ID: 1077412054

View in Genome Browser
Species Human (GRCh38)
Location 11:2408209-2408231
Sequence TTCCATCCCTCCAGGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077412054_1077412066 0 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412066 11:2408232-2408254 GGTGGGGGACAGAGGGGTCACGG 0: 1
1: 0
2: 4
3: 75
4: 727
1077412054_1077412065 -6 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412065 11:2408226-2408248 ATGGAAGGTGGGGGACAGAGGGG 0: 1
1: 1
2: 4
3: 115
4: 897
1077412054_1077412071 25 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412071 11:2408257-2408279 CCCAGGTTTCTCCTGGTTGTTGG 0: 1
1: 0
2: 0
3: 26
4: 194
1077412054_1077412067 1 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412067 11:2408233-2408255 GTGGGGGACAGAGGGGTCACGGG 0: 1
1: 0
2: 4
3: 47
4: 370
1077412054_1077412068 8 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412068 11:2408240-2408262 ACAGAGGGGTCACGGGACCCAGG 0: 1
1: 0
2: 0
3: 19
4: 189
1077412054_1077412069 18 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412054_1077412063 -8 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412063 11:2408224-2408246 GGATGGAAGGTGGGGGACAGAGG 0: 1
1: 0
2: 16
3: 174
4: 1076
1077412054_1077412064 -7 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412064 11:2408225-2408247 GATGGAAGGTGGGGGACAGAGGG 0: 1
1: 0
2: 10
3: 132
4: 930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077412054 Original CRISPR TTCCATCCCTCCAGGGGTCT TGG (reversed) Intronic