ID: 1077412734

View in Genome Browser
Species Human (GRCh38)
Location 11:2411041-2411063
Sequence GCTGCTTGGCCTCCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 261}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077412726_1077412734 8 Left 1077412726 11:2411010-2411032 CCACCGATAGACCACCCCCAGAG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412720_1077412734 24 Left 1077412720 11:2410994-2411016 CCTGCCTATCCCTTCCCCACCGA 0: 1
1: 0
2: 1
3: 23
4: 259
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412731_1077412734 -8 Left 1077412731 11:2411026-2411048 CCCAGAGCAAGACTTGCTGCTTG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412732_1077412734 -9 Left 1077412732 11:2411027-2411049 CCAGAGCAAGACTTGCTGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412722_1077412734 15 Left 1077412722 11:2411003-2411025 CCCTTCCCCACCGATAGACCACC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412728_1077412734 -3 Left 1077412728 11:2411021-2411043 CCACCCCCAGAGCAAGACTTGCT 0: 1
1: 0
2: 0
3: 19
4: 213
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412721_1077412734 20 Left 1077412721 11:2410998-2411020 CCTATCCCTTCCCCACCGATAGA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412725_1077412734 9 Left 1077412725 11:2411009-2411031 CCCACCGATAGACCACCCCCAGA 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412727_1077412734 5 Left 1077412727 11:2411013-2411035 CCGATAGACCACCCCCAGAGCAA 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412729_1077412734 -6 Left 1077412729 11:2411024-2411046 CCCCCAGAGCAAGACTTGCTGCT 0: 1
1: 0
2: 0
3: 9
4: 204
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412724_1077412734 10 Left 1077412724 11:2411008-2411030 CCCCACCGATAGACCACCCCCAG 0: 1
1: 0
2: 1
3: 4
4: 76
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412723_1077412734 14 Left 1077412723 11:2411004-2411026 CCTTCCCCACCGATAGACCACCC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261
1077412730_1077412734 -7 Left 1077412730 11:2411025-2411047 CCCCAGAGCAAGACTTGCTGCTT 0: 1
1: 0
2: 2
3: 27
4: 262
Right 1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077412734 Original CRISPR GCTGCTTGGCCTCCCCAAGC AGG Intronic
900102356 1:967283-967305 GCTGCATGGCCTTGGCAAGCTGG - Intronic
900798552 1:4724113-4724135 GCTGGGTGGCCTCCCCAGGCTGG + Intronic
901081122 1:6584815-6584837 GCTGCTTGGCCTCTGGAAGGTGG + Intronic
903081991 1:20817921-20817943 CCTCCTTGGCCTCCCAAAGACGG + Intronic
904469850 1:30729533-30729555 GCTCCGTGGCCTCCCCAGACAGG - Intergenic
904696756 1:32335642-32335664 GCTGCTGGGCCACGCCAAGGGGG - Intronic
909651105 1:77977256-77977278 CCGTCTTGGCCTCCCAAAGCTGG - Intronic
912965738 1:114235636-114235658 ACTCCTTGGCCTCCCAAACCAGG - Intergenic
