCGGGGGGGCGGGGAGGGGCGGG + Intergenic
940316864 2:152335727-152335749 GCGCGGCGGCGGTCGGGCGCGGG + Intronic
940316870 2:152335743-152335765 GCGCGGGGACCCGGGGCCCCGGG + Intronic
940646052 2:156394005-156394027 GCGCGAGGGGGTGGGGACGCGGG + Intergenic
941021039 2:160407967-160407989 GCGGGCGGGCGGGGAGGCGCGGG - Intronic
941104903 2:161341145-161341167 GCGCAGGGGCGGGACGGCGCCGG + Intronic
941112124 2:161427191-161427213 GCTCGAGGCCGCGGGGCCGCGGG + Intronic
941951332 2:171160260-171160282 GCGAGCGGGCGCGGGCGCGGCGG + Intronic
941951576 2:171161127-171161149 GCGCGGGAGCCCGGGGTTGCCGG + Intronic
942043348 2:172085169-172085191 GGGCGGCGGCGCGGAGCCGCTGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942136498 2:172931176-172931198 GGGGGGGGGCGCTGGGGGGCGGG + Intronic
942314199 2:174682939-174682961 CGGCGGGGGGGCGGCGGCGCCGG - Intergenic
942314200 2:174682945-174682967 GCGGGGCGGCGGGGGGGCGGCGG - Intergenic
942344705 2:174990317-174990339 GTGGGGGGGTGCGGGGGGGCGGG + Intronic
942454743 2:176130070-176130092 GGGCGGCGGCGCGCGGGGGCTGG + Exonic
942516968 2:176764341-176764363 GTGGGGGGTCGGGGGGGCGCTGG + Intergenic
944114477 2:196171777-196171799 GCGCGGCGGCGTGGCGGCGCAGG + Intronic
944256471 2:197627870-197627892 ACGGGGGGGCGGGGGGGCGGGGG - Intronic
944256473 2:197627872-197627894 ACACGGGGGGGCGGGGGGGCGGG - Intronic
944451682 2:199850673-199850695 GTGGGGAGGCGCGGGGGCGGGGG - Intronic
944507222 2:200425123-200425145 GCGGGGGGGGGGGGGGGCGGGGG - Intronic
945274256 2:207972343-207972365 GCCGGGGGGCGGGGGGGCGGTGG + Intronic
945681309 2:212917373-212917395 GCGGGGGGGCGCGGGGCAGGGGG - Intergenic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
946043725 2:216803883-216803905 GGGGGGGGGGGTGGGGGCGCGGG + Intergenic
946043728 2:216803891-216803913 GGGTGGGGGCGCGGGCGGGCAGG + Intergenic
946311200 2:218883537-218883559 GCGCGGGGGCGGGGCGGGGCGGG - Intronic
946333800 2:219024483-219024505 GGGCAGGGGGGCGGGGGCACAGG + Intronic
946362823 2:219229349-219229371 ACGGGGGCGCGCGCGGGCGCCGG - Exonic
946431200 2:219628055-219628077 GCGCGGGGGCGGGGGAGAGATGG + Intronic
946908987 2:224442378-224442400 GCGCGGTGGGGCGGGGGTCCGGG - Intergenic
947119536 2:226800175-226800197 CCGGGGGGAGGCGGGGGCGCCGG + Intergenic
947549899 2:231038225-231038247 GCGCGGGCGGGCGGTGGCTCGGG + Intronic
947593078 2:231395966-231395988 GCGGGCGGGCGCGGCGGCGGCGG + Intronic
947707371 2:232287383-232287405 GCGGGGGGGGGGGGGGGCGCGGG - Intronic
947765250 2:232633666-232633688 ACGCGGGAACGCGGGGACGCGGG - Exonic
947792492 2:232876168-232876190 GGGCGGGGGGCGGGGGGCGCGGG + Intronic
947860493 2:233354471-233354493 GGGCGGGGGCGGGGCGGGGCCGG - Intergenic
948046756 2:234951646-234951668 GCGGGGGGGCACAGGAGCGCGGG + Intergenic
948046850 2:234951931-234951953 GGGCGGGGGCGCGGGGGGCGGGG - Intergenic
948046854 2:234951937-234951959 GGGCGGGGGCGGGGGCGCGGGGG - Intergenic
948046856 2:234951939-234951961 GGGGGCGGGGGCGGGGGCGCGGG - Intergenic
948115883 2:235494167-235494189 GCGCGGGGGCCCCGGCGCGCCGG + Exonic
948116024 2:235494618-235494640 GCCCGCGGGCCCCGGGGCGCGGG + Exonic
948116037 2:235494634-235494656 GCGCGGGGCGGCGGCGGCGGGGG + Exonic
948393299 2:237627496-237627518 ACGCGGGGACGCGGGGGGACGGG - Intergenic
948393305 2:237627504-237627526 GGCCGGGGACGCGGGGACGCGGG - Intergenic
948467496 2:238159236-238159258 GAGCCGGGGCGTGCGGGCGCGGG - Intronic
948491674 2:238317093-238317115 GCGGGGTGGCGGGGGGGTGCAGG + Intergenic
948560458 2:238848179-238848201 GCGCGTGGGGCTGGGGGCGCCGG - Exonic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
948645181 2:239400329-239400351 GGGCGGGGGCGGGCGGGCGCCGG - Intronic
948645226 2:239400436-239400458 GCCCGCCGGGGCGGGGGCGCGGG - Exonic
948801506 2:240435528-240435550 GGGGCGCGGCGCGGGGGCGCGGG - Intergenic
948805693 2:240452744-240452766 GCGCGGCGGGGCGGGGGCTGCGG + Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
948893096 2:240916476-240916498 CGCAGGGGGCGCGGGGGCGCGGG - Intergenic
948910068 2:240998497-240998519 GTGGGAGGGCGCGGGCGCGCGGG - Intergenic
948945672 2:241217919-241217941 GGGCGGGGGCGCGCAGGGGCGGG + Intronic
948945674 2:241217921-241217943 GCGGGGGCGCGCAGGGGCGGGGG + Intronic
948945678 2:241217927-241217949 GCGCGCAGGGGCGGGGGCGGGGG + Intronic
948945774 2:241218126-241218148 GAGCGGGGGCGCGCAGGGGCGGG + Intronic
949004281 2:241636812-241636834 CGGCCGGGGCGCGGGGGAGCGGG - Intronic
949004332 2:241636908-241636930 GGGCGGGGGCGTGGCGGCCCGGG + Intronic
949014529 2:241702016-241702038 GCGCGGGCGGGCGGTGCCGCGGG - Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079863 2:242088459-242088481 GCGCGGGGGGGCGGGGGCGGGGG - Intergenic
949079867 2:242088465-242088487 GCGGGGGCGCGGGGGGGCGGGGG - Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079883 2:242088491-242088513 GTGTGGGGGCGCGGGGGCGCGGG - Intergenic
949079887 2:242088499-242088521 GCGTGGAGGTGTGGGGGCGCGGG - Intergenic
1168965091 20:1894254-1894276 GCGCGGGGGCGCGGGGGGCGGGG - Exonic
1168965097 20:1894262-1894284 GAGTCGGGGCGCGGGGGCGCGGG - Exonic
1169130565 20:3164545-3164567 CTGCGGGAGCGCGGGGCCGCAGG - Exonic
1169278435 20:4248725-4248747 GAGCCGGGGAGCGCGGGCGCGGG - Exonic
1169488416 20:6052436-6052458 GCGCTGGGGCCCGGGTGGGCCGG - Exonic
1169558119 20:6770053-6770075 CCGCGGGGGCGCGAGGGGGGAGG + Intronic
1170015352 20:11775365-11775387 GTGCAGGGGCGGGGGGGCGGGGG - Intergenic
1170163952 20:13343569-13343591 GGGCGGGGGCGGCGGGGCGGGGG - Intergenic
1170348724 20:15416758-15416780 GCGGGGCGGTGGGGGGGCGCCGG + Intronic
1170558021 20:17531143-17531165 GCTCGAGGGCGCGGGCCCGCTGG + Exonic
1170585089 20:17728418-17728440 GCGGGGTGGAGCGGGGGCGCTGG - Intronic
1170756354 20:19210500-19210522 GCGGGGTGGGGCGGGGGGGCCGG - Intergenic
1170756840 20:19212575-19212597 GCGCCGGGAGGCGGCGGCGCGGG + Intergenic
1170889716 20:20367567-20367589 GGGTGGGGGCGGGGGCGCGCCGG - Intergenic
1170999286 20:21396881-21396903 GCCGAGGGGCGCGGGGGCGCGGG - Intronic
1171173645 20:23035597-23035619 GCCCGGGGACGCGCGGGCGGCGG + Exonic
1172028953 20:31968262-31968284 GCGCGGGGAGGCGGCGGCGGCGG + Exonic
1172036999 20:32018168-32018190 GCGGGAGGGGGCGGGGGCGGGGG + Intronic
1172037316 20:32019151-32019173 GCGCCAGCGCGCCGGGGCGCGGG + Exonic
1172474452 20:35226654-35226676 GCGCGGAGGCGGGGGCGCGCTGG + Exonic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1172529315 20:35619126-35619148 GAGTCGGGGCGCGGGGGCGCGGG - Intronic
1172644601 20:36461752-36461774 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1172974154 20:38894103-38894125 GTGCGGGGGTGCGGGGGGGACGG - Intronic
1172974159 20:38894111-38894133 GGGCGGGGGTGCGGGGGTGCGGG - Intronic
1173165957 20:40687698-40687720 GGGCGGGTGCGCGGGCGGGCAGG - Exonic
1173454011 20:43189533-43189555 GTGTGGGCTCGCGGGGGCGCGGG - Intronic
1173548099 20:43914683-43914705 GGCCGGGGGCCCGGGGGCCCGGG - Intergenic
1173588786 20:44208105-44208127 GGGTGGGGGCGGGGGGGGGCGGG - Intronic
1173620813 20:44434515-44434537 GCGCGGGGGGGGGGGGGTGGAGG + Intergenic
1174134847 20:48372486-48372508 GGGCTGGGGGGCGGGGGCGAGGG - Intergenic
1174357667 20:50009466-50009488 GTGCAGGGGCGGGGGGGGGCGGG - Intergenic
1174373970 20:50113090-50113112 GCTCGGGTGAGCGGGGGCGCCGG - Intronic
1174467869 20:50731438-50731460 GCGCGGGCTCGCGGGGGAGGCGG + Intergenic
