ID: 1077412059

View in Genome Browser
Species Human (GRCh38)
Location 11:2408216-2408238
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 8, 3: 62, 4: 486}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077412059_1077412068 1 Left 1077412059 11:2408216-2408238 CCCTGGAGGGATGGAAGGTGGGG 0: 1
1: 0
2: 8
3: 62
4: 486
Right 1077412068 11:2408240-2408262 ACAGAGGGGTCACGGGACCCAGG 0: 1
1: 0
2: 0
3: 19
4: 189
1077412059_1077412067 -6 Left 1077412059 11:2408216-2408238 CCCTGGAGGGATGGAAGGTGGGG 0: 1
1: 0
2: 8
3: 62
4: 486
Right 1077412067 11:2408233-2408255 GTGGGGGACAGAGGGGTCACGGG 0: 1
1: 0
2: 4
3: 47
4: 370
1077412059_1077412069 11 Left 1077412059 11:2408216-2408238 CCCTGGAGGGATGGAAGGTGGGG 0: 1
1: 0
2: 8
3: 62
4: 486
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412059_1077412066 -7 Left 1077412059 11:2408216-2408238 CCCTGGAGGGATGGAAGGTGGGG 0: 1
1: 0
2: 8
3: 62
4: 486
Right 1077412066 11:2408232-2408254 GGTGGGGGACAGAGGGGTCACGG 0: 1
1: 0
2: 4
3: 75
4: 727
1077412059_1077412071 18 Left 1077412059 11:2408216-2408238 CCCTGGAGGGATGGAAGGTGGGG 0: 1
1: 0
2: 8
3: 62
4: 486
Right 1077412071 11:2408257-2408279 CCCAGGTTTCTCCTGGTTGTTGG 0: 1
1: 0
2: 0
3: 26
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077412059 Original CRISPR CCCCACCTTCCATCCCTCCA GGG (reversed) Intronic