914453146 1:147811201-147811223 GCTGCTTCTCCTTCCCAAGACGG + Intergenic
915541414 1:156569374-156569396 ACCGCTTGGCCTCCTCCAGCCGG + Exonic
916327384 1:163578247-163578269 GCAGATTGGCCTCCCCAATATGG + Intergenic
916545019 1:165796007-165796029 GCTGATTGGCCTCCCTAAAGGGG - Intronic
916554705 1:165884184-165884206 GACGCTTGGCCTCCTCAGGCAGG - Intronic
1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG + Intronic
1065850383 10:29782689-29782711 GTTGCTTGACCGCCCCAAACAGG - Intergenic
1065857506 10:29842284-29842306 ACTGTGTGGCCTCCCCAGGCTGG + Intergenic
1067664659 10:48266789-48266811 GCCCCTTGGCCTCCCCACGGGGG + Intronic
1068055730 10:52011143-52011165 GCTGTTTGGCCTACCTAACCAGG - Intronic
1069357058 10:67598401-67598423 GGTGCTTGGCAACCCCATGCAGG + Intronic
1069604447 10:69730811-69730833 GCTGGTTGGCCTCCTTAAGTGGG + Intergenic
1070535668 10:77375480-77375502 GCTGCTTGGTAGCCCCAGGCAGG - Intronic
1070871404 10:79756889-79756911 TCTGCTTGGGATCCCCAAGCAGG - Intergenic
1070932334 10:80270318-80270340 GCTCTTTGGCTTCCCCCAGCAGG - Intergenic
1071247082 10:83776686-83776708 CCGACTTGGCCTCCCAAAGCTGG - Intergenic
1071582466 10:86785549-86785571 CCCACTTGGCCTCCCAAAGCTGG + Intronic
1071596671 10:86932928-86932950 GCTGCTGGGCCTCTGGAAGCAGG - Intergenic
1071638340 10:87279097-87279119 TCTGCTTGGGATCCCCAAGCAGG - Intergenic
1071656904 10:87458855-87458877 CCTGCTTGGGATCCCCAAGCAGG + Intergenic
1076992207 11:281321-281343 GCGGCTGGGCGTCCCCACGCAGG - Exonic
1077037320 11:501696-501718 GCTGCTTGTCCCTGCCAAGCTGG - Intronic
1077100307 11:819573-819595 GCTTCTTCGCCTCCGCCAGCGGG + Exonic
1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG + Intronic
1077486256 11:2839636-2839658 GCTGCCTTCCCTCCCCCAGCTGG - Intronic
1078653802 11:13219822-13219844 GCTTCTTAGCCACCTCAAGCAGG + Intergenic
1079392403 11:20034006-20034028 GCTGCCTGGCCTCCCAAGCCTGG + Intronic
1080692796 11:34572947-34572969 CCACCTTGGCCTCCCAAAGCTGG + Intergenic
1083253094 11:61481126-61481148 CCTGCTTGGCCTCCTCCAGGAGG + Exonic
1083388382 11:62329704-62329726 CCGCCTTGGCCTCCCAAAGCAGG - Intergenic
1083993730 11:66261897-66261919 GCTGCTTCTCCTCCTCGAGCTGG - Exonic
1084562354 11:69911930-69911952 TCTGCCTGGCCTCCCCCTGCAGG - Intergenic
1084584540 11:70049966-70049988 CCGCCTTGGCCTCCCAAAGCTGG + Intergenic
1084859326 11:72007826-72007848 GGTGATTGGGCTCGCCAAGCAGG - Intronic
1085623443 11:78054468-78054490 CCACCTTGGCCTCCCAAAGCTGG - Intronic
1087035821 11:93755490-93755512 CCAGCTTGGCCTCCCAAAGTGGG - Intronic
1087221472 11:95551082-95551104 GCTGCCTGGCCTCTCCCACCAGG + Intergenic
1088465604 11:110134372-110134394 GCTGCTTGGCAACCAGAAGCTGG - Intronic
1089010544 11:115128565-115128587 TCTGCTCTGCCTCTCCAAGCTGG - Intergenic
1089684392 11:120137683-120137705 GCTTCTTGGCAGCCCCCAGCTGG + Exonic
