ID: 1077412069

View in Genome Browser
Species Human (GRCh38)
Location 11:2408250-2408272
Sequence CACGGGACCCAGGTTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077412059_1077412069 11 Left 1077412059 11:2408216-2408238 CCCTGGAGGGATGGAAGGTGGGG 0: 1
1: 0
2: 8
3: 62
4: 486
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412057_1077412069 12 Left 1077412057 11:2408215-2408237 CCCCTGGAGGGATGGAAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 361
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412054_1077412069 18 Left 1077412054 11:2408209-2408231 CCAAGACCCCTGGAGGGATGGAA 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118
1077412061_1077412069 10 Left 1077412061 11:2408217-2408239 CCTGGAGGGATGGAAGGTGGGGG 0: 1
1: 0
2: 2
3: 62
4: 568
Right 1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077412069 Original CRISPR CACGGGACCCAGGTTTCTCC TGG Intronic
900487661 1:2931126-2931148 CAGGGGACCGAGGTCCCTCCAGG - Intergenic
900674595 1:3876982-3877004 CACGGGAGGCAGGATTCTTCTGG - Intronic
902784443 1:18724042-18724064 AATGGGGCCCAGGGTTCTCCCGG + Intronic
902850127 1:19148802-19148824 AGCAGGAGCCAGGTTTCTCCTGG - Intronic
904431402 1:30466830-30466852 AACAGGACCTTGGTTTCTCCTGG - Intergenic
904929090 1:34072350-34072372 CAAGGGACCCTGGTGTCTGCAGG - Intronic
905865393 1:41373741-41373763 CATGGGACACAGATGTCTCCAGG - Intronic
913372380 1:118115240-118115262 AAATGGAGCCAGGTTTCTCCAGG - Intronic
918177340 1:182057658-182057680 AACGAGACCCAGGGTTCCCCGGG - Exonic
919562925 1:199145269-199145291 TAATGGACACAGGTTTCTCCAGG - Intergenic
920192345 1:204201712-204201734 CAAGGGAACCAGCTTCCTCCTGG - Exonic
1067427210 10:46219471-46219493 CAGGGGAACCAGGATTCTCATGG - Intergenic
1072526070 10:96272698-96272720 CAAGGGAACCAGTCTTCTCCTGG + Intergenic
1073057124 10:100710049-100710071 CGCGGGGCGCGGGTTTCTCCCGG - Intergenic
1075784156 10:125037334-125037356 CCCTGCACCCAGGATTCTCCAGG - Intronic
1077103373 11:831869-831891 CACGGGACCCTGGCCACTCCCGG - Exonic
1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG + Intronic
1077981865 11:7308995-7309017 CACAAGACTCAGGTTTCTCCAGG + Intronic
1078368913 11:10729131-10729153 CACGTGACCCAGGTTTCATTTGG - Intergenic
1078729680 11:13963509-13963531 GAGGGGACCCAGGCTTCTCTTGG + Intronic
1084188962 11:67490312-67490334 CAGGGGACCCAGGCTGTTCCTGG - Exonic
1084938688 11:72600964-72600986 CAGGGGACCCAGCTCTTTCCAGG - Intronic
1085217378 11:74844413-74844435 CACTGCCCCCAGGTTTCTTCCGG + Intronic
1094851799 12:34385604-34385626 CAGGGGACCCGGGATTTTCCTGG - Intergenic
1098139990 12:67441514-67441536 CACGGGGCCCAGGTGTATTCTGG - Intergenic
1100377932 12:94034617-94034639 TATGGGACCCTGGTTCCTCCTGG + Intergenic
1105518205 13:21109375-21109397 CACGGGGCCCAGGCTCCTTCAGG + Intergenic
1109492104 13:63115170-63115192 CATTGGACATAGGTTTCTCCAGG - Intergenic
1112352185 13:98645547-98645569 CACCGCACCCAGACTTCTCCTGG - Intergenic
1113768137 13:112893765-112893787 CACGTGCCCCAGCTTTCTCCTGG + Intergenic
1118060032 14:62126276-62126298 CACTGAAACCAGGTTTCTCAGGG - Intergenic
1119554298 14:75541604-75541626 ACCGAGACCCAGCTTTCTCCTGG + Intronic
1120530409 14:85624058-85624080 CACGGGAACCGGCTTCCTCCTGG - Exonic
