ID: 1077405210

View in Genome Browser
Species Human (GRCh38)
Location 11:2379513-2379535
Sequence GCTGAAGGGGAGTCACGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077405197_1077405210 21 Left 1077405197 11:2379469-2379491 CCTGGGGGCAGGGGCTGAGGGAG 0: 1
1: 2
2: 15
3: 145
4: 1259
Right 1077405210 11:2379513-2379535 GCTGAAGGGGAGTCACGGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 200
1077405205_1077405210 -10 Left 1077405205 11:2379500-2379522 CCTAGGGGCAGAGGCTGAAGGGG 0: 1
1: 0
2: 8
3: 92
4: 1391
Right 1077405210 11:2379513-2379535 GCTGAAGGGGAGTCACGGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077405210 Original CRISPR GCTGAAGGGGAGTCACGGGA GGG Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
901574857 1:10192605-10192627 GCTGGAGGAGAGACACAGGAAGG - Intergenic
904352632 1:29918873-29918895 GATGAGGAGGAGTCAGGGGAAGG + Intergenic
904479853 1:30786904-30786926 GCTGCTGGGAAGTCAGGGGAGGG + Intergenic
904599051 1:31663926-31663948 GCTGTAGGGTGGTCAAGGGAAGG + Intronic
904775506 1:32903598-32903620 GATGCAGGAGAGTGACGGGAAGG + Intergenic
907789164 1:57645012-57645034 GCTGAAGGAGAATCCAGGGAGGG + Intronic
908123021 1:61003743-61003765 GGTGAAGGGAAGCCACGGAAGGG - Intronic
910069268 1:83191550-83191572 GCTGAAGTGGAGTTAAGGTAAGG + Intergenic
912795254 1:112689388-112689410 GGAGAAGGGGAGTCAAGGGGGGG - Intronic
913094258 1:115501705-115501727 GCTGAAGGCCAGTCACTAGAAGG + Intergenic
914347985 1:146816074-146816096 GCTGAAGGGGAGAGAGAGGAAGG - Intergenic
915587362 1:156851499-156851521 GCTGAATGGGGGCCCCGGGAAGG + Intronic
916716870 1:167454272-167454294 TCTGCAGAGGAGCCACGGGAGGG + Intronic
917649105 1:177058993-177059015 TCAGAAGGGGAGTCTAGGGAGGG - Intronic
919495290 1:198258123-198258145 TCTGAAGGGTAGTGACAGGAAGG + Intronic
919745344 1:201005251-201005273 GCTGCAGGGGTATCCCGGGAAGG - Intronic
920305680 1:205016710-205016732 GCTGAAGGGGGGTCATTGGGAGG - Exonic
922271947 1:224043275-224043297 GCTGGAGGGGAGGGAGGGGAGGG - Intergenic
922595547 1:226810147-226810169 TCTGCAAGGGAGTCACGGGAAGG + Intergenic
923363598 1:233236895-233236917 GCTGAAGGGCACTGACGGCAGGG + Exonic
923744269 1:236686327-236686349 GCTGCAGGGGAGACAGTGGAGGG + Intergenic
924310542 1:242738254-242738276 GCTGAAGGGGAGGCAGAGTAAGG + Intergenic
1062926294 10:1317891-1317913 GCTTTAGGGAAGTGACGGGATGG - Intronic
1064118093 10:12595987-12596009 GCTGCAGGGGAGTCTGGGAAAGG + Intronic
1064377523 10:14810390-14810412 GCTGATGTGGATTCACGGGAGGG + Intergenic
1066046227 10:31597874-31597896 TGTGAAGGGGAGTCAAGAGAGGG + Intergenic
1069592341 10:69649953-69649975 GCTGGAGGGGAGTCATTGGAGGG - Intergenic