1174736714 20:52972201-52972223 GGGCGGGGGCCCCGGCGCGCCGG - Intergenic
1175210429 20:57350846-57350868 GGACGGGGGGGCGGGGGGGCGGG + Intergenic
1175210431 20:57350848-57350870 ACGGGGGGGCGGGGGGGCGGGGG + Intergenic
1175210434 20:57350854-57350876 GGGCGGGGGGGCGGGGGGACGGG + Intergenic
1175210436 20:57350856-57350878 GCGGGGGGGCGGGGGGACGGGGG + Intergenic
1175210464 20:57350895-57350917 GGGCGGGGGGACGGGGGCGGGGG + Intergenic
1175210482 20:57350923-57350945 GGGGGGCGGCGCGGGGGGGCGGG + Intergenic
1175210488 20:57350931-57350953 GCGCGGGGGGGCGGGGGGGGCGG + Intergenic
1175224875 20:57439217-57439239 GGGTGGGGGTGTGGGGGCGCAGG - Intergenic
1175492283 20:59387254-59387276 GCTCGGGGGGGCTGGGGTGCAGG + Intergenic
1175521229 20:59604047-59604069 GGGCGGGGGGGCGGGGGAGAGGG - Intronic
1175521232 20:59604053-59604075 GCCGGGGGGCGGGGGGGCGGGGG - Intronic
1175562043 20:59939249-59939271 GCGCGGTGGCGCGGGCCCGCAGG - Exonic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1175715500 20:61252393-61252415 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1175847416 20:62065926-62065948 GGGCGGGGGCGCGCGGCCGGGGG + Intergenic
1175847428 20:62065947-62065969 GGGCGGGGGAGCGGGGGTGGCGG + Intergenic
1175847476 20:62066124-62066146 GGGCGCGGGCGCCGGGGCGGTGG + Intergenic
1175911385 20:62406971-62406993 GCCCTGGGGCGCGGGGGTCCTGG + Exonic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1175911505 20:62407318-62407340 CGGCGGGCGCGCGGGCGCGCGGG - Intergenic
1175967322 20:62666097-62666119 GCGGGGGGGCGGGGCGGGGCGGG - Intronic
1176026165 20:62986610-62986632 GGGCGGGGGTGCGGGTGGGCGGG + Intergenic
1176042228 20:63071962-63071984 GGGCGGGGGCGGGGAGGAGCGGG - Intergenic
1176148042 20:63574135-63574157 GGGCGGGGGCGCGGGGGTCCAGG - Intronic
1176148045 20:63574143-63574165 GGGCGGAGGGGCGGGGGCGCGGG - Intronic
1176194640 20:63831458-63831480 GCGCCGCGCCGCGGGGTCGCAGG + Intergenic
1176221078 20:63969672-63969694 GCGCGGGGGCTCGGGCGCGGCGG + Intronic
1176237982 20:64063152-64063174 GCGCGCGGCCGCGGGGCCGAGGG + Exonic
1176281625 20:64316745-64316767 GCGGGGCGCGGCGGGGGCGCGGG + Intergenic
1176547957 21:8209468-8209490 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176549486 21:8214989-8215011 GGGCGGGGGCGCGGGGAGGAGGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176555851 21:8253683-8253705 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176557381 21:8259218-8259240 GGGCGGGGGCGCGGGGAGGAGGG - Intergenic
1176566888 21:8392503-8392525 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176568412 21:8398023-8398045 GGGCGGGGGCGCGGGGAGGATGG - Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574788 21:8436717-8436739 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176576323 21:8442253-8442275 GGGCGGGGGCGCGGGGAGGAGGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611402 21:8988010-8988032 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176952562 21:15064619-15064641 CCGCGGGGGCGTCGGGGCGGCGG - Intronic
1178104127 21:29299247-29299269 GGGCGGGGGCTGGGGGCCGCGGG + Intronic
1178417090 21:32412738-32412760 GCGGGGGGCCGCGGAGCCGCTGG + Exonic
1178417110 21:32412823-32412845 GCGCGGCGGGGCGGAGGCGCAGG - Exonic
1178487401 21:33027673-33027695 CCGCTGGGGGGCGGGGGCGGCGG + Exonic
1178673927 21:34615013-34615035 GCACAGGGTCGCGCGGGCGCGGG - Exonic
1178707647 21:34888848-34888870 GCGCGGCGGCGGGGGCGCGCGGG - Intronic
1178992284 21:37366400-37366422 GCGCGGGCGCGGGGCGGGGCGGG + Intronic
1179133634 21:38660817-38660839 GCGCGTGGGTGCGAGCGCGCGGG + Intronic
1179209346 21:39312941-39312963 GCGCGGGGGGGGCGGGGGGCGGG + Intronic
1179243858 21:39613135-39613157 GCGCGCGGGGGCGTGGGTGCCGG + Intronic
1179411585 21:41167477-41167499 GGGCGGGGGCTCGGGGGCAGCGG + Intergenic
1179457312 21:41508251-41508273 GCGGGCGGGGGCGGGGGCGGCGG + Intronic
1179511844 21:41878889-41878911 GCGCGGGGCCGCGGGGCTGCCGG - Intronic
1179563966 21:42234920-42234942 CCGCGGCGGAGCGGCGGCGCGGG + Intronic
1179874689 21:44261950-44261972 CCGCGGGGGCGGGGAGGGGCGGG + Exonic
1179893764 21:44350472-44350494 GCGGTGGGGTGCAGGGGCGCAGG + Intronic
1180005571 21:45018999-45019021 GGGCGGGGGCCCGGAGGGGCGGG + Intergenic
1180014570 21:45074083-45074105 GCGCGGGGGCCCGGGAGCCTGGG + Intronic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180064560 21:45405774-45405796 GGGCGGGGCCGCGGGGTCTCGGG + Intronic
1180091522 21:45536003-45536025 GCACGTGGGCGCCGGGGTGCAGG - Intronic
1180843596 22:18970349-18970371 GGGCGGGGGCTGGGGGGCGCGGG - Intergenic
1180843610 22:18970375-18970397 GGGCGGGGGCTGGGGGGCGCGGG - Intergenic
1180910697 22:19447883-19447905 GCGCGGAGGGCCGGGGTCGCAGG + Exonic
1180949379 22:19714385-19714407 GCCCGGGGGGGCGGGGACCCAGG - Intergenic
1180950655 22:19719075-19719097 GCGCCTGGGCGCGCGGGCGGGGG + Intronic
1180960575 22:19760671-19760693 GCGCGGGGGTGGGGGGGCCCCGG + Intronic
1181094357 22:20495627-20495649 GCGCGGGGGCGGGCGCGGGCCGG - Intronic
1181121677 22:20671212-20671234 GCCCTGGGGCCCGGGGGCGCGGG - Intergenic
1181162041 22:20965137-20965159 GCGGGGGGGCGGGGAGGCGCGGG - Exonic
1181162046 22:20965147-20965169 GGCCGCGGGCGCGGGGGGGCGGG - Exonic
1181175462 22:21032429-21032451 GGACGGGGGCGCGGCGGAGCAGG - Intronic
1181334645 22:22118252-22118274 GCCCTGGGGCCCGGGGGCGCGGG - Intergenic
1181711816 22:24696040-24696062 GCCCGTGGGCACGGGGGTGCTGG - Intergenic
1182123510 22:27801083-27801105 GCGCGGGGACTCCGGGGGGCGGG - Exonic
1182355349 22:29720258-29720280 GCGCGGGGGCGCTAGGCCCCCGG + Exonic
1182355462 22:29720597-29720619 GGCCAGGGGCGCGGGGGCGGGGG + Intronic
1182355469 22:29720605-29720627 GCGCGGGGGCGGGGGGCGGGGGG + Intronic
1182551853 22:31104947-31104969 GTCCGGGGGCGCGGCGGAGCTGG - Exonic
1182586322 22:31346092-31346114 GCGAGCCGGGGCGGGGGCGCCGG + Exonic
1182586325 22:31346100-31346122 GGGCGGGGGCGCCGGAGCGGAGG + Exonic
1182586343 22:31346160-31346182 GCGCACGGGGGCGGTGGCGCGGG + Exonic
1182804464 22:33058410-33058432 GCGCGGGGAGGCCGGGCCGCCGG - Intergenic
1182804467 22:33058418-33058440 GCGCCGCGGCGCGGGGAGGCCGG - Intergenic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183093687 22:35540324-35540346 GCGCGTGGGGCCGGGGCCGCTGG - Intergenic
1183444476 22:37844084-37844106 GCGCTGGGCGGCGGCGGCGCGGG - Exonic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183486310 22:38089260-38089282 GGGCGGGGGGGGGGGGGGGCGGG + Intronic
1183486378 22:38089453-38089475 CCGCGGGGGCCCGGGGCCTCAGG - Intronic
1183535623 22:38398929-38398951 GCGCGGGGGCGGGGTGGGGCGGG - Intergenic
1183546035 22:38455288-38455310 GCGCGGGGGTCCGGGGGCCCGGG + Intergenic
1183606937 22:38871613-38871635 GCGCGGGGAAGCGGGAGAGCCGG - Intronic
1183625744 22:39000320-39000342 GCGAGGGGGCCGGGGGCCGCTGG + Intergenic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
1183720129 22:39557763-39557785 GGGCGGGGGCGCGGGTGCTGCGG - Intergenic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1184086920 22:42270741-42270763 GCGCGGCGGGGGCGGGGCGCTGG + Intronic
1184101389 22:42343445-42343467 GCGCGGGCGCGGCGGGGGGCGGG - Intronic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184315924 22:43689206-43689228 GCGGGGGGGCGCAGGGCCGGAGG + Intronic
1184347746 22:43923884-43923906 CGGCGGCGGGGCGGGGGCGCGGG - Exonic