1089761831 11:120732378-120732400 CCGCCTTGGCCTCCCAAAGCTGG + Intronic
1090363189 11:126187194-126187216 GCTGCTGGGCCTCCCCTAAGAGG + Intergenic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1093788443 12:23218873-23218895 GCTTCTTGTCGTCACCAAGCTGG - Intergenic
1096179847 12:49544655-49544677 CCTGCTTGGCCTTCCCAACGGGG - Intronic
1096238210 12:49943891-49943913 CCTGCTTGGACCCTCCAAGCAGG + Intergenic
1096670876 12:53197649-53197671 GCTGCTGGGGCTCCCCTAGGGGG + Exonic
1097114496 12:56687766-56687788 GTTCCTTGGCTTCCCCATGCCGG - Intronic
1097460938 12:59860829-59860851 CCTCCTTGGCCTCCCAAGGCAGG + Intergenic
1099121616 12:78696505-78696527 GCTAGTTGGACTCCACAAGCCGG + Intergenic
1099928549 12:89047367-89047389 GCTGCTAGGTCTCCTAAAGCAGG - Intergenic
1100875490 12:98957203-98957225 GCTCCTTGGGCTCCACAAGTGGG + Intronic
1101126651 12:101642410-101642432 GCTGCTTCACCTCCCTAACCGGG - Exonic
1101528748 12:105555911-105555933 ACTGCTTGGCCTGGCCCAGCCGG - Intergenic
1101544506 12:105698557-105698579 ACTGCTCTGCCTCTCCAAGCGGG + Intergenic
1102163997 12:110791675-110791697 CCTTCTTGACCTCCCCAGGCTGG - Intergenic
1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG + Exonic
1103268015 12:119647285-119647307 GCTACTTTGCCTCGACAAGCAGG + Intergenic
1103374243 12:120442887-120442909 GCTGCCTGGCCTCCCTTGGCTGG + Intronic
1103436667 12:120932098-120932120 GATACTTGCCCTCACCAAGCTGG - Intergenic
1103909992 12:124346791-124346813 GGAGCTTGGCCTCCCGACGCAGG + Exonic
1105805792 13:23951003-23951025 TCTGCTTGGCCACCCCAGGCTGG + Intergenic
1108931630 13:55830841-55830863 CCGCCTTGGCCTCCCAAAGCTGG - Intergenic
1109140778 13:58712048-58712070 GCTGCTGGGCCGCCCCACTCAGG + Intergenic
1109359264 13:61274624-61274646 GCTGCTTGGCCCCAGCAAACGGG - Intergenic
1109885335 13:68534791-68534813 CCACCTTGGCCTCCCAAAGCTGG - Intergenic
1118077223 14:62312746-62312768 TCTCCTGGGCCTCCCAAAGCTGG + Intergenic
1118256349 14:64209252-64209274 GCTGCTTGGCGCTCCCAGGCAGG + Intronic
1118434892 14:65761802-65761824 GCTGCTTGCACTACCAAAGCAGG + Intergenic
1120810020 14:88793174-88793196 GCTGCTTTGCGTCCTCAACCGGG + Intergenic
1123126933 14:105953602-105953624 GGTGCTTGGCATCCCCATGCAGG - Intergenic
1123407396 15:20029422-20029444 GGTGCTCGGCATCCCCATGCAGG - Intergenic
1123494736 15:20814460-20814482 GCGGATTGGCCTCCCCACGCCGG + Intergenic
1123494766 15:20814577-20814599 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1123516723 15:21036078-21036100 GGTGCTCGGCATCCCCATGCAGG - Intergenic
1123551231 15:21383553-21383575 GCGGATTGGCCTCCCCACGCCGG + Intergenic
1123551261 15:21383670-21383692 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1124349237 15:28943340-28943362 GCTTCTTGGTCTCCCTAAGCTGG - Intronic
1126065640 15:44824420-44824442 GCTGCTGGGCCTCCCAAGGTCGG - Intergenic
