ID: 1077410094

View in Genome Browser
Species Human (GRCh38)
Location 11:2399925-2399947
Sequence CATCCTGCCCGGGAGGACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077410081_1077410094 26 Left 1077410081 11:2399876-2399898 CCGCCCAGCCACGGCTGACTTGG No data
Right 1077410094 11:2399925-2399947 CATCCTGCCCGGGAGGACCGGGG No data
1077410085_1077410094 18 Left 1077410085 11:2399884-2399906 CCACGGCTGACTTGGAAGCTTGA No data
Right 1077410094 11:2399925-2399947 CATCCTGCCCGGGAGGACCGGGG No data
1077410083_1077410094 23 Left 1077410083 11:2399879-2399901 CCCAGCCACGGCTGACTTGGAAG No data
Right 1077410094 11:2399925-2399947 CATCCTGCCCGGGAGGACCGGGG No data
1077410080_1077410094 27 Left 1077410080 11:2399875-2399897 CCCGCCCAGCCACGGCTGACTTG No data
Right 1077410094 11:2399925-2399947 CATCCTGCCCGGGAGGACCGGGG No data
1077410084_1077410094 22 Left 1077410084 11:2399880-2399902 CCAGCCACGGCTGACTTGGAAGC No data
Right 1077410094 11:2399925-2399947 CATCCTGCCCGGGAGGACCGGGG No data
1077410079_1077410094 30 Left 1077410079 11:2399872-2399894 CCGCCCGCCCAGCCACGGCTGAC No data
Right 1077410094 11:2399925-2399947 CATCCTGCCCGGGAGGACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077410094 Original CRISPR CATCCTGCCCGGGAGGACCG GGG Intergenic
No off target data available for this crispr