1069835115 10:71303297-71303319 GCTGAAAGGGAGTGATGGGCAGG + Intergenic
1069858218 10:71453433-71453455 GCTGAATGGGAGGCCAGGGAGGG + Intronic
1075801689 10:125158882-125158904 GCGGAAAGCGAGCCACGGGAGGG + Intronic
1076079667 10:127567653-127567675 GCTGATGGTGATTCAGGGGATGG - Intergenic
1076128740 10:127996500-127996522 TCTGAAGGGGAGTCTCAGGTTGG - Intronic
1077374606 11:2199647-2199669 GCAGCAGGGCAGTCATGGGATGG - Intergenic
1077405210 11:2379513-2379535 GCTGAAGGGGAGTCACGGGAGGG + Intronic
1078318319 11:10309845-10309867 GGTGAAGGGGAGTGATGGGGAGG + Intronic
1078387768 11:10908076-10908098 GCTGATGGAGAGTCTGGGGACGG + Intergenic
1081599856 11:44485545-44485567 GCTTGAGTGGAGTGACGGGAAGG - Intergenic
1083840015 11:65299075-65299097 GCTGAAGTGGGGTCTAGGGACGG - Intronic
1085198082 11:74684094-74684116 TGTGACGGGGAGCCACGGGAGGG + Intergenic
1085313678 11:75530872-75530894 GGTGGAGGGGAGCCATGGGAGGG + Intergenic
1089470406 11:118715976-118715998 GTGGAAGCTGAGTCACGGGAGGG + Intergenic
1090327920 11:125904696-125904718 GCTGGAGGGGAGATGCGGGAAGG + Intronic
1090806101 11:130203270-130203292 GCTGAAAGGGTCTCATGGGACGG - Intronic
1090981394 11:131725618-131725640 GCTGGAGGGGAGTAAGAGGAAGG + Intronic
1091928592 12:4376138-4376160 GATAAAGGGGAGTCAGAGGATGG + Intronic
1092155359 12:6278684-6278706 GCGGCAGGGGAGTCCCGGGAGGG + Intergenic
1095965602 12:47864993-47865015 CCTGAAGTGGAGTCAGGGAAAGG - Intronic
1096878243 12:54647017-54647039 GCAGAAGGGGGGTCCGGGGAAGG - Intronic
1103021975 12:117541311-117541333 GCTGATGTGGAGGCATGGGAGGG + Intronic
1103259936 12:119577967-119577989 CCTCAAGGGGACTCAAGGGAAGG - Intergenic
1103980314 12:124732872-124732894 GCTGAGGGGGGGTGATGGGAGGG - Intergenic
1103988930 12:124785354-124785376 GCTGGAGGGGAGTGAGGGCAGGG - Intronic
1104746604 12:131214944-131214966 GCTGAAGCGGAGGCCTGGGAGGG - Intergenic
1104914265 12:132256667-132256689 GCTGGAGGGGGGACACTGGAAGG + Intronic
1104955946 12:132465902-132465924 GCTGAAGGGCAGTCCGGTGAGGG - Intergenic
1106012396 13:25837558-25837580 GCTGACGGGGAGAAGCGGGAAGG - Intronic
1106634250 13:31510133-31510155 GCTGGTGGGCAGTCAGGGGATGG + Intergenic
1108696453 13:52906570-52906592 GCTGAAGGTGAGGGAAGGGACGG + Intergenic
1109683653 13:65784664-65784686 GCAGCAGGGGAGGCACGGCAGGG - Intergenic
1113709899 13:112456310-112456332 GCTGCAGGCGAGTCACTGCATGG + Intergenic
1114635318 14:24183898-24183920 GCTGGAGCGGAGGCACGGCAAGG + Exonic
1116046030 14:39743495-39743517 GCTGAAGGGGAGTCTGATGAAGG + Intergenic
1121170107 14:91846625-91846647 TCTGAATGGGAGTAAAGGGATGG - Intronic
