ID: 1077410869

View in Genome Browser
Species Human (GRCh38)
Location 11:2403345-2403367
Sequence TTCCCAAGGCCGCCCCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 341}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077410869_1077410884 29 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410884 11:2403397-2403419 TGGAGCTGGCCCATCTGGCCGGG 0: 1
1: 0
2: 2
3: 23
4: 231
1077410869_1077410878 9 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410878 11:2403377-2403399 AGACAGGGGCGAGGGCCCTGTGG 0: 1
1: 1
2: 5
3: 39
4: 365
1077410869_1077410872 -6 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410872 11:2403362-2403384 TGGGAATCCTGCCACAGACAGGG 0: 1
1: 0
2: 2
3: 13
4: 209
1077410869_1077410876 1 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410876 11:2403369-2403391 CCTGCCACAGACAGGGGCGAGGG 0: 1
1: 0
2: 3
3: 11
4: 205
1077410869_1077410874 0 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410874 11:2403368-2403390 TCCTGCCACAGACAGGGGCGAGG 0: 1
1: 0
2: 4
3: 17
4: 233
1077410869_1077410871 -7 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410871 11:2403361-2403383 TTGGGAATCCTGCCACAGACAGG 0: 1
1: 0
2: 0
3: 16
4: 139
1077410869_1077410879 15 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410879 11:2403383-2403405 GGGCGAGGGCCCTGTGGAGCTGG 0: 1
1: 0
2: 4
3: 42
4: 576
1077410869_1077410881 24 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410881 11:2403392-2403414 CCCTGTGGAGCTGGCCCATCTGG 0: 1
1: 0
2: 0
3: 17
4: 162
1077410869_1077410873 -5 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410873 11:2403363-2403385 GGGAATCCTGCCACAGACAGGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1077410869_1077410883 28 Left 1077410869 11:2403345-2403367 CCAGGCAGGGGCGGCCTTGGGAA 0: 1
1: 0
2: 3
3: 21
4: 341
Right 1077410883 11:2403396-2403418 GTGGAGCTGGCCCATCTGGCCGG 0: 1
1: 0
2: 2
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077410869 Original CRISPR TTCCCAAGGCCGCCCCTGCC TGG (reversed) Exonic
900241494 1:1619606-1619628 TCCTCAAGGCCTCCCCTGCAGGG - Intronic
900313920 1:2047871-2047893 TAACCAAGGACGCCCCTGCTGGG - Intergenic
900388278 1:2420421-2420443 TCCGCAACCCCGCCCCTGCCTGG - Intergenic
900436546 1:2633811-2633833 TCCTCACGGCCGCCCCGGCCAGG + Intergenic
900546891 1:3234399-3234421 CTCCCCAGGCTGCCCCGGCCAGG + Intronic
900626965 1:3612738-3612760 TTCCCAAGCCCCTCCCAGCCAGG - Intergenic
900628287 1:3619665-3619687 TTCCTGAGGCCTCCCCAGCCGGG + Intergenic
900643301 1:3697481-3697503 TTCCCGAGCCCGTCCTTGCCTGG + Intronic
901207670 1:7506094-7506116 TTCCCCAGGCAGCCTCTGGCCGG - Intronic
901322756 1:8349514-8349536 TTCCCAGGGACGCCTCTGCTGGG - Intergenic
902350059 1:15847785-15847807 CTCCCCCGCCCGCCCCTGCCCGG + Intergenic
902797304 1:18807977-18807999 TTCCCTAGGCTGCCCCTGGAAGG + Intergenic
903392196 1:22972515-22972537 TTCCCATGGCTCCCCCTCCCAGG + Intergenic
903672833 1:25046646-25046668 TTCCCAGGCCCACCCCTCCCAGG + Intergenic
904042969 1:27594641-27594663 TTCCCAGAGCCTCCTCTGCCTGG - Intronic
904058353 1:27686873-27686895 TGCCCAAGGGTGCCTCTGCCGGG - Intergenic
904772189 1:32886593-32886615 TTCCCAACACCGCCGCTCCCGGG + Intronic
905276201 1:36819702-36819724 CTCCCAGGGCCTCCCCTTCCAGG - Intronic
911968454 1:104398222-104398244 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
912073304 1:105840447-105840469 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
915282143 1:154829841-154829863 TTCCCGAGGCTGGCCATGCCTGG + Intronic
915834799 1:159168190-159168212 TTCCCCATGCTGCTCCTGCCCGG - Intergenic
918067666 1:181112525-181112547 TTCACAAGGCCTCACCAGCCAGG - Intergenic