1126094195 15:45076147-45076169 GCTGCTGGGCCTCCCAAGGTCGG + Exonic
1128732412 15:70030188-70030210 GGTGTGTGGCCACCCCAAGCTGG - Intergenic
1129232786 15:74205977-74205999 GCTAGGTGGCCTCCCCAACCAGG - Intronic
1131540892 15:93274387-93274409 GTAGCTTGCCCTCCCCCAGCTGG - Intergenic
1202959572 15_KI270727v1_random:110796-110818 GCGGATTGGCCTCCCCACGCCGG + Intergenic
1202959602 15_KI270727v1_random:110913-110935 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1132746033 16:1436691-1436713 GGTGGATGGCCTCCCCCAGCAGG - Exonic
1132871802 16:2118688-2118710 TCTGCTTGGCATCCCCTTGCTGG - Exonic
1133638602 16:7695404-7695426 CCACCTTGGCCTCCCAAAGCAGG - Intronic
1134520726 16:14918208-14918230 TCTGCTTGGCATCCCCTTGCTGG + Intronic
1134550850 16:15137766-15137788 TCTGCTTGGCATCCCCTTGCTGG - Intronic
1134708398 16:16316859-16316881 TCTGCTTGGCATCCCCTTGCTGG + Intergenic
1134715613 16:16356892-16356914 TCTGCTTGGCATCCCCTTGCTGG + Intergenic
1134951204 16:18351786-18351808 TCTGCTTGGCATCCCCTTGCTGG - Intergenic
1134959144 16:18395267-18395289 TCTGCTTGGCATCCCCTTGCTGG - Intergenic
1135957097 16:26964971-26964993 TATCCTTGGCTTCCCCAAGCAGG - Intergenic
1136111134 16:28064026-28064048 CCTGCTGGGGCTCCCCAAGAGGG + Intergenic
1138620811 16:58209748-58209770 CCTCCTTGGCCTCCCAAAGTGGG + Intergenic
1141150192 16:81559110-81559132 GCTTGTTGGCCTCCACAGGCCGG + Intronic
1142127421 16:88417117-88417139 TCTGCTGGGCCTCCCCCAGGAGG + Intergenic
1142474116 17:179894-179916 GCTGATGGGCCTCCCCAGGTGGG + Intronic
1142634569 17:1248847-1248869 CCGCCTTGGCCTCCCAAAGCCGG - Intergenic
1144456956 17:15426649-15426671 ACAGCATGGCCTCCCCATGCAGG - Intergenic
1144461957 17:15465823-15465845 GCTGCATGTCCTCCCCACGGTGG - Intronic
1146255576 17:31390234-31390256 ACTGCATGGCCTCCCCTAGCTGG - Intergenic
1146860054 17:36289559-36289581 GCTCCTTTTTCTCCCCAAGCAGG + Intronic
1147090380 17:38093650-38093672 GCTCCTTTTTCTCCCCAAGCAGG + Intergenic
1147106833 17:38226876-38226898 GCTCCTTTTTCTCCCCAAGCAGG - Intergenic
1147682571 17:42260656-42260678 CCTGCTTTGGCTCCCCAAACTGG + Intronic
1147794194 17:43031006-43031028 CCAGCTTGGCCTCCCAAAGGAGG - Intergenic
1148025915 17:44587566-44587588 TCTGCTTGGCCTTCCCAGGAGGG + Intergenic
1148035312 17:44655882-44655904 GCTCCTCGCCCTCCCCAAACCGG + Intergenic
1148422697 17:47561660-47561682 GCTCCTTTTTCTCCCCAAGCAGG + Intronic
1148678356 17:49458242-49458264 GCAGCTTGCTCTCCCCAGGCAGG + Intronic
1152067777 17:78121095-78121117 GGTGGTTGGCCTCCTCAACCTGG - Exonic
1152343536 17:79738159-79738181 GCTGCCAGGCCCCGCCAAGCAGG + Intronic
1152405237 17:80094463-80094485 CCACCTTGGCCTCCCAAAGCTGG - Intronic
1152625329 17:81385560-81385582 GCTGCATCCCCTCCCCCAGCCGG + Intergenic
1152860769 17:82696115-82696137 CCGCCTTGGCCTCCCAAAGCCGG + Intronic
1152970840 18:159129-159151 GCCGCTTGGCAACCCCAAGAAGG - Intronic
