ID: 1077404566

View in Genome Browser
Species Human (GRCh38)
Location 11:2377398-2377420
Sequence GCGCGGGGGCGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1894
Summary {0: 6, 1: 6, 2: 31, 3: 276, 4: 1575}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077404566_1077404581 13 Left 1077404566 11:2377398-2377420 CCCGCGCCCCCGCGCCCCCGCGC 0: 6
1: 6
2: 31
3: 276
4: 1575
Right 1077404581 11:2377434-2377456 CCCCCGCCCCTCGGCCCGCCAGG 0: 1
1: 1
2: 4
3: 97
4: 638
1077404566_1077404588 25 Left 1077404566 11:2377398-2377420 CCCGCGCCCCCGCGCCCCCGCGC 0: 6
1: 6
2: 31
3: 276
4: 1575
Right 1077404588 11:2377446-2377468 GGCCCGCCAGGCCCCCTTGCCGG 0: 1
1: 0
2: 2
3: 30
4: 242
1077404566_1077404579 4 Left 1077404566 11:2377398-2377420 CCCGCGCCCCCGCGCCCCCGCGC 0: 6
1: 6
2: 31
3: 276
4: 1575
Right 1077404579 11:2377425-2377447 TTCTTCGCGCCCCCGCCCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077404566 Original CRISPR GCGCGGGGGCGCGGGGGCGC GGG (reversed) Exonic