919124523 1:193379031-193379053 TTCCCAAGGCCTCCCCAGCCAGG + Intergenic
919351824 1:196466890-196466912 TACCCAAGGCTGACCCTGCTTGG - Intronic
920255555 1:204651941-204651963 TTCCCCAGCCGGCCCCTGCCAGG + Intronic
920349485 1:205328520-205328542 TTCCCATGCCCTGCCCTGCCTGG - Intergenic
920784167 1:209024598-209024620 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
921797057 1:219358521-219358543 TTCCTGAGGCCTCCCCAGCCTGG - Intergenic
921880378 1:220248942-220248964 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
922051910 1:221998849-221998871 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
922753815 1:228083139-228083161 TTCCCGAGGCCGCCCGCGCGTGG + Exonic
923865418 1:237934181-237934203 TTCCTGAGGCCTCCCCAGCCCGG - Intergenic
924772269 1:247088449-247088471 CTCCCAACTCAGCCCCTGCCAGG - Intergenic
1062858391 10:790996-791018 TCCCCAAGGCGGCTCCTTCCAGG + Intergenic
1063551185 10:7035186-7035208 TTCCTGAGGCCGCCCCAGCACGG - Intergenic
1063813678 10:9745190-9745212 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1064464013 10:15561873-15561895 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1064547528 10:16465787-16465809 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1064981660 10:21173040-21173062 TTCCCCAGAACGCCCCTGGCTGG + Intronic
1066059202 10:31707347-31707369 CTCCCCAGGCTGCCCCTCCCGGG + Intergenic
1066357423 10:34698399-34698421 TGCCCAAGGCCTCCAATGCCTGG + Intronic
1066388078 10:34957570-34957592 TTCCCAAGGCAGGCCCAGCCAGG + Intergenic
1069891976 10:71657692-71657714 TTCCCCAGCACCCCCCTGCCAGG + Intronic
1071498105 10:86182407-86182429 TGGCCAAGGCCGCCCCAGCACGG + Intronic
1074401092 10:113141574-113141596 TTCCCAAGACAGCCCCTTCAGGG - Intronic
1074449820 10:113549973-113549995 CTCCCAAGGCCTCCCATGCAGGG + Intergenic
1074786806 10:116849082-116849104 TTGCTAAGGCCGCCCGTGCCAGG - Intergenic
1075093310 10:119455253-119455275 TTTCCGAGGCGGCCCCGGCCGGG + Exonic
1075629407 10:123991960-123991982 TTCCCGAGGCCGCCGTCGCCGGG - Intergenic
1076101017 10:127778180-127778202 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1076649304 10:131976736-131976758 TTCCCAGGGCAGCCCCTCCTAGG - Intronic
1076939189 10:133590458-133590480 TCCCGGTGGCCGCCCCTGCCTGG + Intergenic
1077155539 11:1089345-1089367 TCCCCAAGGTTGGCCCTGCCGGG + Intergenic
1077185405 11:1233499-1233521 TCCACATGGCAGCCCCTGCCAGG + Intronic
1077297069 11:1831382-1831404 TGCCCAGGGCAGCCCCCGCCCGG + Intronic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1077496534 11:2889486-2889508 TGCCCGAGGCCTCCCCTTCCCGG + Intronic
1077514797 11:2995036-2995058 TTCCCAGCGCTGCCTCTGCCAGG + Intergenic
1078887871 11:15523500-15523522 TTCCCAATGCTGGCCATGCCAGG + Intergenic
1079870573 11:25793825-25793847 TTCCCTAGTCCGGCTCTGCCCGG - Intergenic
1081158792 11:39728399-39728421 TTCCTGAGGCCTCCCCAGCCTGG - Intergenic
1081761050 11:45576639-45576661 TGCCCATGGCCGCCCCGGTCAGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084019344 11:66408713-66408735 CTCCCAAGGCCCCCCTTACCCGG - Intergenic
1084121565 11:67071900-67071922 CTCCCAGGGCTGCACCTGCCAGG + Exonic
1085811231 11:79683122-79683144 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1087795688 11:102452893-102452915 TTCCCAAGCGCGCGCCTGCGAGG - Exonic
1087877624 11:103376182-103376204 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1091808886 12:3378542-3378564 TTCACAAGGCTGCTCCTGCAAGG - Intergenic
1094484427 12:30913252-30913274 TTCACAAGGCTGCTCCTGCAAGG - Intergenic
1096220739 12:49827204-49827226 CTCCCCAGGCCACCCCTGCCCGG + Intronic