1184418356 22:44364851-44364873 TGGCAGGGGAGCGGGGGCGCCGG - Intergenic
1184481796 22:44752520-44752542 GGGCGGAGGGGCGGGGGGGCGGG + Intronic
1184523111 22:45007441-45007463 GGGCGGGGGCGCGCGGGGGCGGG + Intronic
1184593749 22:45502537-45502559 GCGCGGAGGAGCGGGGACCCGGG - Intronic
1184645250 22:45891714-45891736 GCGCGGGCGCGTGTGGGCACTGG - Intergenic
1185055320 22:48576035-48576057 GCGCGGGGGGGGGGGGGGTCCGG - Intronic
1185272694 22:49936094-49936116 GCGCGGGGCCGGGGCGGCGGGGG - Intergenic
1185296716 22:50058314-50058336 GCGCGGGCGGCGGGGGGCGCGGG + Intergenic
1185296720 22:50058322-50058344 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185302540 22:50090029-50090051 GCGCGGGCGCGTGCGGGCGGCGG + Exonic
1185320196 22:50197186-50197208 GGGCGGGTGCGGGGGTGCGCTGG - Intronic
1185398332 22:50603743-50603765 GCGCGGGGAAGCGGGGGAGGAGG + Intronic
1185409647 22:50674906-50674928 TCGCGGAGGCGCGGGGTCCCGGG + Intergenic
1185413484 22:50697725-50697747 GCGGGGGGGCGCGGGGGGGCGGG + Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203252836 22_KI270733v1_random:125768-125790 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203254373 22_KI270733v1_random:131311-131333 GGGCGGGGGCGCGGGGAGGAGGG - Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260892 22_KI270733v1_random:170854-170876 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203262429 22_KI270733v1_random:176390-176412 GGGCGGGGGCGCGGGGAGGAGGG - Intergenic
949559480 3:5188332-5188354 GCGCGTGGGCGCGCGGCCCCGGG - Intronic
949993740 3:9600672-9600694 GGGCCGGGGGGCGGGGGCGCTGG + Intergenic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
950021907 3:9793204-9793226 CCGCAGGGGCGCGGGGCCGAGGG + Intronic
950024295 3:9810038-9810060 GCGCGAGGGAGCTGGGGCCCGGG + Exonic
950345324 3:12287848-12287870 GCGGGGGCGGGCGCGGGCGCCGG - Intronic
950404691 3:12797160-12797182 GGGCGGGGGGGAGGGGGCGCTGG - Intronic
950487755 3:13282956-13282978 GCCGGGGGGCTCGGCGGCGCTGG + Intergenic
950487824 3:13283157-13283179 GCGGCGGAGCGCGGCGGCGCGGG - Intergenic
950549055 3:13655400-13655422 GCGCCGGGCGGCCGGGGCGCCGG - Intergenic
950584020 3:13880181-13880203 TCCCGCGGGCGCAGGGGCGCTGG - Intergenic
950710559 3:14810597-14810619 GGGCGCGAGCGCGGGGGCGGCGG - Intergenic
951485207 3:23202975-23202997 GCGCGGCCGCGAGGGGGCGGGGG - Intergenic
951485209 3:23202977-23202999 GCGCGCGGCCGCGAGGGGGCGGG - Intergenic
951558817 3:23945877-23945899 GTTCGGCGGCGCGCGGGCGCCGG + Intronic
951780194 3:26354464-26354486 GGGCGGCGGAGCGGGGGCGGGGG - Intergenic
952389248 3:32865789-32865811 GGGCGGGGGGGGGGGGGGGCCGG - Intronic
952418911 3:33114073-33114095 GCGCGATGGAGCCGGGGCGCCGG + Exonic
952816784 3:37453102-37453124 GGGGGGGGGCGCCGGGGCTCTGG - Intronic
952867220 3:37862104-37862126 GCGCGGGGGCGCGGCGCGGGGGG - Intronic
952867230 3:37862126-37862148 GCGCGGGGGCGCGGCGCGGGGGG - Intronic
952889205 3:38029692-38029714 GGGCGGGGGCGCAGGGCAGCGGG - Intronic
952929293 3:38347052-38347074 GGGCAGGGGCGCGGGGGCCCCGG - Intronic
952942286 3:38454061-38454083 ACGCGGGGGCCGGGGGGCGGCGG - Exonic
953030632 3:39177706-39177728 GCGGGGGGGGGAGGGGGCGGAGG + Intergenic
953404652 3:42654464-42654486 GCGCGGCGGGCGGGGGGCGCGGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954204934 3:49051579-49051601 GCGGAGGGGGGGGGGGGCGCAGG - Intronic
954409690 3:50365026-50365048 GCGCGGGGCAGAGGGGGAGCGGG + Intronic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
954693840 3:52410122-52410144 GCGCGGAGGGACGGGGGCGAAGG + Exonic
954714170 3:52518902-52518924 GCGCAGGGGCGGGGCGGGGCGGG - Intronic
954859594 3:53676257-53676279 GCGAGGGGGCGGAGGGGCGGAGG - Intronic
954864688 3:53718577-53718599 GCCGGGGGGCGGGGGGGCGGGGG - Intronic
954864690 3:53718579-53718601 GGGCCGGGGGGCGGGGGGGCGGG - Intronic
955356590 3:58237466-58237488 GCGGGGCGGGGCGGGGGCGGGGG + Intergenic
955818801 3:62874869-62874891 GGGCTGGGGGGCGGCGGCGCCGG - Exonic
956596521 3:70973233-70973255 GCGGGGCGGGGCGGGGGCGGGGG - Intronic
956605008 3:71065080-71065102 GGGCCGGGGCGCGCGGGCGCGGG - Intronic
956675018 3:71725272-71725294 GAGCGGCGGCTCGGGGGCGGCGG + Exonic
956813659 3:72888447-72888469 GCTCGGGGGCGCGGACGCGGGGG - Exonic
957072868 3:75579925-75579947 TGCCGGGGGCGCGGGGGTGCTGG - Intergenic
957072877 3:75579942-75579964 GCGCAGGGGTCCGGGGGTGCCGG - Intergenic
958004289 3:87792773-87792795 GCCCCGGGGCGCGGGAGGGCAGG - Intergenic
958453858 3:94306072-94306094 GGGCGGGGTGGCGGGGGGGCGGG + Intergenic
958453860 3:94306074-94306096 GCGGGGTGGCGGGGGGGCGGGGG + Intergenic
958453864 3:94306082-94306104 GCGGGGGGGCGGGGGGGAGGTGG + Intergenic
959462504 3:106644107-106644129 GGGAGCGGGCGCGGGGGAGCAGG - Intergenic
959539497 3:107523537-107523559 GGGCACGGGCGCCGGGGCGCGGG + Intronic
960038404 3:113124599-113124621 GCGTGGGGGCGTGGGCGCGTGGG + Intergenic
960223864 3:115147438-115147460 GGGCGGGGACGGGGGGGCGGAGG - Intergenic
960639144 3:119810206-119810228 GCGCGCGGGCGGGCCGGCGCCGG + Intronic
960902212 3:122564393-122564415 TCGGGAGGGCGCGGGGGCTCCGG - Exonic
961164138 3:124751885-124751907 GTGGCGGGGCGGGGGGGCGCGGG - Intergenic
961322132 3:126083760-126083782 GCTGGGGGTCGCGGGGGAGCCGG - Intronic
961377362 3:126475778-126475800 GCGCTGGGGCTCGGCGGAGCGGG + Exonic
961654295 3:128432961-128432983 GGGCGGCGGGGCTGGGGCGCGGG - Intergenic
961696603 3:128709641-128709663 GCGCGGGGGCGGGGTGTGGCGGG - Intergenic
961780044 3:129315967-129315989 GCGAGGGGCCGAGGGGGTGCAGG + Exonic
961827155 3:129605262-129605284 GGGCGGGGGCGGGGGCGGGCGGG - Intronic
961868899 3:129974530-129974552 GAGCCGGGGCGCGGAGGCACTGG - Exonic
961873175 3:130002753-130002775 ACGCGGGGGTCCGGGGGTGCCGG - Intergenic
962322833 3:134405971-134405993 GCGGGGGGGTGGGGGGGCGGCGG + Intergenic
962750999 3:138434815-138434837 GCTGGGGGCCCCGGGGGCGCAGG - Exonic
963827312 3:149970287-149970309 GGGCTGGGGCGCGCGGGCCCCGG - Intronic
964201222 3:154121380-154121402 GCGTGGGGGCGGGCCGGCGCCGG + Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964720752 3:159765213-159765235 CCGCGGGCGGGCGGGAGCGCAGG - Intronic
966182018 3:177197028-177197050 GGCCGGGGGCGCTGGGCCGCGGG - Intronic
966182221 3:177197632-177197654 GAGCGGGCGGGCGGGCGCGCGGG + Intergenic
966711918 3:182980423-182980445 GCGGGGGTGCGCGGCAGCGCCGG + Intronic
966762203 3:183428418-183428440 GCGCTGGGGCGTGGGGCCGGCGG - Intronic
966764504 3:183447797-183447819 GCGTGGGGGCGCGGGGTGGGTGG + Intergenic
966849359 3:184155320-184155342 GCGCCGGGGCGGGGCCGCGCCGG + Intronic
966866137 3:184260061-184260083 GGGCCGGGGCGGGGGGGCGCCGG + Exonic
966886679 3:184380839-184380861 GCGCCGGGTCGCGCGGGCGTCGG + Intronic
967762330 3:193240585-193240607 GCGTGGGGGCGGAGGGGGGCCGG + Intergenic
967867804 3:194204371-194204393 GCGCGGCGGGGCGTGCGCGCCGG - Intergenic
968010531 3:195271198-195271220 GCGCCGGTGCGCGGAGGGGCGGG + Intergenic
968047352 3:195631725-195631747 GCCCGGGGTGGCGGGGGGGCGGG - Intergenic
968091341 3:195900168-195900190 GCGAAGGGGTGCTGGGGCGCGGG + Intronic
968213333 3:196867781-196867803 GGGCGGGGGCGGGGCGGCCCCGG + Intergenic
968230640 3:197003015-197003037 GGACGGGGGCGCGGGGCTGCGGG + Exonic
968258176 3:197297952-197297974 CCGCGGGGGTGCGGCGGCCCAGG - Intronic
968307261 3:197658199-197658221 GCCCGGGGTGGCGGGGGGGCGGG + Intergenic
968434127 4:576251-576273 GCGCGGGGTCGCGGCGGCGGCGG - Intergenic