1153942426 18:9989684-9989706 AGTGCTTGGCCTCCCCAGGGAGG - Intergenic
1154110563 18:11565016-11565038 GCTGCTTGGCACCTCCAGGCTGG - Intergenic
1154452138 18:14486981-14487003 GCGGATTGGCCTCCCCAGACCGG + Intergenic
1154452169 18:14487098-14487120 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1155311985 18:24532930-24532952 GCTGCTTGTCCTCCCCACCCTGG - Intergenic
1155974877 18:32118284-32118306 CCACCTTGGCCTCCCAAAGCTGG - Intronic
1157472767 18:48002842-48002864 CCTGCTTGGAATCCCCAAACTGG - Intergenic
1160021213 18:75183430-75183452 GCTGCTGGGCTTCCCCATGAAGG - Intergenic
1160340196 18:78083012-78083034 GCTGCCTGCCCTTCCCCAGCTGG + Intergenic
1160940896 19:1620005-1620027 GCTGCTCGGCCCCGCCAGGCAGG + Intronic
1161596914 19:5155150-5155172 GTCCCTGGGCCTCCCCAAGCTGG + Intergenic
1161652282 19:5492706-5492728 GCAGCTTGGCTTCGCCAAGGAGG + Intergenic
1161772236 19:6237076-6237098 GCTGCCTGGACTCCCCACCCCGG - Intronic
1162044668 19:7990741-7990763 GCTCCTTGGCTTCCTAAAGCAGG + Intronic
1162085982 19:8249382-8249404 GCTCTTTGGGCTCCTCAAGCAGG + Intronic
1162519344 19:11170244-11170266 GTTCCTTGCCCTCCCCAGGCAGG - Exonic
1162956193 19:14099677-14099699 CCACCTTGGCCTCCCCAAGTGGG + Intronic
1163013693 19:14440958-14440980 GCTTCCTGACCTCCCCAAACTGG - Intronic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
1163640932 19:18461577-18461599 GCTGGATGGCCTCCTCCAGCAGG - Exonic
1164284402 19:23800287-23800309 CCGCCTTGGCCTCCCAAAGCTGG + Intronic
1164713300 19:30374784-30374806 GCTGCGAGGCCACCCCCAGCCGG + Intronic
1165080270 19:33302654-33302676 GCTGGTTCGCCGCCCCATGCCGG - Intergenic
1165219120 19:34300524-34300546 TCTGCTTGGACCCGCCAAGCAGG - Exonic
1167117815 19:47498256-47498278 CTTGCCTGGCTTCCCCAAGCAGG - Intronic
925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG + Intronic
925533838 2:4894540-4894562 CCTCCTTGGCCTCCCAAAGTTGG + Intergenic
926152385 2:10432397-10432419 GCTGCCAGGCTGCCCCAAGCCGG - Intergenic
927007069 2:18861739-18861761 GGTGCTTGGCAACCCCATGCAGG + Intergenic
928511229 2:32005891-32005913 GGTGCTTTGCCTCCCCAATGTGG - Intronic
930059250 2:47274707-47274729 GTTGCGTGGCCTCCCCAAGTGGG + Intergenic
933151703 2:78922830-78922852 GCTGCATGGACTCCCCACCCAGG - Intergenic
933713076 2:85341832-85341854 TCTGCTTGGCCTTGCCATGCCGG - Intergenic
934149738 2:89134926-89134948 GCAGCTGGGCCACTCCAAGCAGG + Intergenic
934277568 2:91587061-91587083 GCGGCTTTTCCTCCCGAAGCTGG - Intergenic
934777881 2:96950466-96950488 ACTGCTTGGCCTCGGCAGGCTGG - Intronic
937257352 2:120564852-120564874 GTTGTTTGGCCCTCCCAAGCTGG + Intergenic
942763695 2:179429250-179429272 GCTGCCTGGCATCCCCAAACAGG - Intergenic
947025016 2:225727793-225727815 GCAGATTGTCCTCCCCAAACTGG + Intergenic
947800222 2:232924649-232924671 GCTGCTTTGCCTCCTCCAGGTGG - Intronic