1096221149 12:49828641-49828663 TTACCAAGCCCGGCCCGGCCTGG - Intronic
1098029043 12:66235386-66235408 TTCCCAAAGCTGCCTCGGCCCGG - Intronic
1098179253 12:67828607-67828629 TTCCCTAGGCCTACCCAGCCTGG + Intergenic
1098470179 12:70833875-70833897 TTCAAAAGGCAGCCCCAGCCAGG + Intronic
1101966663 12:109286820-109286842 AGCCCAATGCCGCCTCTGCCAGG + Intronic
1102671530 12:114623392-114623414 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1102806303 12:115783723-115783745 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1102822389 12:115918796-115918818 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1103418844 12:120763557-120763579 TTACCTAAGCAGCCCCTGCCTGG - Exonic
1104240935 12:126988647-126988669 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1104376230 12:128267250-128267272 GTCCGAGGCCCGCCCCTGCCGGG - Intergenic
1104711801 12:130992617-130992639 TTCCCAATGCCCAACCTGCCTGG + Intronic
1104870440 12:131991359-131991381 TTCCCAAGGCCCCCCATGCTTGG - Intronic
1105704844 13:22962412-22962434 TTCCCCAGGCCTCCCCAACCCGG + Intergenic
1105857804 13:24387570-24387592 TTCCCCAGGCCTCCCCCACCTGG + Intergenic
1106046636 13:26148054-26148076 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1106377644 13:29204516-29204538 TTCCCAAGGCTCCTCCTGGCTGG - Intronic
1106458939 13:29951499-29951521 TTCCCGAGGCCTCCCTAGCCAGG - Intergenic
1109446687 13:62448398-62448420 CTCTCAAGGCCTCCTCTGCCTGG - Intergenic
1110044655 13:70812903-70812925 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1110440226 13:75518820-75518842 TTCCCAAGCCCCCCCATCCCCGG + Intergenic
1113113307 13:106847507-106847529 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1114319639 14:21536735-21536757 TGACCAAGTCCGCCCCCGCCTGG + Intronic
1114462623 14:22897111-22897133 TTCCAAAGGCTGCCCCTTCTAGG - Intergenic
1114473887 14:22981295-22981317 TTCCGGAGGCCGCCCGGGCCCGG - Exonic
1115054533 14:29106582-29106604 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1115846386 14:37540064-37540086 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1117508628 14:56426988-56427010 TTCCCATGGCCACCTCTTCCAGG + Intergenic
1117699233 14:58396438-58396460 TTCCCTCAGCCGCCCGTGCCCGG + Intronic
1121061308 14:90912715-90912737 TTCCCTAGGCCACACCAGCCAGG + Intronic
1121154384 14:91668986-91669008 TTTCCAAGGCCTTCCCAGCCAGG + Intronic
1122037611 14:98960243-98960265 TTGCCAAGGACTCCCCTGACGGG - Intergenic
1122114488 14:99520865-99520887 TTCCCAAGGCTGCCTCCTCCAGG + Intronic
1122691502 14:103533971-103533993 TTCCCCAGGTCCTCCCTGCCAGG + Intronic
1122791991 14:104187883-104187905 ACCCCCAGGCCGCCCCCGCCAGG - Intergenic
1122880255 14:104687682-104687704 CCCCCAGGGCCGCTCCTGCCTGG - Intergenic
1122967593 14:105138574-105138596 TGCCCAGGGCCGCCTCAGCCAGG + Intergenic
1124372202 15:29110311-29110333 TCCCCTGGGCTGCCCCTGCCTGG + Intronic
1125754892 15:42056956-42056978 CCCCCAAGGCCGGCCCTGCCAGG - Intergenic
1128133965 15:65249303-65249325 TTCCCCAGGCAGCCCCTGGGCGG + Intronic
1129173156 15:73820297-73820319 CTCCCAAGCCCATCCCTGCCTGG - Intergenic
1129657027 15:77531207-77531229 TTCCTAACAGCGCCCCTGCCCGG + Intergenic
1129862125 15:78871223-78871245 TTTCTAAGCCCTCCCCTGCCCGG - Intronic
1131425714 15:92344036-92344058 TTGGCACGGCTGCCCCTGCCTGG + Intergenic
1132555037 16:568627-568649 CTTCCCAGGCTGCCCCTGCCAGG + Exonic
1134211250 16:12279455-12279477 GTCCCCAGGCCTCCCCAGCCTGG - Intronic
1136067897 16:27771028-27771050 TTCCCAAGGCTGCCTCCTCCTGG + Intronic
1136983955 16:35082993-35083015 GTCCCCAGGCCACCCCTGCATGG + Intergenic
1137476128 16:48811276-48811298 CTCCCAAGGCAGCCTCAGCCGGG + Intergenic