1121676685 14:95759219-95759241 CACGGTAACCTGGTTTCCCCTGG - Intergenic
1129387893 15:75206065-75206087 CACAGGCCCCAGGGTTCTCAGGG - Exonic
1133066834 16:3213934-3213956 CACGGCATCCTGGATTCTCCTGG + Intergenic
1135630794 16:24034404-24034426 CCAGGCACCCAGGATTCTCCAGG - Intronic
1137405696 16:48187521-48187543 CACGGATCCCAGGGGTCTCCAGG + Intronic
1142036933 16:87868238-87868260 TGCGGGTCCCAGGTTTCTCTGGG - Intronic
1143662588 17:8335896-8335918 CACTGCACCCAGCTTTTTCCTGG - Intergenic
1145777340 17:27538669-27538691 CACAGGACCCAGTTTTGTTCAGG - Intronic
1148453946 17:47800944-47800966 CTCGGGACCCATGTGTCCCCCGG + Intergenic
1148607456 17:48940972-48940994 CACGGAACTCAGGATTCTTCCGG + Exonic
1151414463 17:73952543-73952565 CCCGGGACCCAGGAGCCTCCTGG - Intergenic
1151801003 17:76379760-76379782 CTGGGGACCCAGGTCTCTTCTGG - Intronic
1152859776 17:82689398-82689420 CAAGCCAGCCAGGTTTCTCCAGG - Intronic
1156239841 18:35242644-35242666 CCCGGGGCCCAGGTGTCTCCTGG - Exonic
1156249660 18:35340449-35340471 CACGGGGCCCAGGTGAATCCTGG + Exonic
1160716770 19:580306-580328 CCAAGGACCCAGGGTTCTCCAGG - Intronic
1161161385 19:2763424-2763446 CAAGGGGCCCAGGGATCTCCGGG + Intronic
1162027977 19:7904878-7904900 CACTGGCCCCAGGTGTCCCCAGG - Intronic
1162659825 19:12160206-12160228 GACGGGACCCAGGCCTGTCCGGG + Intergenic
1163647879 19:18500479-18500501 CACAGAATCCAGTTTTCTCCAGG + Intronic
1166812127 19:45521040-45521062 CACTTGCCCCAGATTTCTCCAGG - Intronic
1167121771 19:47521460-47521482 AAAGGTACCCAGCTTTCTCCTGG - Exonic
925302991 2:2830179-2830201 AATGGCACCCATGTTTCTCCAGG + Intergenic
926370091 2:12170742-12170764 CACAAGACCCAGGCTTCTCATGG - Intergenic
928397684 2:30955566-30955588 CTCGTGCCCCAGCTTTCTCCAGG - Intronic
932102258 2:68911921-68911943 CATGGGGACCAGTTTTCTCCAGG - Intergenic
932330184 2:70894322-70894344 CACAGGACTCAGGATTCTCCAGG - Intergenic
932407815 2:71525510-71525532 CACGGCGCCCAGGCTTCCCCAGG + Intronic
932524602 2:72450896-72450918 CAAGGGAGCCAGGTTCCACCAGG + Intronic
933577748 2:84089112-84089134 GAAGGGACACAGTTTTCTCCTGG - Intergenic
933718440 2:85379903-85379925 CAGGAGCCCCAGGTTTATCCTGG - Intronic
934722993 2:96594884-96594906 CAAAGGGCCCAGGTTTCACCTGG + Exonic
935292465 2:101621850-101621872 CACTGGAGCCAGTTGTCTCCTGG - Intergenic
936126004 2:109789692-109789714 CACTGAACTCAGGTTTCCCCTGG - Intergenic
936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG + Intergenic
937112951 2:119380991-119381013 CAGGAGCCCCAGGTTTATCCAGG - Intergenic
942444086 2:176066933-176066955 TACGGGAGGCTGGTTTCTCCTGG - Intergenic
942461968 2:176174881-176174903 CGCGGGCCCCAACTTTCTCCTGG - Intergenic
946230999 2:218291369-218291391 CAGGGGAGCCAGGTGCCTCCTGG - Intronic
947664424 2:231894725-231894747 AACAGGACCCAGGTGACTCCTGG + Intergenic
947801289 2:232929644-232929666 CCATGGACCCAGGTATCTCCAGG + Intronic
948231861 2:236354874-236354896 CAAGAGAGCCAGGCTTCTCCAGG - Intronic
948281583 2:236751363-236751385 CTGAGCACCCAGGTTTCTCCTGG - Intergenic
948477719 2:238231280-238231302 GAGGGGAAGCAGGTTTCTCCAGG - Exonic
949030135 2:241791544-241791566 CAGGAGCCCCAGGTTTATCCTGG + Intronic
1171721247 20:28565278-28565300 CACTGCAACCAGGTTTCTACAGG - Intergenic
1173616349 20:44405791-44405813 CACGAGCCCCAGCTTTCTCTAGG - Intronic