947832067 2:233148531-233148553 CCTGCCTGGCCTCCCTAACCTGG - Intronic
948279711 2:236737795-236737817 GCTGCTGGGCACCCCCAGGCTGG + Intergenic
948300053 2:236898915-236898937 GCTGCTCAGTCTCCGCAAGCTGG - Intergenic
948894105 2:240920333-240920355 GCTGCTTGGCCTCCCACCTCTGG - Intronic
1169193114 20:3670108-3670130 GCTGCTTCTCATCCCCAGGCGGG - Intronic
1169377775 20:5080787-5080809 TCACCTTGGCCTCCCAAAGCTGG + Intronic
1170346929 20:15397544-15397566 CCTGCTTGGCCTCTCAAAGTTGG + Intronic
1170462964 20:16596511-16596533 GCTGCTGGGTATCCCCAACCAGG - Intergenic
1170761871 20:19258165-19258187 GCAGCTGGGCCTCCCCAGGATGG - Intronic
1175256732 20:57652394-57652416 GCTGCTCGGGGTCCCGAAGCTGG + Exonic
1175346487 20:58281095-58281117 CCACCTTGGCCTCCCAAAGCTGG - Intergenic
1175510578 20:59521847-59521869 CCACCTTGGCCTCCCAAAGCTGG - Intergenic
1176120287 20:63451472-63451494 GCTACGTGGAGTCCCCAAGCAGG - Intronic
1176443856 21:6801202-6801224 GCTGCTTCCCCGCCCCAAGAAGG - Intergenic
1176443885 21:6801319-6801341 GCGGATTGGCCTCCCCAGACCGG - Intergenic
1176822052 21:13666358-13666380 GCGGATTGGCCTCCCCAGACCGG - Intergenic
1178320552 21:31601968-31601990 CCGCCTTGGCCTCCCCAAGTGGG - Intergenic
1179887961 21:44322463-44322485 GCTGCCTGGCCTGGCCAGGCAGG - Intronic
1180137473 21:45871018-45871040 GCTGCATGGCCTTCCCCAGCGGG - Intronic
1180137561 21:45871295-45871317 GCTGCACGGCCTTCCCAAGGGGG - Intronic
1181040728 22:20191481-20191503 CCTGCTTGCCCACCCCCAGCAGG + Intergenic
1181139521 22:20794257-20794279 GCTCCTTGTCCTCCACAAGGTGG + Intronic
1182309630 22:29395405-29395427 GCTGCCTGCCCTCAGCAAGCAGG - Intronic
1182352367 22:29706003-29706025 GCTGCTCTGCCTCCTCCAGCTGG + Intergenic
1182515763 22:30858050-30858072 GCAGCTAGGCCTCGCCAAGGGGG + Intronic
1182720931 22:32399389-32399411 CCTCCTTGGCCTCTCAAAGCTGG + Intronic
1183941369 22:41297338-41297360 GCTGATTGTCCTCCCTAAGGTGG - Intergenic
1184108767 22:42383396-42383418 GCAGCTTCACCTCCCCAAACAGG + Exonic
1184273548 22:43398113-43398135 TCTTCCTGGCCTCCCCAGGCCGG + Intergenic
1184691617 22:46119838-46119860 TCTGCTTGGCCTGCCCTGGCTGG - Intergenic
1184697368 22:46147575-46147597 GCTGCTTGGCGACCCAAGGCTGG - Intergenic
950424038 3:12915043-12915065 GATGCTGGGCCTCCCCAGGGCGG + Intronic
950521493 3:13500416-13500438 GCTCCTTGTCCCCACCAAGCTGG - Intronic
953014259 3:39057866-39057888 CCGCCTTGGCCTCCCAAAGCTGG + Intronic
953543061 3:43839762-43839784 GGGGCTTGGCCCCTCCAAGCAGG + Intergenic
954287286 3:49627971-49627993 GCTGCTGGACCTCCTCAACCAGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954451562 3:50574439-50574461 GCTTCTTACCCTCCCCAAGGTGG + Intronic
954676792 3:52320357-52320379 CCTGCCCGGCCTCCCCTAGCGGG - Intronic
955229029 3:57082926-57082948 CCACCTTGGCCTCCCAAAGCGGG + Intergenic