1137788551 16:51155460-51155482 TTCCCAGTCCCTCCCCTGCCCGG + Intergenic
1138556659 16:57774988-57775010 TCTCCACTGCCGCCCCTGCCAGG + Intronic
1140277386 16:73522804-73522826 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1140852032 16:78943921-78943943 TACCCAAGGCCTCCATTGCCTGG + Intronic
1142131189 16:88432288-88432310 CTCCCAACGGCGCACCTGCCAGG + Exonic
1142140133 16:88469098-88469120 GCCCCAGGGCCGTCCCTGCCGGG - Intronic
1142143086 16:88481242-88481264 TGGCCAAGGCTGCACCTGCCTGG - Intronic
1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG + Intronic
1142535613 17:615856-615878 TTGCCCAGGCAGCCCCTTCCCGG + Intronic
1142622204 17:1172250-1172272 TGCCCAATCCCACCCCTGCCTGG - Intronic
1142653849 17:1376658-1376680 TTCCCAAGACTGTCCTTGCCAGG + Intronic
1143239099 17:5428844-5428866 ATCCCAAGGCTCCCCCTGCCTGG - Intronic
1143582750 17:7836100-7836122 TTCCCAAGGCTTCTCCCGCCCGG + Intergenic
1143731871 17:8886127-8886149 TTCCCATGGCCCCACCTCCCAGG + Intronic
1143766040 17:9138385-9138407 CTTCCAAGCCCGCTCCTGCCAGG - Intronic
1145261955 17:21359839-21359861 TCCCCAAGGTCTCCCCTTCCTGG - Intergenic
1147594315 17:41706743-41706765 TTCCCAAAGCCAGCCCTGGCAGG + Intergenic
1149498916 17:57136542-57136564 TTCCTCAGGCCGCCCTGGCCGGG - Intergenic
1150984304 17:70177945-70177967 TTCCAGAAGCCTCCCCTGCCTGG + Exonic
1151146381 17:72045460-72045482 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1151200676 17:72465657-72465679 TTCCCAAGGGAGCCAGTGCCTGG - Intergenic
1151318459 17:73338217-73338239 TTCCCTCGGCCACGCCTGCCTGG + Exonic
1151541751 17:74768164-74768186 TCTCCAAGGCTGCCTCTGCCAGG - Exonic
1151714645 17:75825200-75825222 TTCCCCCCGCCGCCCCTCCCCGG + Exonic
1151803907 17:76393640-76393662 TTCCCCAGGCCTCACCAGCCTGG - Intronic
1151880149 17:76889857-76889879 TTCCCAGTGCAGTCCCTGCCGGG + Intronic
1151958472 17:77392611-77392633 TTCCCAAGGCCAGGCCTGGCTGG - Intronic
1152381608 17:79945169-79945191 TTCCCTGGGCCACCCCAGCCTGG + Intronic
1152582102 17:81170750-81170772 GCCCCAAGGATGCCCCTGCCTGG + Intergenic
1153987196 18:10362933-10362955 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1156169221 18:34462433-34462455 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1156836501 18:41561544-41561566 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1159339803 18:67119853-67119875 TTTCCAATGCAGCCGCTGCCAGG + Intergenic
1160131114 18:76225729-76225751 CTCCCAGTGCTGCCCCTGCCAGG + Intergenic
1160442478 18:78903021-78903043 TTCCCAAGGCCACTCCGGCCAGG + Intergenic
1160910749 19:1472755-1472777 CTCCCACCGCGGCCCCTGCCTGG + Exonic
1163689349 19:18730313-18730335 TTCACCAGGCGCCCCCTGCCTGG - Intronic
1163883300 19:19945694-19945716 CTCCCAAGGAGGCTCCTGCCAGG - Intergenic
1165746033 19:38229810-38229832 CGCCCGAGGGCGCCCCTGCCCGG + Intergenic
1165830331 19:38727504-38727526 ATCCCCAGCCCACCCCTGCCGGG + Intronic
1167002798 19:46755929-46755951 TTGCCACGGCCAACCCTGCCAGG + Exonic
1167009893 19:46800435-46800457 GTCCCAAGCACGGCCCTGCCTGG + Intergenic
1168133367 19:54335396-54335418 TTCCCGAGGCCTCCCCAGCCAGG + Intronic
925001329 2:405154-405176 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
925034080 2:672755-672777 TTCCCAGGGACACCCCTGCAGGG + Intronic
925277512 2:2660977-2660999 TTCCTAAGGCCGACCCTGCTTGG - Intergenic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
925774382 2:7320021-7320043 TTCACAAGGCAACCCCTGGCTGG + Intergenic
925987298 2:9226683-9226705 TTCCCAAGTCCTCCCCTCCAGGG - Intronic
926724421 2:15986460-15986482 TTCCCAGGGCTGGCCCTGACAGG - Intergenic
926793677 2:16600983-16601005 ATCCCTAGGAGGCCCCTGCCTGG + Intronic