1124062868 15:26310903-26310925 GCAGGTGGGGAGTCATGGGAGGG + Intergenic
1126935250 15:53699885-53699907 GGTGAAGGAGAGCCACGGAATGG + Exonic
1129372518 15:75106381-75106403 GCTGTAGGGGAGACCCCGGAAGG + Intronic
1129466460 15:75727037-75727059 CCTGAAAGGGAGTGGCGGGAAGG - Exonic
1130634441 15:85603930-85603952 GCTGAAGCAGAGTCACTGGCAGG - Intronic
1132653164 16:1030695-1030717 GCCGGAGGGGAGCCACGGGGGGG - Intergenic
1135089311 16:19500287-19500309 ACTGAAGTGGAGACAAGGGATGG - Intergenic
1136398879 16:30007138-30007160 GCTGCAGGGGCGCCAGGGGAGGG - Intronic
1138443224 16:57047382-57047404 GCTGCAGGGGAGACTCGAGAGGG + Intronic
1139986050 16:70899458-70899480 GCTGAAGGGGAGAGAGAGGAAGG + Intronic
1140414561 16:74764975-74764997 CCTGAAGGAGACTCATGGGACGG + Intronic
1141665401 16:85462985-85463007 GCAGTAGGGGCGTCACGGGGCGG - Intergenic
1142076798 16:88123136-88123158 GGTGATGGGTAGTCTCGGGATGG - Intergenic
1145296784 17:21598939-21598961 TCTGCAGGTGAGTCAGGGGAGGG + Intergenic
1146339449 17:32007113-32007135 GCGGAAGGGGAGTCGCGGGAAGG + Intergenic
1146966296 17:37033893-37033915 GCTGAAGGGAATTCTGGGGAAGG - Intronic
1148062893 17:44848711-44848733 GGGGGAGGGGTGTCACGGGAGGG + Intronic
1148155877 17:45425144-45425166 GCTGCAGGTGAGTCACCGGGAGG + Intronic
1148205326 17:45776107-45776129 GGTGAAGGGGAGCCCAGGGAGGG - Intergenic
1148998030 17:51729076-51729098 GTGGAACGGGAGTCACTGGAGGG - Intronic
1150791746 17:68205197-68205219 GCGGAAGGGGAGACGCGGGGAGG + Intergenic
1152323849 17:79624339-79624361 GCTGCAGGGGAGGCTGGGGAAGG + Intergenic
1155048951 18:22129975-22129997 GGGGAAGGGGAGGCAAGGGAAGG - Intergenic
1156516241 18:37682991-37683013 GTGGAAGGGGAGCCACTGGAAGG + Intergenic
1156641861 18:39111109-39111131 GCTGAAGGGAAGGGATGGGATGG + Intergenic
1157100201 18:44722333-44722355 GCAGCAGGGGACTCATGGGAAGG - Intronic
1160696071 19:485076-485098 GGTGAAGGGGAGTGAGAGGAGGG + Intergenic
1161869837 19:6861748-6861770 ACTCTGGGGGAGTCACGGGAGGG - Intergenic
1163122095 19:15224077-15224099 TCTCAAGGGGAGCCAGGGGAGGG - Intergenic
1163325757 19:16602030-16602052 CCTGCAGGGGTGTCAGGGGATGG + Intronic
1164670110 19:30067592-30067614 CCTGGAGGGCAGTCAGGGGAAGG + Intergenic
1165429150 19:35762323-35762345 CCTGAAGGGGAGCCACAGCATGG - Exonic
1167636470 19:50658801-50658823 GCTGGAGGGGAGTTTAGGGACGG + Intronic
925040826 2:732022-732044 GCACAGGGGGAGTCACGGCACGG + Intergenic
925040859 2:732110-732132 GCACAGGGGGAGTCACGGCACGG + Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
926126711 2:10276746-10276768 GCAGAAGGGGAGGCACAGGGTGG - Intergenic