956168640 3:66415308-66415330 GCTGCTGGGCCACCCCAAGAGGG + Intronic
959984700 3:112559929-112559951 TCTCCTTGCCCTCCCTAAGCAGG + Intronic
962895016 3:139706403-139706425 CCAGCATGGCCTCCTCAAGCAGG - Intergenic
964438626 3:156679614-156679636 CCTTCATGGCCTCCCCAATCAGG - Intronic
964715956 3:159721852-159721874 GCTGAGTGGCATCCCCAAGGTGG - Intronic
968427482 4:533384-533406 GCTGCTGGGCCCAGCCAAGCGGG - Intronic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
969033175 4:4229287-4229309 GCGGCTTTTCCTCCCGAAGCTGG + Intergenic
969694398 4:8726405-8726427 GCTGGTTGACCTCCCCAGGTGGG + Intergenic
970225907 4:13856542-13856564 GCTTCTTTGCCACCCCAGGCAGG + Intergenic
970324279 4:14906976-14906998 GCTGATTGGCATCTCCCAGCTGG - Intergenic
970381515 4:15512702-15512724 CCTCCTCGGCCTCCCAAAGCTGG - Intronic
970423517 4:15926428-15926450 CCACCTTGGCCTCCCAAAGCTGG + Intergenic
974883449 4:67787054-67787076 GCTGATTGTCCTCCCCAACATGG - Intergenic
978751526 4:112253549-112253571 GGTGGTTGGCCTGCCCCAGCAGG + Intronic
984908145 4:184649014-184649036 GCTGCCTGGCCTCCCCGGCCCGG + Intronic
985086868 4:186322890-186322912 GCAGCTTGGCCAGTCCAAGCTGG - Intergenic
985231655 4:187824694-187824716 GCTGCTTGTTATCTCCAAGCTGG + Intergenic
985700577 5:1369541-1369563 GCAGCTGAGCCTGCCCAAGCTGG + Intergenic
985799661 5:1996209-1996231 GCTGCCTGGCCTCCCTAAAGAGG + Intergenic
986258944 5:6125813-6125835 GCTGCTCTGTCTCTCCAAGCAGG - Intergenic
986297909 5:6454986-6455008 GCTGCTGGAGCTCTCCAAGCGGG - Intronic
986416182 5:7530490-7530512 CCAGCTTGGCCTCCCAAAGGAGG + Intronic
989092736 5:37750770-37750792 GTTGTTAGGCCTCCCCAGGCAGG + Intronic
989534665 5:42550001-42550023 GCTCTTTGGCCTTCCCCAGCTGG - Intronic
992203563 5:74407544-74407566 GCTGCCTGACGTACCCAAGCTGG - Intergenic
997046546 5:130325851-130325873 GCTGCTGGGCTTCCCCCAGATGG - Intergenic
998895323 5:146792752-146792774 GCTGCTTGAACTCCCCAGTCTGG - Intronic
1001476988 5:172057546-172057568 TCTGCCTGGCCTCCTCATGCTGG + Intronic
1002804971 6:564612-564634 ACTGCTTGGCTTCCCCATCCCGG + Exonic
1006452202 6:34111759-34111781 GCCTCTGGGCATCCCCAAGCTGG - Intronic
1006507129 6:34496468-34496490 GCTGCTCGGCCTCCTCCTGCTGG + Intronic
1007201903 6:40116612-40116634 GCTGCTTTGGCTCCCAAAGGTGG - Intergenic
1007239474 6:40414730-40414752 GAAGCTTGGCCCCCCCAGGCGGG + Intronic
1011633951 6:89353006-89353028 GCTCCTGCACCTCCCCAAGCCGG - Intergenic
1017082376 6:150682106-150682128 GCTGCATGGCCTCAACAAGGTGG - Intronic
1019404525 7:876714-876736 GCAGCTTGCCCTCCACACGCTGG - Exonic
1019917950 7:4145292-4145314 ACAGCATGGCCTCCCCAGGCAGG - Intronic
1021874674 7:25037341-25037363 GATGCAGTGCCTCCCCAAGCTGG + Intergenic
1022091579 7:27111125-27111147 GCTCCTTGGCCTCCTCCAGAGGG + Intronic
1024023211 7:45389740-45389762 GCTACTTGGCCTGCCTGAGCCGG + Intergenic