927633269 2:24792964-24792986 TTCCCAAGGGCGCACCTCCAGGG + Intronic
927955341 2:27203912-27203934 TTCCCAGGGCCGGCTCTGCAGGG + Intronic
928167244 2:28980269-28980291 CTCCCAAGGCCTGCCCTCCCTGG + Intronic
929442781 2:41978520-41978542 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
933933717 2:87181966-87181988 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
934615502 2:95768240-95768262 TCTCCAAGGCAGCACCTGCCAGG - Intergenic
934645398 2:96056318-96056340 TCTCCAAGGCAGCACCTGCCAGG + Intergenic
934838802 2:97612407-97612429 TCTCCAAGGCAGCACCTGCCAGG + Intergenic
936359393 2:111783478-111783500 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
937269301 2:120637900-120637922 TCCCCAGGGCCGCCTCTGCAGGG - Intergenic
937380617 2:121373296-121373318 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
938273255 2:129993562-129993584 TTCCCTCGGCCCCCCATGCCCGG + Intergenic
939895973 2:147791717-147791739 TTCCAGAGGCCTCCCCAGCCAGG + Intergenic
941641748 2:167996452-167996474 GCCCCATGGCTGCCCCTGCCAGG - Intronic
941667288 2:168255079-168255101 TGCCCCGGGCCTCCCCTGCCAGG + Intergenic
1168795974 20:610355-610377 ATGGCAAGGCCGCCCCGGCCGGG + Exonic
1169911375 20:10650310-10650332 TTCCCACGGGGGCACCTGCCAGG - Exonic
1170763672 20:19273141-19273163 TTCCCAAGGCCACCCTTGCCAGG + Intronic
1170850368 20:19998823-19998845 TGCCCTAGGCAGCCCCTCCCTGG - Intronic
1172105809 20:32516766-32516788 TTTCCAAGGCCCTCCATGCCTGG - Intronic
1172829441 20:37820740-37820762 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1174619076 20:51860206-51860228 TTACAAAGGCCACCCCAGCCAGG + Intergenic
1175066306 20:56291504-56291526 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1175956484 20:62612314-62612336 TGCCCAAGGCCCCCTGTGCCTGG - Intergenic
1176167357 20:63681138-63681160 CTCCCAGGGACACCCCTGCCGGG - Intronic
1177765113 21:25449269-25449291 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1180103236 21:45599674-45599696 ATCTGTAGGCCGCCCCTGCCTGG + Intergenic
1180152794 21:45960303-45960325 CTCCCAGTGCCTCCCCTGCCAGG - Intergenic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1181513169 22:23397824-23397846 GACCCAAGGCCACCCCAGCCTGG - Intergenic
1181639853 22:24190752-24190774 CAGCCAAGGCCTCCCCTGCCAGG + Intergenic
1181695632 22:24591516-24591538 GACCCACGGCCTCCCCTGCCTGG - Intronic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1182473278 22:30561586-30561608 TGTCCATGGCAGCCCCTGCCTGG + Intronic
1182517459 22:30867162-30867184 TGCCCAAGCCCACCCCTTCCTGG + Intronic
1182804382 22:33058082-33058104 CTCCCCAGGCTGCCGCTGCCGGG - Intronic
1183107618 22:35626191-35626213 CTCCCAAGGCTGTCCATGCCTGG - Intronic
1183231660 22:36586141-36586163 TTCCAAGGGCCCTCCCTGCCAGG + Intronic
1183556343 22:38530257-38530279 ATCTCAAAGCCTCCCCTGCCAGG - Intronic
1184588913 22:45467785-45467807 TTCCGGAGGCCTCCCCAGCCAGG - Intergenic
1184666121 22:45990013-45990035 CTCCCTAGGCGGCCCCTGCAGGG - Intergenic
1184943236 22:47783724-47783746 TTCCCACAGCCACCCCTGGCTGG + Intergenic
1185259287 22:49852987-49853009 TTATCACGGCCGCCTCTGCCCGG - Intergenic
1185399912 22:50610395-50610417 TTCCCCAGACCTCCCCTGCCAGG - Intronic
950539180 3:13599767-13599789 TTCCCAAGCCACCCCCTCCCTGG - Intronic
952453716 3:33453686-33453708 GTCCCAAGGCCTGCCCTGCGGGG - Intergenic
952961252 3:38590623-38590645 ATCTGAAGGCAGCCCCTGCCTGG - Intronic
953664683 3:44917426-44917448 TCCCCAAGGCAAGCCCTGCCCGG + Intronic
954110139 3:48429155-48429177 TCACCCAGGCCGCCCCTGCCCGG + Intronic
954132513 3:48567730-48567752 TCCCCCAGGCCGCCCCGGGCTGG - Exonic