926858589 2:17283814-17283836 GCTAATGGGGAGTCACTGAATGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
936757565 2:115733342-115733364 GCAGCATGGGAGTCACAGGAAGG + Intronic
937287491 2:120762498-120762520 GCAGGAGGAGAGTCACAGGAAGG + Intronic
937688508 2:124725426-124725448 GGGGAAGGGGAGTAAAGGGAGGG - Intronic
937728672 2:125198799-125198821 GCTTAAAGATAGTCACGGGATGG + Intergenic
946114202 2:217447288-217447310 GCTCAAGAGGAGTCAGGAGAAGG + Intronic
946142960 2:217706967-217706989 GCTGGAGGGGAGAAACAGGATGG - Intronic
946268469 2:218568892-218568914 GCTGAAGGGGGGACGCGGGTCGG + Exonic
946482482 2:220070410-220070432 GCTGAAGGGGAGCAAGGGGTTGG - Intergenic
947126078 2:226869846-226869868 TCTGAAGGGGTGTCCCAGGAGGG + Intronic
947267326 2:228298130-228298152 GCTGGAGTGGAGTCGGGGGAAGG - Intergenic
947841601 2:233211286-233211308 GATGAAGGGGAGGCAAGGCAGGG - Intronic
948003643 2:234589793-234589815 GCTAAAGAGGAGACATGGGACGG + Intergenic
948637674 2:239349727-239349749 GCGGAAGGGCAGACACGGCAGGG + Intronic
1170873767 20:20232144-20232166 GCTGAAGGAGAGTCCCAGCAGGG + Intronic
1172196129 20:33092772-33092794 GCTGGAGGTGAGTCAAGGGGTGG - Intronic
1172331460 20:34078704-34078726 CATGAAGGGGTGTGACGGGATGG - Intronic
1173580301 20:44142427-44142449 GCTGAAGTGGAGTGAGGGGGAGG - Intronic
1173994442 20:47326992-47327014 GGGGATGGGGAGTTACGGGAGGG + Intronic
1174080577 20:47968499-47968521 GGTTAAGCGGAGTGACGGGAAGG - Intergenic
1175374145 20:58513461-58513483 TCTGAAGGAGGGTCAGGGGAGGG - Intronic
1175499994 20:59442978-59443000 GCTGAGGGGGAGTCGGGGGAGGG - Intergenic
1175914552 20:62419596-62419618 GCTGAAGGAGATCCACGAGAAGG - Exonic
1175957923 20:62621083-62621105 GTGGAGGGGGAGGCACGGGAGGG - Intergenic
1175957943 20:62621127-62621149 GTGGAGGGGGAGGCACGGGAGGG - Intergenic
1175957964 20:62621170-62621192 GTGGAGGGGGAGGCACGGGAGGG - Intergenic
1175957975 20:62621193-62621215 GTGGAGGGGGAGGCACGGGAGGG - Intergenic
1175957986 20:62621216-62621238 GTGGAGGGGGAGGCACGGGAGGG - Intergenic
1175987209 20:62770087-62770109 GCTCCAGGGGAGTCACTGGAGGG + Intergenic
1176942503 21:14940911-14940933 GATGAAGCTGAGGCACGGGATGG - Intergenic
1180050175 21:45327479-45327501 GCTGAGGTGGAGTTGCGGGAAGG + Intergenic
1181147453 22:20858880-20858902 GCTGCAGGGGAGAGAGGGGATGG + Intronic
1183500753 22:38177371-38177393 GCTGATGGGGTGTGAGGGGATGG - Intronic
1184411589 22:44329227-44329249 GAAGAAGGGGAGTGAAGGGATGG + Intergenic
1184535242 22:45082260-45082282 GTTAGAGGGAAGTCACGGGAGGG + Intergenic
950530274 3:13549052-13549074 GCGGAGGCGGAGTCAGGGGAGGG + Intergenic
954380061 3:50214567-50214589 GCTGAGGGACAGTCAGGGGAAGG + Intronic
