ID: 1077411739

View in Genome Browser
Species Human (GRCh38)
Location 11:2406897-2406919
Sequence TGGGGCCCAGCCAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 1, 2: 6, 3: 110, 4: 740}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077411734_1077411739 -5 Left 1077411734 11:2406879-2406901 CCAGGCAGAAGGAGTGAGTGGGG 0: 1
1: 0
2: 5
3: 28
4: 402
Right 1077411739 11:2406897-2406919 TGGGGCCCAGCCAGGGATGGAGG 0: 1
1: 1
2: 6
3: 110
4: 740
1077411723_1077411739 22 Left 1077411723 11:2406852-2406874 CCAGGCCTGGTCCCGGGGCGAGG 0: 1
1: 0
2: 2
3: 22
4: 256
Right 1077411739 11:2406897-2406919 TGGGGCCCAGCCAGGGATGGAGG 0: 1
1: 1
2: 6
3: 110
4: 740
1077411729_1077411739 11 Left 1077411729 11:2406863-2406885 CCCGGGGCGAGGTGGGCCAGGCA 0: 1
1: 0
2: 3
3: 51
4: 317
Right 1077411739 11:2406897-2406919 TGGGGCCCAGCCAGGGATGGAGG 0: 1
1: 1
2: 6
3: 110
4: 740
1077411722_1077411739 23 Left 1077411722 11:2406851-2406873 CCCAGGCCTGGTCCCGGGGCGAG 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1077411739 11:2406897-2406919 TGGGGCCCAGCCAGGGATGGAGG 0: 1
1: 1
2: 6
3: 110
4: 740
1077411727_1077411739 17 Left 1077411727 11:2406857-2406879 CCTGGTCCCGGGGCGAGGTGGGC 0: 1
1: 0
2: 0
3: 24
4: 329
Right 1077411739 11:2406897-2406919 TGGGGCCCAGCCAGGGATGGAGG 0: 1
1: 1
2: 6
3: 110
4: 740
1077411730_1077411739 10 Left 1077411730 11:2406864-2406886 CCGGGGCGAGGTGGGCCAGGCAG 0: 1
1: 0
2: 7
3: 69
4: 378
Right 1077411739 11:2406897-2406919 TGGGGCCCAGCCAGGGATGGAGG 0: 1
1: 1
2: 6
3: 110
4: 740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077411739 Original CRISPR TGGGGCCCAGCCAGGGATGG AGG Intronic