968434172 4:576365-576387 GCGCGGGGCCGCGGGCGGGGTGG - Intergenic
968479161 4:826215-826237 GCGCCGAGGGGCGGGGCCGCGGG + Intergenic
968508963 4:987093-987115 GCAGCGCGGCGCGGGGGCGCAGG - Exonic
968514684 4:1011275-1011297 ACCCGGGCGCGCGCGGGCGCAGG + Exonic
968514910 4:1011843-1011865 GCCCGGGGGCGCGGGGCGGCGGG + Intronic
968514983 4:1012017-1012039 GGGCGGGGGCGGGGAGGGGCGGG + Intronic
968518348 4:1024135-1024157 GTGCTGGTGGGCGGGGGCGCTGG + Intronic
968518352 4:1024143-1024165 GGGCGGGGGCGCTGGCGGGCGGG + Intronic
968518355 4:1024151-1024173 GCGCTGGCGGGCGGGGGTGCTGG + Intronic
968518362 4:1024167-1024189 GTGCTGGTGGGCGGGGGCGCTGG + Intronic
968518366 4:1024175-1024197 GGGCGGGGGCGCTGGTGGGCGGG + Intronic
968518369 4:1024183-1024205 GCGCTGGTGGGCGGGGGCACTGG + Intronic
968556556 4:1248861-1248883 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
968578073 4:1377131-1377153 GAGCGGGGGGGCAGGGGAGCCGG + Intronic
968584126 4:1408060-1408082 GCGGGGCGGGGGGGGGGCGCAGG + Intergenic
968585017 4:1412316-1412338 TCTCGGGGGCACGGGGGCGGGGG - Intergenic
968613886 4:1568778-1568800 GCGCGGGTGGGAGGCGGCGCGGG - Intergenic
968636570 4:1684108-1684130 GCGCGGGCGGTCGTGGGCGCGGG - Intronic
968636645 4:1684371-1684393 TCGCGGCGGCGGCGGGGCGCGGG - Intergenic
968640510 4:1712288-1712310 GAGCGCCGGCGCGGGGACGCGGG - Exonic
968660034 4:1795052-1795074 GCGCGGGGGCGCGGGCGGGGCGG - Intronic
968660964 4:1798537-1798559 GCGCGAGGGGGCCGGGGCGGGGG - Intronic
968701408 4:2059709-2059731 GGCGGGGGGCGCGGGGCCGCCGG + Exonic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
968879896 4:3293309-3293331 GCGGGGCGGGGCGGGGGCGGGGG + Intronic
968908018 4:3463452-3463474 GGGGGGGGGGGCGCGGGCGCGGG + Intronic
968908054 4:3463563-3463585 GGGCGGGGGACGGGGGGCGCGGG + Intronic
968965127 4:3765854-3765876 GCGCAGCGGGGCGGGCGCGCGGG - Intergenic
969016485 4:4107244-4107266 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
969113359 4:4857062-4857084 GCGGGGGGGGGGGGGGGGGCGGG - Intergenic
969115498 4:4868473-4868495 GCGCGGGGGCGGGTGGGGGGGGG - Intergenic
969239204 4:5888197-5888219 GCGCGGGGCGGCGGGGGCGGGGG + Intronic
969242083 4:5905906-5905928 GCACGGGGGCAGGGGGGCGGGGG + Intronic
969285698 4:6200659-6200681 GGGCGGGGGCGGGGCGGGGCGGG - Intergenic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
969379012 4:6782507-6782529 GCGCGCGGGCGGTGGGCCGCGGG - Intronic
969477070 4:7427838-7427860 GCGGGGGGGCGGGGGGGCGGTGG - Intronic
969550397 4:7862398-7862420 GCGGGGGGGGGGGGGGGCGCCGG + Intronic
969611909 4:8232204-8232226 GGGCGGCGGGGCGGGGGCACAGG + Intronic
969619851 4:8273519-8273541 GGGCGGGGGTGCGGGGGGGAGGG - Intronic
969737466 4:9001072-9001094 GCGCAGGGGTCCGGGGGTGCCGG + Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970967879 4:21948852-21948874 GCGGGGGCGCGCGGGGTGGCGGG + Intergenic
971244101 4:24912973-24912995 GCGCAGCGGCTCGGAGGCGCCGG - Intronic
971351815 4:25862618-25862640 GCGCGGGGCCCCGGGGACGCGGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972414369 4:38824077-38824099 GCAGGGGGGGGCGGGGGCGGCGG - Exonic
972725850 4:41746054-41746076 GCGGCGGGGCCCGGGGGCCCGGG - Exonic
973687986 4:53393761-53393783 GCGGGGGGGGGGGGGGGGGCCGG - Intronic
973774798 4:54233177-54233199 GCGCAGGGGCGCAGGGGCGCAGG + Intronic
974047125 4:56907830-56907852 TCGCGGGCGCGCGCGGGCGTCGG + Intergenic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975821021 4:78270534-78270556 GCGGGGGGGCGGGGTGGCGGGGG - Intronic
977257726 4:94758520-94758542 GCCCGGCGGGGCGGGGGCCCAGG + Intronic
977525695 4:98143154-98143176 GCTCGGGGTGGTGGGGGCGCTGG + Exonic
977908278 4:102501633-102501655 GAGCGGGAGCGCGGCGGGGCCGG - Exonic
978073138 4:104495069-104495091 GGGCGGGGGCGCGGGGGTGGGGG + Intergenic
978126842 4:105146191-105146213 GCGCGCGGGGGCGTGTGCGCGGG + Intronic
978384689 4:108167904-108167926 GCGGGCGAGCGCGGGGCCGCCGG + Exonic
979231470 4:118352823-118352845 GTGCGGGGGCGGGAGGGGGCTGG - Exonic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
979785680 4:124712795-124712817 GAGCGGCGGGGCGGGGGCGGGGG - Intergenic
980595851 4:134953024-134953046 GGGCGGGGGCGCGTAGGCTCTGG - Intergenic
981550542 4:145937557-145937579 GCGCCGGGGCGCGGGGCGGCCGG - Intronic
981550545 4:145937565-145937587 GAGGGGGCGCGCCGGGGCGCGGG - Intronic
981713563 4:147732026-147732048 GCGCGGGGGCCGGGCGGGGCGGG + Intergenic
982288738 4:153759768-153759790 GCGCGGGGGCGCGGGCGTGGGGG - Intronic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
982770185 4:159390248-159390270 GGGTGGGGGGGCGGGGGGGCAGG - Intergenic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
984206488 4:176792837-176792859 GCCCGGGAGCGCCGCGGCGCAGG + Intergenic
984923414 4:184785597-184785619 GGGCGGGGGCGGGGGGGGGGGGG + Intronic
984928381 4:184826092-184826114 GGGCGGGGCCGCGGGAGGGCGGG - Intronic
985550152 5:528684-528706 GCCCAGGGGCGCGGGGGAGCGGG - Intergenic
985714269 5:1446594-1446616 GAGCCGGGGAGCGGGGGAGCGGG - Intergenic
985988392 5:3536102-3536124 GCGCGGGTGAGCGTGCGCGCGGG - Intergenic
987088208 5:14488278-14488300 GCAGGGGGGCGGGAGGGCGCGGG - Intronic
987258252 5:16179435-16179457 GCGCGGGGCCGCGGGGACCGGGG + Exonic
987374009 5:17217825-17217847 CCGCGGCGGCGCGGGGCCACCGG - Intronic
988777557 5:34490843-34490865 TGGCGGGGGCGGGGGGGCGGTGG + Intergenic
990347463 5:54884181-54884203 GCTCCGGGTCGCGGCGGCGCAGG - Intergenic
990499684 5:56383903-56383925 GGGCGGGGCCGCGGGGGTGGGGG - Intergenic
990955061 5:61332440-61332462 GTGCGGGGGCGGCGCGGCGCTGG + Exonic
991261994 5:64677470-64677492 GGGCGGGGGTGGGGGGGCGGGGG - Intergenic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
992228652 5:74641981-74642003 GCGCGGGCGCTTGGGGACGCGGG - Intronic
992866330 5:80960548-80960570 GCGCGCGGTGGCAGGGGCGCGGG - Intergenic
992939561 5:81750226-81750248 GGGCGGGGGCGGGTGGGCGCCGG - Intronic
993504649 5:88694331-88694353 GAGCCGGGGCGCGGGGCCTCGGG - Intergenic
993519465 5:88883246-88883268 GCGCGCGAGGGGGGGGGCGCGGG + Intronic
993901013 5:93584453-93584475 GCGCGGGGGTGCGGGCGAGGCGG + Exonic
994208825 5:97065053-97065075 GGGGGGGGGCGGGGGGGGGCAGG + Intergenic
994964949 5:106657288-106657310 GGGCGGGGGGGGGGGGGCGGAGG + Intergenic
995724812 5:115170830-115170852 CCGCGGGGGTGCGGGGGTGCCGG - Intronic
995735603 5:115296715-115296737 GTGCAGGGGTGCGGGGGTGCGGG + Exonic
996184958 5:120464206-120464228 GCGCGTGTGCGCGAGAGCGCCGG + Intergenic
997265014 5:132490396-132490418 GCGCGGGCTCCGGGGGGCGCCGG - Intronic
997485195 5:134225579-134225601 GCGCGGGAGGCAGGGGGCGCCGG + Intronic
997521385 5:134526340-134526362 GCGAGGGGGCGCGGGCGGGCGGG + Intronic
997582966 5:135028714-135028736 GGGCGCGGGCGCGGGCGCGGAGG - Exonic
997984476 5:138492002-138492024 GCGCAGGGGCGCAGGGGCTCCGG - Intergenic
998033930 5:138897296-138897318 GGGCGGGGGCGGGGGGGGGGGGG - Intronic
998130288 5:139648334-139648356 GGGCGGGCGCGCGGCGGCGGCGG + Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998156107 5:139788166-139788188 GGGGGGGGGCGCGGGGGGGGCGG - Intergenic
998166671 5:139848284-139848306 GCGCGCGGCCGCGGCGGCGGCGG + Exonic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
999188743 5:149731240-149731262 GCGCGGGGGAGCGAGGAAGCTGG + Intronic