954441866 3:50526450-50526472 TTTCCAAGGCTGCCTCAGCCAGG + Intergenic
954634657 3:52064995-52065017 TTTCGAAGGCCACCTCTGCCAGG + Intergenic
957657468 3:83099260-83099282 TTCCCGAGGCCTCCCCAGACAGG + Intergenic
958604663 3:96341293-96341315 TTTCTAAGGCCTCCCCAGCCAGG + Intergenic
961449887 3:126997928-126997950 CTCACAAGGCTGCCCCTGCCAGG - Intronic
962212625 3:133491686-133491708 TGCCCAAGGCCACACCTGCCTGG + Intergenic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
965302621 3:167021137-167021159 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
965931245 3:174044971-174044993 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
966883554 3:184362556-184362578 ATCACAAGGCCCCCCCTTCCCGG - Intronic
968006684 3:195247779-195247801 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1202739775 3_GL000221v1_random:42884-42906 CTCACAAGGCCCCCACTGCCAGG - Intergenic
968503297 4:960989-961011 CTCCCATGGCCGGCCCAGCCCGG + Intronic
968516109 4:1016300-1016322 GTCCCCAGGCCTCCCCTGCCCGG - Intronic
968551591 4:1226264-1226286 TGGCCAGGGCCGCCCCTGCACGG + Intronic
968642894 4:1723193-1723215 TGCCCATGGCTCCCCCTGCCAGG + Intronic
968729111 4:2261504-2261526 TTCCCGCGGCCGCGCCTCCCGGG - Intronic
969057320 4:4409962-4409984 TTCCCACGGCAGACCCTGGCTGG - Intronic
969315396 4:6378642-6378664 GTCCCACGGCCGGCCCTGCTGGG - Intronic
969515966 4:7648435-7648457 GTCCCAAGGTCGCTGCTGCCTGG - Intronic
969623577 4:8291275-8291297 TTCCCTGGGACCCCCCTGCCAGG + Intronic
969719593 4:8885998-8886020 GTCCCAAGGCCGCCACCTCCAGG + Intergenic
971093197 4:23369520-23369542 TTCCCAAGGCCCCAGCTGGCAGG - Intergenic
972268212 4:37483238-37483260 TTCCCAAGGCCTTCCCAGACAGG + Intronic
974679155 4:65138194-65138216 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
977136793 4:93315027-93315049 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
978902087 4:113963345-113963367 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
979120479 4:116893425-116893447 TTGCCAAGGCAGCACCTTCCAGG - Intergenic
980153554 4:129078886-129078908 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
980963535 4:139499545-139499567 GTCCCAAGACCCCCCCTCCCAGG + Intronic
982184179 4:152779678-152779700 TGCGGAAGGGCGCCCCTGCCTGG - Exonic
984576333 4:181452581-181452603 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
985037582 4:185856789-185856811 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
985577576 5:680692-680714 TTCCAAAGCCCGCCTCTGCGTGG + Intronic
985592507 5:772788-772810 TTCCAAAGCCCGCCTCTGCGTGG + Intergenic
985665415 5:1179508-1179530 TTCCCAGGGCTGCTCCTGCAGGG + Intergenic
986661216 5:10061912-10061934 TTCCAGAGGCCTCCCCAGCCTGG + Intergenic
987318972 5:16749936-16749958 TCCCCAAGGGTGTCCCTGCCTGG - Intronic
987675190 5:21064492-21064514 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
988942769 5:36162828-36162850 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
989134083 5:38136119-38136141 TTCCCAAGCAAGCCCCTGACAGG + Intergenic
989415426 5:41169605-41169627 TTCCCGAGGCCTCCCCTGCCAGG - Intronic
990032900 5:51283273-51283295 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
992249960 5:74866530-74866552 TGGCCAAGCCCGCACCTGCCGGG - Intronic
992400241 5:76404292-76404314 TTCCGAGGGCAGCCCCTGGCTGG - Intronic
992557674 5:77919012-77919034 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
993769703 5:91910956-91910978 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
997371766 5:133366033-133366055 TCCACAAGGCCCCACCTGCCTGG + Intronic
998136976 5:139679027-139679049 TTTCCAAGGCAGCCCATCCCGGG - Intronic