955429531 3:58828158-58828180 GGTGATGGGGAGTCACTGAAAGG + Intronic
964745992 3:160012880-160012902 GCAGAAGTGGAGTCATGGGAGGG - Intergenic
967856318 3:194120145-194120167 GGGGAAGGGGAGTGCCGGGAGGG - Intergenic
968555531 4:1244765-1244787 GCTGCCGGGGACTCACGGCAGGG - Intronic
969586458 4:8096989-8097011 GCAGAGGGCGGGTCACGGGAGGG + Intronic
971303040 4:25457410-25457432 GATGAAGTGGAGGCAGGGGAGGG - Intergenic
978682778 4:111402438-111402460 GCAGAAGGGGAGTCAGAGGCAGG + Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
984842385 4:184080511-184080533 GATGAAGGGGAGTTGCGGGATGG + Intergenic
985478545 5:92716-92738 CCTGAAGGGGAGCCAGGGGAGGG + Intergenic
985784285 5:1886062-1886084 GCCGCAGGGGAGGCAGGGGATGG + Intronic
986016739 5:3764030-3764052 GCTGTAGAGGAGTCAGGAGAAGG + Intergenic
986059116 5:4171325-4171347 GCTGAAGGGAAGACAGAGGATGG + Intergenic
987073358 5:14358389-14358411 GGGGAAGGGGAGTCACAGGCAGG - Intronic
992504091 5:77368365-77368387 GCTCCACAGGAGTCACGGGAAGG - Intronic
998372425 5:141670490-141670512 GGTGAGGGGGAGCCAAGGGATGG - Exonic
998394401 5:141809253-141809275 GATGAAGGAGAGTCAGGTGATGG + Intergenic
1000922384 5:167153516-167153538 GTGGAAGGGGAGACACGAGAGGG + Intergenic
1002307356 5:178291638-178291660 GGTGAAGGGGAGTCAGCGAAGGG + Intronic
1002878792 6:1234351-1234373 GCTGCAGGGGAGTGCCGGGAAGG - Intergenic
1003853087 6:10244660-10244682 GATGAAGCTGAGTCACGGGCTGG - Intergenic
1003887331 6:10533352-10533374 GCTGAAGTGGTCTCATGGGAAGG + Intronic
1004078113 6:12364028-12364050 GCTGAGGGGGAGGCAGGGCAGGG - Intergenic
1006107184 6:31723790-31723812 GCTGGAGGGGAGGCACGGTGGGG - Exonic
1007425445 6:41743389-41743411 GCTGCAGGGGAGTCAGGGCATGG + Exonic
1008946348 6:57101248-57101270 TCTGAAGCGGAGTCATGTGAAGG + Intronic
1009055793 6:58333370-58333392 GCCAAAGGGTAGTCAGGGGAGGG + Intergenic
1009235382 6:61117228-61117250 GCCAAAGGGTAGTCAGGGGAGGG - Intergenic
1015820840 6:137258770-137258792 GCTGAAGGGAACTCATGAGATGG - Intergenic
1017686644 6:156920170-156920192 GCTGAAGGGGAGGGAGGTGAAGG - Intronic
1020016927 7:4836561-4836583 GCTGCAGCGGAGTCGCGCGAAGG - Exonic
1022412830 7:30152564-30152586 GCCTAAGGGGAGTCCCTGGAAGG + Intronic
1024817621 7:53289196-53289218 AGTGAAGGGGAGTCATTGGAAGG - Intergenic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1027287047 7:76656731-76656753 GCTGAAGTGGAGTTAAGGTAAGG + Intergenic
1027699980 7:81457640-81457662 GCTGTGTGGGAGTCAGGGGAAGG - Intergenic
1029895227 7:103976611-103976633 GCTTTAGGAGAGTCAGGGGAGGG + Intronic
1031982889 7:128140610-128140632 GCTGCAAGGGAGTCTGGGGAAGG - Intergenic
