ID: 1077412069

View in Genome Browser
Species Human (GRCh38)
Location 11:2408250-2408272
Sequence CACGGGACCCAGGTTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077412054_1077412069 18 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412059_1077412069 11 Left 1077412059 11:2408216-2408238 CCCTGGAGGGATGGAAGGTGGGG 0: 1
1: 0
2: 8
3: 62
4: 486
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412057_1077412069 12 Left 1077412057 11:2408215-2408237 CCCCTGGAGGGATGGAAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 361
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412061_1077412069 10 Left 1077412061 11:2408217-2408239 CCTGGAGGGATGGAAGGTGGGGG 0: 1
1: 0
2: 2
3: 62
4: 568
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077412069 Original CRISPR CACGGGACCCAGGTTTCTCC TGG Intronic