999565518 5:152856098-152856120 TTCCAAATGCCTCCCCTGCCTGG + Intergenic
1002537812 5:179887752-179887774 TTCCCATGACCTTCCCTGCCAGG - Intronic
1005499447 6:26417330-26417352 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1006105763 6:31715391-31715413 TACCCAAGGCAGCCCCTAGCAGG - Exonic
1007299439 6:40855748-40855770 TTTCCAAGGCCCCTCCTGCCTGG - Intergenic
1007305075 6:40897465-40897487 TATCCAAGCCCGCCCCAGCCTGG + Intergenic
1007600313 6:43076968-43076990 TTACCTGGGCCGACCCTGCCGGG - Exonic
1011026173 6:82871927-82871949 TTCCCAAGTCCTCCCCAGCCAGG + Intergenic
1011223355 6:85081367-85081389 TTCCCAAGGTCACTCCTTCCAGG + Intergenic
1011845113 6:91553259-91553281 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1013485708 6:110594218-110594240 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1014705174 6:124737413-124737435 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1015055817 6:128901978-128902000 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1015729799 6:136335833-136335855 TCCCCAGGGCCGCCTTTGCCTGG + Intergenic
1018138706 6:160805464-160805486 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1018716471 6:166536636-166536658 TTCCCACGCCAGCCCCAGCCTGG + Intronic
1018836512 6:167488255-167488277 CTCCCAGAGCCGCACCTGCCGGG - Intergenic
1018947273 6:168356628-168356650 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947338 6:168356848-168356870 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947371 6:168356958-168356980 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947470 6:168357288-168357310 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947503 6:168357398-168357420 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947568 6:168357618-168357640 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947586 6:168357672-168357694 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947603 6:168357727-168357749 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947635 6:168357837-168357859 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947758 6:168358222-168358244 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947776 6:168358276-168358298 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947793 6:168358331-168358353 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947826 6:168358441-168358463 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947963 6:168358881-168358903 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947981 6:168358935-168358957 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1019150717 6:170003835-170003857 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1019646113 7:2129903-2129925 TTCCCATGGCACCCGCTGCCAGG + Intronic
1020098693 7:5382471-5382493 TTCCCATGGCAACCCCTTCCTGG + Intronic
1021898171 7:25257112-25257134 TTCCCAGAGCTGGCCCTGCCTGG - Intergenic
1022923255 7:35037177-35037199 CCCCCAAGGCCGCCCCCGGCGGG + Intronic
1028979714 7:96954030-96954052 TTCCTAAGGCTGGCCCTGCTAGG + Intergenic
1029109816 7:98207250-98207272 TACCCCAGGCGGCCCCTGCACGG - Exonic
1029461002 7:100693936-100693958 TCCCCGAGGCCGCCGCAGCCCGG - Intergenic
1031018812 7:116604511-116604533 TTCCCACGACCGCCCCTCTCAGG - Intergenic
1031041268 7:116840610-116840632 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1031150855 7:118052561-118052583 TTCCCAAGTGGTCCCCTGCCTGG + Intergenic
1033663768 7:143422367-143422389 TTCCCCAGGTCCCCCCAGCCTGG - Intergenic
1034459624 7:151191317-151191339 TTCCCAAGGCCATCCTTGGCAGG + Intronic
1035224444 7:157425630-157425652 TTCCCAGGGCTGCTCCTGTCTGG + Intergenic