1032075469 7:128833848-128833870 GCTGCAGTGGAGCCAGGGGAAGG + Intronic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1033315674 7:140295284-140295306 GCTGAAGGAGGATCAGGGGAAGG + Intronic
1039386192 8:37137831-37137853 GCTCAGGGGGAGTCTCTGGATGG + Intergenic
1039546409 8:38414180-38414202 GCTGAAGGAGGGTCACCGCATGG - Exonic
1042508075 8:69582546-69582568 GCAGAAGGGGAGTTGGGGGAGGG + Intronic
1044412736 8:91902139-91902161 GCTGCCGGGAAGGCACGGGAAGG - Intergenic
1045569503 8:103354410-103354432 CCTGAAGGGCAGTCACAGAAGGG - Intergenic
1047743263 8:127824332-127824354 GCTGAAGGGGCCCCAAGGGAGGG - Intergenic
1050089612 9:2004262-2004284 GGGGAAGGGGAGACATGGGAGGG + Intergenic
1052772838 9:32705269-32705291 GCTGCAGGTGAGTCACTGGCTGG - Intergenic
1057946994 9:99338503-99338525 GTGGATGGGGAGTCACTGGATGG + Intergenic
1060003730 9:119981372-119981394 GCTGATGGGGAGACAGGGCAGGG - Intergenic
1060007541 9:120013923-120013945 GGTAATAGGGAGTCACGGGAAGG + Intergenic
1060796398 9:126515213-126515235 CCTGAAGGGCAGCCAGGGGAGGG - Intergenic
1061119456 9:128634301-128634323 GCTGCAGCGAAGTCAAGGGAGGG + Exonic
1061301822 9:129709881-129709903 AGTGAAGGGGAGGCATGGGAAGG - Intronic
1061506863 9:131036484-131036506 GCAGAAGGGGAGCCTGGGGAGGG + Intronic
1061512247 9:131068363-131068385 GCCGAAGGGGAGCAAAGGGATGG + Intronic
1061801443 9:133115312-133115334 GCTGAAGCGGAGTGAGGAGAGGG + Intronic
1061921789 9:133786698-133786720 GCCGAAGGGGAGGCAGGGAAGGG - Intronic
1062645667 9:137546909-137546931 CCTGCAGGGGAGTAAAGGGATGG + Exonic
1062694643 9:137867169-137867191 GCAGAAGAGAAGTCCCGGGATGG - Intronic
1203776357 EBV:75373-75395 GCTCGAGGGGAGACAGGGGAGGG - Intergenic
1187363650 X:18649805-18649827 GCTGGAGGGGTGTCGCGGGTGGG - Intronic
1192180302 X:68912084-68912106 GCTGAAGGGGCTACACAGGAAGG - Intergenic
1192213709 X:69143447-69143469 GATGAAAGGGAGACACAGGAAGG + Intergenic
1195880424 X:109586903-109586925 GCAGCAGGGGAGGCACGGGTGGG - Intergenic
1198613268 X:138425492-138425514 GCTGAAGGGGATGGATGGGAAGG - Intergenic
1199504132 X:148542657-148542679 GCTGAAGGGCTGTCAGGGGAAGG + Intronic
1199978056 X:152905847-152905869 TCTGGAGGGGAGTCCCTGGAGGG - Intergenic
1199978068 X:152905877-152905899 CCTGGAGGGGAGTCCCTGGAGGG - Intergenic
1200093425 X:153646525-153646547 GCCGAAGGGGGGTTAAGGGAAGG + Intronic
1200181246 X:154151855-154151877 GTAGAAGGGGAGCCAAGGGAAGG + Intronic
1200186891 X:154188969-154188991 GTAGAAGGGGAGCCAAGGGAAGG + Intergenic
1200192542 X:154226107-154226129 GTAGAAGGGGAGCCAAGGGAAGG + Intronic
1200198297 X:154263911-154263933 GTAGAAGGGGAGCCAAGGGAAGG + Intronic