1024397671 7:48887959-48887981 GCTGTTTGGCCTCACCTAGCTGG + Intergenic
1027554715 7:79648626-79648648 GGTGCTTGGCAGCCCCATGCAGG + Intergenic
1028177564 7:87675157-87675179 TGTGCTTAGCCTCCCCATGCTGG + Intronic
1029987548 7:104935832-104935854 TCTTCTTGGCCTCCCTGAGCCGG + Intergenic
1032682412 7:134198735-134198757 GGAGCTTGGCCTTCCCAACCAGG + Intronic
1033167628 7:139054445-139054467 ATTGCTTAGCCTCCCCATGCTGG - Intronic
1033405426 7:141068415-141068437 CCTCCTTGGCCTCCCAAAGCTGG + Intergenic
1034637807 7:152581165-152581187 GCTTCCTGGACTCCCCACGCTGG - Intergenic
1034684151 7:152954968-152954990 GCTTCCTGGCCCCCCTAAGCTGG - Intergenic
1036757093 8:11477741-11477763 AGTGCTTGGCCTCCCCTAACTGG - Intergenic
1038020691 8:23549932-23549954 CCGCCTTGGCCTCCCAAAGCAGG - Intronic
1038805550 8:30787814-30787836 TCAGCTTGGCCTCCCAAAGCTGG + Intronic
1039835170 8:41250119-41250141 GCTGCCTGGCCTCCCACAGCCGG + Intergenic
1040020564 8:42737199-42737221 GTTGCCTGGCCTACCGAAGCAGG + Exonic
1040537451 8:48322636-48322658 GCTGTTTGTCCTCCCCCAGGAGG + Intergenic
1042212486 8:66394636-66394658 ACAGCTTGGTCTTCCCAAGCAGG + Intergenic
1043967463 8:86495212-86495234 GGTGCTTGGCAACCCCATGCAGG - Intronic
1046104071 8:109645417-109645439 GCAGCCTGGCTTCTCCAAGCCGG - Exonic
1046742561 8:117844815-117844837 GATGCTTGGCGTCCCCAAGCAGG + Intronic
1047805978 8:128360298-128360320 CCGCCTTGGCCTCCCAAAGCTGG + Intergenic
1048424695 8:134312199-134312221 GCTACTTGGGCTTCCCCAGCAGG + Intergenic
1049216117 8:141409181-141409203 GCTCCCAGGCCTCCCCTAGCAGG - Intronic
1049721106 8:144115958-144115980 GCGGCTTGGCCTCCTGCAGCCGG - Exonic
1053291494 9:36882382-36882404 ATTGCCTAGCCTCCCCAAGCAGG - Intronic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1057680061 9:97172244-97172266 CCTGCTTGGCCTCCCAAAGTTGG - Intergenic
1061042505 9:128148305-128148327 GCTGCTTGGGATCCCCAATCTGG - Intergenic
1061189597 9:129074419-129074441 CCTCCTTGGCCTCCCAAAGTAGG + Intergenic
1061469226 9:130809745-130809767 GCAGCTTGGCCTCCCTAATGTGG - Intronic
1062024861 9:134335672-134335694 GCAGCCTGGCCGCCCCCAGCTGG + Intronic
1062316093 9:135967561-135967583 CCTGCTTGGCCTGCCCAGCCAGG - Intergenic
1062494262 9:136824216-136824238 GCTGCTCTGCCTCCCACAGCAGG - Intronic
1203525315 Un_GL000213v1:83208-83230 GCGGATTGGCCTCCCCAGACCGG + Intergenic
1203525344 Un_GL000213v1:83325-83347 GCTGCTTCCCCGCCCCAAGAAGG + Intergenic
1186512254 X:10138912-10138934 GCCGCTCGGCCTCCCGCAGCAGG - Exonic
1186635255 X:11396985-11397007 TCTACTTGGCCTCCCAAAGATGG - Intronic
1189392944 X:40592403-40592425 CCATCTTGGCCTCCCAAAGCTGG - Intronic
1193774787 X:85628354-85628376 GCTGCCTGCCATCCCCATGCAGG - Intergenic
1199627979 X:149758104-149758126 GCTTCTTGGGCTCCCCAAAGAGG + Intergenic
1199700686 X:150373322-150373344 GCTGCTAAGTCTCCCCAACCAGG - Intronic