1173672784 20:44810017-44810039 CACGGGACCCCAGGGTCTCCAGG - Intronic
1174487191 20:50868947-50868969 TCAGGGACCCAGGCTTCTCCTGG + Intronic
1176265716 20:64208317-64208339 CAGGAGGCCCAGGTTTCCCCGGG - Exonic
1179709367 21:43204099-43204121 AAGGAGACCCAGGGTTCTCCAGG + Intergenic
1183260242 22:36790143-36790165 TCAGGGACCCAGGCTTCTCCTGG + Intergenic
1184735768 22:46396979-46397001 CACGGGGCCCAGGCTGCCCCAGG + Intronic
951670644 3:25178001-25178023 CACGTAACTCAGGTTTCTCCCGG + Intronic
953768539 3:45761887-45761909 CACGGGACCCTGGCCTTTCCGGG + Intronic
955004906 3:54959307-54959329 CAGGGGACTCAGGTCCCTCCAGG + Intronic
955264023 3:57424025-57424047 CACGGCACCCAGCCTACTCCTGG + Intronic
957167478 3:76693695-76693717 CAGTGGCCCCATGTTTCTCCAGG - Intronic
960959007 3:123055968-123055990 CACTGCACCCAGCCTTCTCCTGG - Intergenic
961865837 3:129952953-129952975 CACGTGACCCAGGTTGCTCCTGG - Intergenic
964610013 3:158602904-158602926 CTCGGGAGCCAGGATTCTCATGG - Exonic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
985478239 5:91785-91807 GACGGGACCCCGATTTCCCCTGG - Intergenic
985554624 5:551942-551964 CAGGGGACCCTTATTTCTCCTGG - Intergenic
986482337 5:8202200-8202222 CCCTGGACCCAGGTCTCTCCTGG + Intergenic
992503310 5:77362817-77362839 CAGGGGACCAAGATTTTTCCAGG - Intronic
1002880291 6:1244713-1244735 CAGGGGACCCAGGAATCTTCAGG + Intergenic
1005700738 6:28398222-28398244 CACGGGGACCAGATGTCTCCTGG + Exonic
1005735177 6:28739078-28739100 TACTGAACCCAGCTTTCTCCTGG + Intergenic
1015287389 6:131502151-131502173 TTGGGGACCCAGGTCTCTCCTGG - Intergenic
1019563513 7:1669084-1669106 CCCGGGTCCTAGGGTTCTCCAGG - Intergenic
1019596883 7:1862185-1862207 TTCGGGAGCCAGGTTACTCCGGG + Intronic
1019699276 7:2465873-2465895 CATGGGAGCCAGGCGTCTCCTGG - Intergenic
1020193818 7:6021469-6021491 ATCTGGACACAGGTTTCTCCAGG - Intronic
1026534575 7:71229299-71229321 CAACGGACCCAGGATTCCCCTGG + Intronic
1034878350 7:154744797-154744819 CCCGGGACCCAGATTTCTCAGGG + Intronic
1035724859 8:1818000-1818022 CACGGGACCCAGGTACAGCCTGG - Intergenic
1037756659 8:21714577-21714599 CATGGAAACCAGGTTTGTCCTGG + Intronic
1038152834 8:24957708-24957730 CTCGGCACCCAGGCTTCTTCAGG + Intergenic
1040894540 8:52352277-52352299 CACAAGCCCCAGCTTTCTCCAGG + Intronic
1048922155 8:139241028-139241050 CTGGGGACCAAGTTTTCTCCTGG + Intergenic
1049227821 8:141466130-141466152 CACAGGACCCTGGGTGCTCCTGG - Intergenic
1049786065 8:144451426-144451448 CACGAGGCCCCGGTATCTCCAGG + Intronic
1052752321 9:32504147-32504169 CACTGAAGCCATGTTTCTCCTGG - Intronic
1056065120 9:82925476-82925498 CAAGGGCCCCAGCTTTCTGCTGG - Intergenic
1056125986 9:83537347-83537369 CCCAGGACCCAGGTTCCTGCAGG + Intronic
1056689492 9:88794552-88794574 CACAGGCCCCAAATTTCTCCTGG - Intergenic
1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG + Intergenic
1057757117 9:97847689-97847711 CACGGGCTCCAGGGTCCTCCTGG + Intergenic
1060475464 9:123983429-123983451 CCCAGGACTCAGATTTCTCCTGG + Intergenic
1062098082 9:134712841-134712863 CACGGGGACCAGGTCTCCCCTGG + Intronic
1062450050 9:136611359-136611381 CAGGGGACCCAGGGAGCTCCAGG + Intergenic
1190248257 X:48704941-48704963 CAAGGGAGCCAGGTTCCTCAAGG + Intronic
1196786763 X:119427544-119427566 CACATGACCCATGTTTCTCTTGG - Intronic