1036122497 8:6033568-6033590 TTCCTCAGGCCTCCCCAGCCAGG + Intergenic
1036987957 8:13557698-13557720 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1037108270 8:15136729-15136751 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1038042822 8:23740303-23740325 TTCCCGAGGCCTCTCCAGCCAGG + Intergenic
1038053497 8:23836021-23836043 TTCCCAAGACGTCCCCAGCCAGG - Intergenic
1038953284 8:32440029-32440051 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1041106871 8:54453472-54453494 TTCCCAACGCCACCTCTCCCTGG + Intergenic
1041186705 8:55308343-55308365 TTCCTTAGGCCTCCCCAGCCAGG - Intronic
1044220273 8:89662467-89662489 TTCCTGAGGCCTCCCCAGCCTGG - Intergenic
1047022993 8:120796218-120796240 TTCCCAAGGCATCTCCAGCCAGG + Intronic
1048464611 8:134655063-134655085 ATGCAAAGGCCACCCCTGCCTGG - Intronic
1048796062 8:138151313-138151335 TGCCCAAGGAGACCCCTGCCAGG - Exonic
1049237357 8:141518855-141518877 TTCCCAGGCCCACCGCTGCCCGG - Intergenic
1049305889 8:141903791-141903813 TTCCTAGGGCCGCCTCTGTCTGG - Intergenic
1049398338 8:142412293-142412315 TGCTCAGGGCCGCGCCTGCCGGG - Intergenic
1049535475 8:143178634-143178656 ATCCCAAGGCCCCCCCTTCAGGG + Intergenic
1049929951 9:446488-446510 TCCCCGAGGCCGCCCCTCCAGGG - Exonic
1051047600 9:12893757-12893779 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1052111802 9:24594811-24594833 TTCTCAACGCCGCCCGTGGCCGG - Intergenic
1053214324 9:36258224-36258246 TGCCCCAGGCCTCCCCTCCCCGG - Intronic
1055453814 9:76454785-76454807 TTCCTGAGGCCCCCCCAGCCAGG + Intronic
1056263586 9:84874073-84874095 TTCCCAAGGCCCAGCCTGACTGG + Intronic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1058638562 9:107060387-107060409 TTCCCAAGGTAGCCCCTCCGTGG - Intergenic
1058711395 9:107682247-107682269 TTCCCAAGGCTGGTCCTGCTGGG - Intergenic
1059354006 9:113685954-113685976 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1059403877 9:114087977-114087999 GTGCCAGGGCCTCCCCTGCCTGG + Intronic
1060671101 9:125470651-125470673 TTCCCAATGACGCCCTTTCCTGG + Intronic
1061537634 9:131259598-131259620 TTCTCAGGGGCGCCCCTCCCAGG - Exonic
1061559539 9:131393943-131393965 ATCCCAAGGCCGCCGCTCCCGGG + Intergenic
1061593546 9:131614148-131614170 TTCTCAAGGCAGCCCCTCCTTGG - Intronic
1062057070 9:134474311-134474333 TTCCCACAGCCTCCCCTGGCTGG + Intergenic
1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG + Intronic
1062528370 9:136987850-136987872 TTGCCCAGGTCACCCCTGCCTGG + Intergenic
1203749658 Un_GL000218v1:66344-66366 CTCACAAGGCCCCCACTGCCGGG - Intergenic
1185938741 X:4289064-4289086 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1186026319 X:5317537-5317559 TTCCCAAGGGCCTCCCTCCCCGG + Intergenic
1186294266 X:8131770-8131792 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1188704038 X:33303778-33303800 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1188856863 X:35208153-35208175 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1189553220 X:42114551-42114573 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1192035980 X:67563569-67563591 TTCCCCAGGCCACTGCTGCCTGG + Intronic
1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG + Intronic
1197016360 X:121631314-121631336 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1197767885 X:130070867-130070889 TTCCCCAGGCCCCCTCTGGCAGG - Intronic
1198330515 X:135618369-135618391 TTCTCAAGGATTCCCCTGCCAGG - Intergenic
1198336413 X:135670627-135670649 TTCTCAAGGATTCCCCTGCCAGG + Intergenic
1198363216 X:135915995-135916017 TTCTCAAGGATTCCCCTGCCAGG - Intergenic
1200117500 X:153775757-153775779 TTTCCAAAGCCCCCCTTGCCGGG - Intronic