999268822 5:150284553-150284575 GGGCGGCTGCGCGGGGGCGGAGG + Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1000320960 5:160133955-160133977 GGGGGGGGGGGCGGGGGCGGGGG - Intergenic
1000345844 5:160312627-160312649 CCCGCGGGGCGCGGGGGCGCCGG - Intronic
1001314688 5:170633704-170633726 GCGAGGGGGCGGGGGGGCGGAGG + Intronic
1001395894 5:171419585-171419607 GCGAGGGGGCGGGGGGCCGGGGG - Intergenic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001556746 5:172641890-172641912 CCGCGGGGGCGCTGGGAGGCTGG - Intronic
1001773412 5:174312019-174312041 ACCCGGGCGCGCGGGGGCGCGGG + Intergenic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002474114 5:179454290-179454312 GGGCGGGGGGGCGGGGGCAGGGG - Intergenic
1002559574 5:180072133-180072155 GCGGGGGGGCGGGGCGGCGGCGG - Intergenic
1002580879 5:180208961-180208983 GCGCGGGCTCGCGGGGGCTGGGG - Intronic
1002638378 5:180619181-180619203 CCGCGGGCGGGAGGGGGCGCGGG - Intronic
1002897933 6:1389969-1389991 GCGCGGCGGAGCGGGGCCGGCGG - Exonic
1002928911 6:1620293-1620315 GAGCTGGGGAGCGGGGACGCGGG + Intergenic
1002991741 6:2245294-2245316 GTGCGGGGGCGGGGGCGCGCCGG - Intronic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003124122 6:3341779-3341801 GGGTGGGGGCGGGGGAGCGCAGG + Intronic
1003175522 6:3750683-3750705 GCGGGGGTGCGGGGGGGCCCTGG + Intronic
1003290703 6:4776334-4776356 GCGCGGGAGCGCGGCTCCGCAGG + Intronic
1003291267 6:4780393-4780415 GGGCGGGGGGGGGGGGGCGTAGG - Intronic
1003291268 6:4780399-4780421 GGGCGGGGGCGGGGGGGGGGGGG - Intronic
1003552275 6:7109288-7109310 GGGAGGGGGCGCGGGGGGCCCGG - Intronic
1003645539 6:7910659-7910681 GCGCTGGGGCGCCCGGGCCCAGG - Exonic
1003645605 6:7910872-7910894 GCGCGCCGGCGCGGGCGGGCGGG - Intronic
1003875878 6:10436179-10436201 GCGCGGTGGCGAGTGGGCGACGG - Intergenic
1003927164 6:10887176-10887198 GCTAGGGCGCGCGAGGGCGCGGG + Intronic
1003927166 6:10887184-10887206 GCGCGAGGGCGCGGGGTCCCTGG + Intronic
1003927169 6:10887192-10887214 GCGCGGGGTCCCTGGGGCTCAGG + Intronic
1003942671 6:11044371-11044393 CCGAGGGGGCGGGGAGGCGCGGG - Intergenic
1003942727 6:11044527-11044549 GCGCGAGGCCGCAGGGGCGGGGG - Intergenic
1004167993 6:13273899-13273921 GCGGGGCGGGGCGGGGGGGCCGG - Intronic
1004262142 6:14117756-14117778 GAGCTGTGGCGCGCGGGCGCCGG - Exonic
1004396230 6:15248445-15248467 GGGCGGGGGCGTGGGCGTGCCGG + Intronic
1004615319 6:17282610-17282632 GGGCGGGGGCGTGGGGGGGGGGG - Intronic
1004662349 6:17721559-17721581 GGGCGGGGGCTGGGGGGCGGGGG + Intergenic
1004864121 6:19837247-19837269 GCGCGCGGGCGGGGGCGCGGAGG - Intergenic
1005583104 6:27251589-27251611 GGGCGGGGGCCTGGGGGCGGGGG + Intronic
1005912966 6:30326904-30326926 GCGCCGCGGGGCGGGGGCGAGGG + Exonic
1005990122 6:30897301-30897323 GGGCAGGGGGGTGGGGGCGCGGG + Intronic
1006170127 6:32087627-32087649 GGGCGGGGGTGCGGGGGAGCCGG + Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006472719 6:34237492-34237514 GCGGCGGGGCCCGGCGGCGCGGG + Intronic
1006472950 6:34238244-34238266 GCGCGCGGGGGGAGGGGCGCAGG - Intronic
1006642453 6:35496381-35496403 GCGCGGTGCCGCGGCTGCGCTGG - Intronic
1006717568 6:36130361-36130383 GGGCGGAAGCGCGGGAGCGCAGG + Exonic
1007072728 6:39048845-39048867 GCGCAGCGGGCCGGGGGCGCCGG - Exonic
1007478310 6:42133820-42133842 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007479026 6:42137813-42137835 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007557919 6:42782478-42782500 GGGCGGGGGCGCAGGCGGGCAGG + Intronic
1007739505 6:44002267-44002289 GCGGGGGAGGGCGTGGGCGCGGG - Intronic
1007752061 6:44076750-44076772 GCGGGGGGGAGGGGGCGCGCCGG - Intergenic
1007800506 6:44388146-44388168 GCCGGGGGGGGCGGGGGGGCGGG - Intronic
1007897459 6:45377664-45377686 GCGCGGGGGCCCAGCGACGCTGG + Intronic
1008106045 6:47442126-47442148 ACGGGTGGGCGGGGGGGCGCGGG + Intergenic
1009437729 6:63636479-63636501 CCGCTGAGGCGCGGGCGCGCAGG + Intronic
1010032911 6:71288897-71288919 GCGCGGGGCTGCGGGGCTGCGGG - Exonic
1010244785 6:73653491-73653513 GGGCGGGGGCGGGGGAGCGGCGG - Intronic
1010249879 6:73696313-73696335 GCGCGCGGGCGCGCGGGCCTGGG + Intronic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1010428169 6:75749153-75749175 GCCCGAAGGGGCGGGGGCGCCGG - Intergenic
1010703132 6:79077115-79077137 GCGCGGGGGCGCGCGAGAGTCGG - Intronic
1010703455 6:79078342-79078364 GCGCCGGGGGGCGGGGGCGCGGG - Intergenic
1011226611 6:85114979-85115001 GGGGGCGGGGGCGGGGGCGCCGG + Intergenic
1011226913 6:85117864-85117886 GGGCGGGGGTGCGGGGGCAGGGG + Intergenic
1011434473 6:87322482-87322504 GCGCAGCGGCGCGGGGCTGCGGG - Intronic
1011448958 6:87472949-87472971 GCGCGGGGGCGCGGAGGGGGCGG + Intronic
1012245782 6:96924471-96924493 GGGCGGGGGCGGGGGGCGGCAGG + Intergenic
1012245805 6:96924551-96924573 GCGCGGGATCGCGGGGGAGGGGG + Intergenic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1012410127 6:98947643-98947665 GCGCGGGGCCGCGGGCGGGGAGG + Intronic
1012895502 6:104941454-104941476 GCGGGGCAGGGCGGGGGCGCAGG + Intergenic
1012912898 6:105137230-105137252 GCCGGGGGGCGCGGGGCGGCGGG - Intergenic
1012986351 6:105880414-105880436 GTGCGGGGGCGCGTGTGCTCCGG - Intergenic
1013400507 6:109791423-109791445 GCTGGGGGGCGGCGGGGCGCTGG - Exonic
1013576053 6:111483838-111483860 GGGTGGGGGCGCGCGGGCGCGGG + Intergenic
1013619289 6:111872891-111872913 GCGCGGGGGCGCCGGCGGCCGGG + Intronic
1014001236 6:116368926-116368948 GGGCGGGGGCGGGGGGACGGGGG + Intronic
1014137592 6:117907393-117907415 GCGCGGGGGCGCGGAGCTGCCGG - Intergenic
1014156720 6:118119489-118119511 GCGGGGTGGAGGGGGGGCGCCGG - Intronic
1014913196 6:127118148-127118170 GCGCTGGGGCACAAGGGCGCAGG + Intergenic
1015149066 6:130019204-130019226 GTGGGGGAGCGCGGCGGCGCCGG + Intronic
1015785921 6:136921818-136921840 GCGCCGGGGCGAGGGGGCTGGGG + Intergenic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1016328227 6:142927009-142927031 GCGCGGCGGCGCGGGGCGGGCGG + Intronic
1016340904 6:143060793-143060815 GCGGGGCGGGGCGGGGGCGGGGG - Intronic
1016340913 6:143060806-143060828 GCGCGGGCGCGGGGCGGGGCGGG - Intronic
1016982317 6:149864389-149864411 GCGGGGCCGCGCGGGGGGGCGGG - Intergenic
1016982323 6:149864397-149864419 GCGCGGGGGCGGGGCCGCGCGGG - Intergenic
1017662404 6:156687363-156687385 GCGCGGCGGCGCGAGGGTTCCGG + Intergenic
1017671821 6:156777163-156777185 GCGCGGCGGCGTGGGGCGGCCGG - Intergenic
1018017815 6:159727612-159727634 GCGCGGTGGCCCGGGGGGCCCGG + Intronic
1018998691 6:168729394-168729416 AGGCGGGGGCGAGGGGGGGCGGG + Intergenic
1019197215 6:170289821-170289843 GGGCGGGGGCGTGAGGACGCGGG + Intronic
1019343707 7:519903-519925 GGGGGGGGGGGCGGGGGCGGGGG - Intronic
1019406324 7:885996-886018 GCGGGGGAGCGCGGTGGCGAGGG + Intronic
1019473398 7:1232970-1232992 GTGGCGGGGCGCGGGGGCGCGGG - Exonic
1019473410 7:1232992-1233014 GCGCGGGGGGCCGGCGGGGCCGG - Exonic
1019474369 7:1236823-1236845 CGGCGGGGGCGCGGGGCCGGCGG - Exonic
1019474637 7:1238195-1238217 GCGGGCAGGGGCGGGGGCGCGGG - Intergenic
1019510192 7:1413969-1413991 GCGGGGGGGGGGGGGGGCGTGGG - Intergenic
1019529136 7:1494970-1494992 GCGCTGGGGCCCGTGGGAGCGGG - Intronic
1019539799 7:1546509-1546531 GCGCCGGGGCGCTGGGCAGCCGG - Exonic
1019608579 7:1923448-1923470 GCGCGGGGGTGCCAGGGTGCCGG - Intronic
1019735202 7:2647027-2647049 GCGCGGTGGGGCGGGGACGGAGG + Intronic
1019828372 7:3301722-3301744 GCCCGGGGTCGCGAGGGCTCCGG - Exonic
1019999177 7:4745183-4745205 CCGCGGGGGCGGGGCGGCACTGG - Intronic
1020034842 7:4958764-4958786 GCGAGGAGGCGCGGGCGCCCCGG + Intronic
1020037607 7:4974250-4974272 GGGGGTGGGGGCGGGGGCGCGGG + Intergenic
1020066176 7:5190209-5190231 TCGCGGGGGCGGGGCCGCGCAGG + Exonic
1020069034 7:5213411-5213433 GCGAGGGGCCGCGGGTGCGAGGG + Intronic
1020162228 7:5781430-5781452 GGGGGTGGGGGCGGGGGCGCGGG - Intronic
1020983169 7:15097108-15097130 GCGGGGGGGGGCGGGGGGGGGGG - Intergenic
1021719247 7:23490434-23490456 GGGCGGGGGCGGGCGGGCGCGGG + Intergenic
1021719251 7:23490442-23490464 GCGGGCGGGCGCGGGCGGGCGGG + Intergenic
1021761222 7:23904748-23904770 GCGTGGCGGCGTGGGGGCGGGGG + Intergenic
1021781750 7:24113671-24113693 GCGTGGGGGCAGGGGGGAGCGGG - Intergenic
1021969370 7:25951396-25951418 GGGCGGTGGCGCGTGGGGGCGGG + Intergenic
1021969376 7:25951404-25951426 GCGCGTGGGGGCGGGGGCGGGGG + Intergenic
1021992598 7:26152448-26152470 GCGCCGGGACCCGCGGGCGCCGG + Exonic
1021998363 7:26201701-26201723 GCGCGGGGCCGCCGGGGGGAGGG - Intronic
1022340976 7:29468137-29468159 GGGCGGGGGGGGGGGGGGGCGGG - Intronic
1022427963 7:30285580-30285602 GAGCGGCTGCGCGGGGCCGCCGG - Exonic
1022721082 7:32942624-32942646 GCGCGGGTGGGCGGGGGCCTCGG - Intergenic
1023177636 7:37448773-37448795 GCGTGGGGCCGCGGCGGCGTGGG + Exonic
1023842370 7:44104611-44104633 GCGCGGGGGGTCAGGGGCTCTGG - Exonic
1023881981 7:44325850-44325872 GTGCGGGGGCGGGCGGGGGCGGG - Intronic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1023955728 7:44885378-44885400 GGGCGGGGGCGCGAGCGCGGCGG - Intergenic
1024043806 7:45574426-45574448 GCGGCGAGGCGCCGGGGCGCGGG - Intronic
1024043815 7:45574449-45574471 GCGCCGGGGCGGGCGGGCGGCGG - Intronic
1024043829 7:45574477-45574499 GGCCCGGGGCGCCGGGGCGCGGG - Intronic
1024307735 7:47942428-47942450 GGGCGGGGGCGCGGGGCAGGAGG - Intronic
1024307738 7:47942436-47942458 GAGTGGGGGGGCGGGGGCGCGGG - Intronic
1024323236 7:48089572-48089594 GCGCGGCTGCGCGGGGAGGCGGG + Intronic
1024639360 7:51316849-51316871 GCGGCGCGGGGCGGGGGCGCCGG + Intergenic
1025106561 7:56175510-56175532 GCGCGGCGGCGCGGGGTCCTCGG + Intergenic
1025762262 7:64405623-64405645 GGGAGGGGGCGAGGGGGCCCCGG - Intergenic
1025850506 7:65239786-65239808 GCGCGAGGGCGGGGCGGGGCGGG + Intergenic
1026000350 7:66556272-66556294 GGGCGCGGGCGCGGGCGCGAGGG - Intergenic
1026297105 7:69062719-69062741 TCGCGGGGATGGGGGGGCGCTGG - Intergenic
1026894138 7:74000292-74000314 GTGGGGGGGGGCGGGGGCGGGGG + Intergenic
1026909464 7:74083892-74083914 GCCCGGGGAGGCGGGGGCGGAGG - Intronic
1026994482 7:74606607-74606629 GAGCGGTGGAGCGGGGGCGGCGG - Intergenic
1027138253 7:75639346-75639368 CCCCGGGGGCTCGGGCGCGCCGG - Intronic
1027374891 7:77538528-77538550 TGGCGGAGGCGGGGGGGCGCTGG - Intronic
1028621582 7:92834003-92834025 GCGCGGGGGAGGGGAGGCGCCGG + Intronic
1029074949 7:97928046-97928068 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1029188293 7:98754934-98754956 GGGGGGGGGCGGGGGGGGGCGGG - Intergenic
1029238701 7:99143682-99143704 GCGAGGGGGCGCCGGGGCGCGGG + Intronic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029238828 7:99144142-99144164 GCGCGGGGGCGCGCAGGGCCGGG - Intergenic
1029536286 7:101159724-101159746 GGGCGGGGGCGCTGGGGAGCAGG - Intronic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1029570166 7:101363524-101363546 GGGCTGGGGCGCGGGGCGGCGGG + Intronic
1029639856 7:101814221-101814243 GCGCGGGGGCCTGGGCGCGCCGG + Intergenic
1029708333 7:102286817-102286839 GGGCGGGGGCGGGGCGGGGCCGG + Intronic
1029715109 7:102321469-102321491 TCGACGGGGCGCGGGGGGGCGGG - Exonic
1029738651 7:102479078-102479100 GTGCGGGGTGGCGGGGGCGGGGG - Intergenic
1029746432 7:102517814-102517836 GGGCGGGGGCGGGGCGGCGGGGG + Intergenic
1029764369 7:102616793-102616815 GGGCGGGGGCGGGGCGGCGGGGG + Intronic
1029849403 7:103446284-103446306 GCGCTGGGACGCCGGGGCGCGGG + Intergenic
1029896506 7:103989744-103989766 GCGGGGCGGCGCGCGGGGGCGGG - Intergenic
1030348242 7:108456440-108456462 GCGGGGGCGCGCGCCGGCGCGGG - Intronic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031043546 7:116862911-116862933 GCGACGGCGGGCGGGGGCGCGGG + Intronic
1031043548 7:116862917-116862939 GCGGGCGGGGGCGCGGGCGCGGG + Intronic
1031043550 7:116862919-116862941 GGGCGGGGGCGCGGGCGCGGGGG + Intronic
1031317255 7:120273310-120273332 GCTCGGCAGCGCGGGGGCGCGGG - Intergenic
1031361826 7:120857365-120857387 GGGCGGCGGGGCGGGGGCGGGGG + Intronic
1031361864 7:120857502-120857524 GGGCGGGGGGCGGGGGGCGCCGG + Intronic
1031531868 7:122886186-122886208 GCGCCGGGGCGCGCGGGCGGCGG - Exonic
1031886596 7:127251690-127251712 GGGCGTGGGCGCGGGCGCTCGGG - Intronic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032074531 7:128830236-128830258 GCGCGGGGGAGGGGCGGCGGGGG + Intergenic
1032092140 7:128916230-128916252 ACGCGGGGACGCGGGGACGCGGG + Intergenic
1032237927 7:130140900-130140922 GCGCGGCGGCGCCGGGCTGCGGG - Intergenic
1032344330 7:131105852-131105874 GCGGGAGGGGGCCGGGGCGCGGG - Intergenic
1033220399 7:139523652-139523674 GCGAGGCGGCGCGCGGGAGCCGG - Intergenic
1033390768 7:140924938-140924960 GCGGGGGTGCGGGGGGGAGCGGG + Intergenic
1033654384 7:143362862-143362884 GAGCAGGGGCGGGGAGGCGCGGG - Intergenic
1033661994 7:143408694-143408716 GGTTGGGGGCGCGGGGGCGGGGG + Intronic
1033756853 7:144403439-144403461 GGCAGGGGGCGCGGGGGAGCGGG + Intronic
1033756859 7:144403447-144403469 GCGCGGGGGAGCGGGGAGGGGGG + Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034182711 7:149150700-149150722 GAGGGGAGGCGGGGGGGCGCGGG - Intronic
1034201428 7:149285326-149285348 TCGCGGGGCCGCCGGGGCTCGGG - Intronic
1034228034 7:149497859-149497881 GCGGGGCGGGGCGGGGCCGCGGG - Intergenic
1034228068 7:149497933-149497955 TCGCGGGGTCGCGGGGTCGCGGG - Intergenic
1034228072 7:149497941-149497963 GGCCGGGGTCGCGGGGTCGCGGG - Intergenic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1034445930 7:151114517-151114539 GCGGCGCGGCGCGGGGGAGCCGG - Intronic
1034568364 7:151933754-151933776 GCGGGGGGGCGGGGGGGCCGTGG - Intergenic
1034617933 7:152435529-152435551 GCGCCGGGGCGCGGAGGCCGCGG + Intronic
1034659902 7:152759950-152759972 GAGCGGGGCCGCGGAGGAGCGGG - Intronic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1035125832 7:156607419-156607441 GCTCGGGCGCGGGTGGGCGCGGG - Intergenic
1035127150 7:156616792-156616814 GAGCCCGGGCGCAGGGGCGCGGG - Intergenic
1035436508 7:158863776-158863798 GTGTGGGGGCGGGGGGGAGCGGG + Intronic
1035537920 8:406756-406778 GCGTGGGGGCGTGGGGGCGTGGG - Intronic
1035537924 8:406764-406786 GCGTGGAGGCGTGGGGGCGTGGG - Intronic
1035580868 8:738328-738350 GCACGGGGGCTCGCGGGGGCGGG + Intergenic
1035588884 8:798271-798293 GCGCCGGGGCACGGGGCTGCAGG - Intergenic
1035588918 8:798439-798461 GCGCCGGGGCACGGGGCTGCAGG - Intergenic
1035588934 8:798523-798545 GCGCCGGGGCACGGGGCTGCAGG - Intergenic
1035588967 8:798691-798713 GCGCCGGGGCACGGGGCTGCAGG - Intergenic
1035602066 8:902741-902763 GTGCGGGTGGGCGGGGGCGGGGG + Intergenic
1035602089 8:902809-902831 GTGCGGGTGGGCGGGGCCGCCGG + Intergenic
1035602128 8:902906-902928 GTGCGGGTGGGCGGGGGCGGTGG + Intergenic
1035690166 8:1554765-1554787 GCGCGGGGGAGGGGGGGCTGGGG - Intronic
1035751894 8:2002221-2002243 GCCCGAGGGCGCGCCGGCGCGGG + Exonic
1036033248 8:4994123-4994145 GCGGGGTGGGGCGGGGGCCCAGG + Intronic
1036242568 8:7092334-7092356 GCGCGGGGGTCCGGGGCTGCCGG + Intergenic
1036258227 8:7221677-7221699 GCGCTGGGGTCCGGGGGTGCCGG - Intergenic
1036307341 8:7611704-7611726 GCGCGGGGGTCCGGGAGTGCCGG + Intergenic
1036310275 8:7680273-7680295 GCGCTGGGGTCCGGGGGTGCCGG - Intergenic
1036358185 8:8059688-8059710 GCGCGGGGGTCCGGGAGTGCCGG + Intergenic
1036359262 8:8065830-8065852 GCGCCGGGGTCCGGGGGTGCCGG + Intergenic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036578947 8:10054788-10054810 GCGCAGGCGCGAAGGGGCGCCGG + Intronic
1036708071 8:11059726-11059748 GGGCGGGGTCCGGGGGGCGCGGG - Intronic
1036786685 8:11692665-11692687 GTGCGGGGGTGCGGGGGTGAGGG + Intronic
1036891696 8:12601122-12601144 GCGCCGGGGTCCGGGGGTGCCGG - Intergenic
1036892765 8:12607255-12607277 GCGCGGGGGTCCGGGAGTGCCGG - Intergenic
1036899244 8:12659086-12659108 GTCCGGGGGCGCGGAGGTGCCGG - Intergenic
1036900315 8:12665242-12665264 GCGCGGGGGTCCGGGGGTGCCGG - Intergenic
1036910569 8:12754671-12754693 GCGCGGGGATGCGGCGGGGCCGG - Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038055789 8:23856293-23856315 GGGCGGGGGGGGGGGGGCGGCGG + Intergenic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1038291178 8:26251220-26251242 GGGCAGGGGCGGGGGGGGGCAGG + Intergenic
1038304170 8:26383643-26383665 GCGCGGGAGCGGGGCGGGGCGGG + Intronic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038575717 8:28701844-28701866 GCCCGGTGGCTCGGGGGCCCGGG + Intronic
1038650817 8:29401768-29401790 GCGGGGGGGCGGGGGGCGGCGGG - Intergenic
1038883593 8:31640035-31640057 GGGCGGCGGAGCCGGGGCGCTGG - Intronic
1039212694 8:35235348-35235370 GGGCGGTGACGCGGCGGCGCTGG - Intergenic
1039518456 8:38152088-38152110 GCGGGGGGGCGGGGGGGGGCGGG + Intergenic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039630585 8:39107697-39107719 ACGCGGGGACGCGCGGACGCCGG - Exonic
1039903261 8:41767655-41767677 GGGGGTGCGCGCGGGGGCGCGGG + Intronic
1039903265 8:41767661-41767683 GCGCGCGGGGGCGCGGGCGGGGG + Intronic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1040038844 8:42896776-42896798 GCGCGGCGGCGCGGGTCGGCCGG + Intronic
1040038880 8:42896880-42896902 GGGCGGGGACGCGGGGCGGCGGG + Intronic
1040545785 8:48396976-48396998 GGGCGGGGGCGGGGGTGCGCGGG - Intergenic
1041244901 8:55880311-55880333 GCCCGGGGGAGCCAGGGCGCGGG + Intronic
1041281079 8:56211540-56211562 GCTGGGGGGCGCGGTGGGGCGGG + Intergenic
1041690393 8:60680400-60680422 GGGGGGGGGGGCGGGGGCGGCGG + Intronic
1043388273 8:79768382-79768404 GCGCGAGGGCGCGCCGGCGGGGG + Intergenic
1043463857 8:80486552-80486574 GCGCGGCGGGGCGGGGGTGGAGG + Exonic
1043472661 8:80578257-80578279 GCGCGGGGGTGCGGGCGGCCGGG - Intergenic
1044999812 8:97869423-97869445 GCGCCGGGGCCCCGGGGCGCTGG - Intronic
1045305414 8:100952691-100952713 GGGCGGGGGCCCCGGGGCGGGGG + Intronic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1045737939 8:105318538-105318560 GAGGGGGAGCGCGGGGGCGCAGG - Intronic
1046379712 8:113435605-113435627 GCGGGGGGGCGGGGGATCGCGGG - Intronic
1047041796 8:121005256-121005278 GTGCGGGGGTGCTGGGGTGCTGG + Intergenic
1047097676 8:121641550-121641572 GCGCGGGCGGGCGGGCGAGCGGG + Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047998628 8:130358744-130358766 GAGCGGGGGCGGGGCGGGGCGGG - Intronic
1048307981 8:133296963-133296985 GCGCGGGCGCGAGGGGGCTTTGG - Exonic
1049194515 8:141308107-141308129 GGCCGGGGCCGCGGGGGCGGCGG + Intronic
1049229130 8:141473047-141473069 GCGGGGGGGGGCGGGGGGGGGGG - Intergenic
1049391186 8:142372528-142372550 GCGGGGTGGAGCGGGGGTGCTGG + Intronic
1049419486 8:142510588-142510610 GCTGGGGGCGGCGGGGGCGCGGG + Intronic
1049446075 8:142632266-142632288 GCCCAGGGCCGCCGGGGCGCTGG + Intergenic
1049585408 8:143430506-143430528 CGGCGGGGGCGGGGGGGCGCCGG + Intergenic
1049585410 8:143430512-143430534 GGGCGGGGGGGCGCCGGCGCGGG + Intergenic
1049697226 8:143990259-143990281 CCGCGTGGGGGCGGGGGCGGGGG - Exonic
1049697381 8:143990687-143990709 TCGCGGGGGTGGGGGGGCTCGGG + Intronic
1049707959 8:144051481-144051503 GCGGGGGGGGGCGGGGAGGCGGG + Intronic
1049719266 8:144108129-144108151 GCCGGCGGGCGCGGGCGCGCGGG - Exonic
1049752522 8:144291884-144291906 GCGCGCGGGCGCGGGGCCCGTGG + Intronic
1049756578 8:144313683-144313705 GCGCGGGGAGGCGGGGAGGCGGG - Intronic
1049756582 8:144313691-144313713 GGGCGGCGGCGCGGGGAGGCGGG - Intronic
1049756598 8:144313725-144313747 GCGGGGAGGCGCGGGGAGGCGGG - Intronic
1049756602 8:144313733-144313755 GCGGGGAGGCGGGGAGGCGCGGG - Intronic
1049762562 8:144337788-144337810 GCGCGGGGGCTCCGGGGCTCCGG + Intergenic
1049867862 8:144950619-144950641 GCGCGGGGGGGGCGGGGCGGGGG - Intronic
1049879457 8:145052277-145052299 GCGCGGGCGGGGCGGGGCGCGGG - Intergenic
1050620010 9:7442531-7442553 GCGGGGGGGGGGGGGGGGGCGGG - Intergenic
1050845206 9:10208231-10208253 GCGGCGGGGCGCGGTGGCTCAGG + Intronic
1051416589 9:16847398-16847420 GGGCGGGGGGGGGGGGGCGGCGG + Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053034092 9:34809921-34809943 ACCTCGGGGCGCGGGGGCGCGGG + Intergenic
1053079367 9:35161894-35161916 GCGGGGGGGGGCGGGGTCGGTGG + Intergenic
1053230100 9:36400901-36400923 GCGGCGGGGCGCGGCGGGGCGGG - Intronic
1053306143 9:36986086-36986108 GCGCGCCGGGGCGAGGGCGCCGG - Intronic
1053455010 9:38227058-38227080 GCGGGGGGGGGGGGGGGCTCCGG + Intergenic
1054400633 9:64712375-64712397 GCCCGGGGGCGGGGGGGGGGCGG + Intergenic
1055501473 9:76906274-76906296 GCGCCGTGGCGCGTGGGCGGAGG + Intergenic
1055757663 9:79572846-79572868 GCGGCGGGGCGCGGGCTCGCCGG + Intronic
1056413493 9:86354619-86354641 GAGCGAGTGCGCTGGGGCGCCGG - Intergenic
1056414472 9:86362878-86362900 GGGTGGGGGGGCGGGGGTGCGGG + Intergenic
1056414478 9:86362886-86362908 GGGCGGGGGTGCGGGGGGGGTGG + Intergenic
1056659518 9:88534378-88534400 GCCCAGGGGCGCGAGGGCGCGGG + Intergenic
1056659522 9:88534386-88534408 GCGCGAGGGCGCGGGAGTGTGGG + Intergenic
1056773878 9:89497880-89497902 GCGCGGGAGGGAGGGCGCGCGGG - Intronic
1056992282 9:91423561-91423583 GCGGGCGGGCGGGCGGGCGCGGG - Intronic
1057146937 9:92764847-92764869 GTGCGGCGGCGCGGGCGGGCGGG - Intergenic
1057199772 9:93133920-93133942 ACGAGGGGGCGTGGGGGCGCAGG - Intronic
1057259664 9:93576666-93576688 CGGCGGGGGCGGCGGGGCGCAGG - Exonic
1057298092 9:93860973-93860995 GGGCGGGGCCGCTGGGGGGCAGG + Intergenic
1057313450 9:93955244-93955266 TCGGGGCGGCGCGCGGGCGCCGG + Exonic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432227 9:95004935-95004957 GGGCGGCGGCGCGGGCGGGCGGG - Intronic
1057432338 9:95005297-95005319 GCGCTGCGGCGCGCGGGTGCGGG + Intronic
1057488542 9:95505855-95505877 GCGCGGGGCTGCGGAGGCGGCGG - Intronic
1057490460 9:95516268-95516290 CCGCCTGGGCGCGGGAGCGCGGG - Intronic
1057490498 9:95516382-95516404 GCGCGGGGACACGGGGACGCGGG - Intronic
1057546223 9:96021773-96021795 GGGCGGGAGGGCGGAGGCGCCGG + Intergenic
1057547260 9:96027609-96027631 GCGCTGGGCGGCGGCGGCGCCGG - Intergenic
1057573302 9:96219826-96219848 GCTAGGGGGCGCGGGAGAGCAGG - Intergenic
1057596097 9:96417583-96417605 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1057619104 9:96619418-96619440 CGGCGGGCGCGCGGGCGCGCGGG - Exonic
1057619125 9:96619458-96619480 GCGCGGGCGCTCGGGGCGGCGGG + Exonic
1057832687 9:98419095-98419117 GCCCGGGGGGGCGGTGGAGCAGG + Intronic
1057881478 9:98796105-98796127 GCGGCGGGGCCCGGGGGCCCGGG - Intronic
1058058463 9:100472974-100472996 GGGCAGGGGCGCGGGGGCCGGGG - Intronic
1058099742 9:100905698-100905720 GGGGGGGGGGGCGGGGGCGGGGG + Intergenic
1058778151 9:108305843-108305865 GGGCGGGGTCGGGGGGGGGCGGG - Intergenic
1058885741 9:109320364-109320386 GCGGCGGGGCGCGGGGCCGCCGG - Exonic
1058908125 9:109497996-109498018 GGGCCGGGGCGGGAGGGCGCGGG - Intronic
1059123372 9:111661828-111661850 TCGGCGGGGCGCGGGGGCGGTGG + Intronic
1059145645 9:111897029-111897051 GCGCGCGGGCGGGGGCGCGCAGG + Exonic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059176766 9:112175253-112175275 GGGAGGAGGCGCGGGCGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059206939 9:112476255-112476277 GCGGGGGGGGGGGGGGGCGGGGG - Intronic
1059375256 9:113876230-113876252 GGCCGGGGGGGCGGGGGCGCTGG - Intergenic
1059470931 9:114504710-114504732 GCGGGCGGCGGCGGGGGCGCGGG - Exonic
1059769780 9:117414621-117414643 GCCCGGGGACGCGGCGGCGGCGG + Exonic
1060106526 9:120876585-120876607 GCGCGGGGCCGGGCGGGGGCAGG + Intronic
1060106774 9:120877428-120877450 GGGCGGGGGCGGGCGGGGGCTGG - Intronic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1060215955 9:121738268-121738290 GCGCGAGGGCACAGGGGCACCGG - Intronic
1060514574 9:124257909-124257931 GCGGGGAGGGGCGGGCGCGCGGG + Intronic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1060555311 9:124504817-124504839 GGACGGGGAGGCGGGGGCGCGGG + Intronic
1061028957 9:128068272-128068294 GCGGGCGGGAGCGGGGGCGGCGG - Exonic
1061052158 9:128203355-128203377 GGGCGGGGGCCCCGCGGCGCAGG + Intronic
1061108918 9:128552942-128552964 GGGAGGGGGCGCGAGGCCGCCGG + Intronic
1061128218 9:128689759-128689781 GCGGGGGGGCGCGGCGCGGCCGG + Intronic
1061129830 9:128702690-128702712 GCGCTGGGGCGCGGGACCTCGGG + Exonic
1061231613 9:129319043-129319065 GGGCGGGGGCGACGGGGGGCAGG - Intergenic
1061248374 9:129413272-129413294 GCGGCGGGGCGCGTTGGCGCGGG - Intergenic
1061252687 9:129436014-129436036 GCGCTGGGGCAGGGGGGCGGGGG - Intergenic
1061299897 9:129698254-129698276 GGGCGGGGGGGGGGGGGGGCGGG + Intronic
1061299899 9:129698256-129698278 GCGGGGGGGGGGGGGGGCGGGGG + Intronic
1061317109 9:129803230-129803252 GCTCCGGGGCGCGGCGGCGCTGG + Exonic
1061317157 9:129803444-129803466 TGCGGGGGGCGCGGGGGCGCGGG + Intronic
1061347980 9:130042574-130042596 GCGTGGGGGCGTGGAGGCCCCGG - Intronic
1061348078 9:130042842-130042864 GGGCGGAGGCGAGGGCGCGCTGG - Intronic
1061365986 9:130172632-130172654 GCCCGGGGGGGCGGGGGCCGCGG + Exonic
1061368910 9:130187038-130187060 GAGAGGCGGGGCGGGGGCGCGGG + Intronic
1061559657 9:131394284-131394306 GGGCCGGGGCGTGGGGGCGGCGG + Intronic
1061967751 9:134025613-134025635 GCGCGCGGGGTCTGGGGCGCGGG + Intergenic
1061975832 9:134067726-134067748 GCCCGGGGTCGCGGCGGCGGTGG - Intronic
1062015113 9:134287539-134287561 GGGTGGGGGCGGGGGGGCGGGGG - Intergenic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062084641 9:134642305-134642327 GCCCCGGGGCGCGGGGCTGCGGG + Intronic
1062162469 9:135087829-135087851 GCGCGGGGCGGCGGCGGCGGCGG + Exonic
1062162482 9:135087859-135087881 GCGGCGGGCCGAGGGGGCGCGGG + Exonic
1062230616 9:135479837-135479859 GCGCGGGGAGGCGGGGAGGCGGG + Exonic
1062306007 9:135907436-135907458 GCGCGGGGGCGGGAGCGGGCCGG + Intergenic
1062491786 9:136808333-136808355 GCGGCGGGCCGGGGGGGCGCGGG + Intronic
1062544111 9:137054064-137054086 GGGCGGGGCCGCGGGACCGCGGG + Intergenic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062574663 9:137200591-137200613 GGGCGGGGGCGCGGGGCCCGGGG - Exonic
1062659094 9:137619068-137619090 GGGGGGCGGCGCGGGGGCGGCGG + Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203469239 Un_GL000220v1:108919-108941 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203470774 Un_GL000220v1:114455-114477 GGGCGGGGGCGCGGGGAGGAGGG - Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203477060 Un_GL000220v1:152891-152913 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203478595 Un_GL000220v1:158427-158449 GGGCGGGGGCGCGGGGAGGAGGG - Intergenic
1185736495 X:2500483-2500505 GCGCGGGGGGGCGGCTGCACGGG + Intronic
1185736581 X:2500739-2500761 GCTCGGGGGCGGGGGCGCGGGGG - Intronic
1185747463 X:2584180-2584202 CGGGGGGCGCGCGGGGGCGCGGG + Intergenic
1185747607 X:2584615-2584637 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1186426087 X:9465193-9465215 CGGCGGCGGGGCGGGGGCGCTGG - Exonic
1186426133 X:9465316-9465338 GCGCGGCTGCTCCGGGGCGCCGG + Exonic
1186768145 X:12791758-12791780 GCGCGGGCGCGGGGGCGCGGAGG - Intronic
1186821340 X:13291168-13291190 GGGGGGGCGCGGGGGGGCGCGGG - Intergenic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187768181 X:22666509-22666531 GCGGGGCGGGGCGGGGGCGGGGG - Intergenic
1188525902 X:31087686-31087708 GTGCGGGGTGGCGGGGGTGCAGG - Intergenic
1188881839 X:35499524-35499546 GCGGGGGGGGGGGGGGGGGCGGG - Intergenic
1189001252 X:36949615-36949637 GCGGGGGGGCGGGGGGGGGGCGG - Intergenic
1189160582 X:38804903-38804925 GCGCAGGGACGCAGGGGCACGGG - Exonic
1189252775 X:39614018-39614040 GCGGGGGGGAGCGGGGGGGCGGG - Intergenic
1189534519 X:41923183-41923205 GGGCGGCGGGGCCGGGGCGCGGG + Intronic
1189534521 X:41923191-41923213 GGGCCGGGGCGCGGGAGCGAGGG + Intronic
1190789585 X:53686458-53686480 GCGCGGAGGCGCGGAGGTGGCGG - Intronic
1191955522 X:66639109-66639131 GGGCGGGGGCTGAGGGGCGCGGG - Intronic
1192183253 X:68929441-68929463 GAGTGGGGGCGAGGGGGTGCTGG + Intergenic
1192491027 X:71577903-71577925 ACGCGGGAGCGCAGGGGGGCGGG - Intergenic
1192491033 X:71577911-71577933 GCGGGGGGACGCGGGAGCGCAGG - Intergenic
1192553693 X:72073259-72073281 GGGTGGGGGCGGGGGGGAGCGGG + Intergenic
1192630953 X:72777481-72777503 GCGGGGGGCGGCGGGGGCGCGGG - Intronic
1192650756 X:72943320-72943342 GCGGGGGGCGGCGGGGGCGCGGG + Intronic
1194977365 X:100408803-100408825 GCGGGGGCTCGCGGGGGCCCCGG + Exonic
1194977731 X:100410392-100410414 GCGGGGGGTAGCGGGGGGGCGGG + Intergenic
1195113026 X:101666153-101666175 GGGCGGTGGGGCGGGGGCGGGGG + Intergenic
1195113029 X:101666161-101666183 GGGCGGGGGCGGGGGGGAACAGG + Intergenic
1195379243 X:104255303-104255325 ACGAGGGGGCGAGGGGGCGAGGG + Intergenic
1195379247 X:104255311-104255333 GCGAGGGGGCGAGGGGGCGAGGG + Intergenic
1195645039 X:107221299-107221321 GGGCGGGGCCGGGGGGGCGGTGG - Intronic
1195702636 X:107716539-107716561 GGGCGGGGGGGAGGGGACGCAGG - Intronic
1195802565 X:108730322-108730344 GCGGGGGGGTGCGGGGGTGGGGG - Intronic
1198517559 X:137425030-137425052 GGGCGGGGGCCCGGGGGCGGGGG + Intergenic
1198767159 X:140091569-140091591 GCGGGCGGGCGCGCGGGCGGCGG - Intergenic
1199699085 X:150363380-150363402 GCGGGCGGGCGCGGGGGCACCGG + Intronic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic
1199772691 X:150984295-150984317 GCCCGGGGGCTCGGGGGCCCGGG - Intronic
1200058751 X:153474719-153474741 GGGGGCGGGGGCGGGGGCGCGGG + Intronic
1200074386 X:153543940-153543962 GTGTGGGGGCGTGGGGGCGTGGG + Intronic
1200098176 X:153673836-153673858 GGGCGGGGCCGGCGGGGCGCGGG - Intronic
1200100760 X:153688308-153688330 GCCCGGGGGCGCGCGGGCGGCGG - Exonic
1200231115 X:154444382-154444404 GCGCGGGGCCGCCGGGGACCTGG - Intronic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic
1201867837 Y:18673570-18673592 GCGCGGGGGTGGGGGGGGGCAGG - Intergenic