ID: 1077413083

View in Genome Browser
Species Human (GRCh38)
Location 11:2412523-2412545
Sequence CAGGGTTCAGACTCTGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077413081_1077413083 -10 Left 1077413081 11:2412510-2412532 CCGTGATACAGGTCAGGGTTCAG 0: 1
1: 0
2: 3
3: 7
4: 105
Right 1077413083 11:2412523-2412545 CAGGGTTCAGACTCTGACGAGGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077413083 Original CRISPR CAGGGTTCAGACTCTGACGA GGG Intronic
900039624 1:447576-447598 CAGGGGTCAGACTGTGACTTGGG - Intergenic
900061056 1:682552-682574 CAGGGGTCAGACTGTGACTTGGG - Intergenic
901437677 1:9257966-9257988 CGGGGTTCAGCCTCAGAGGAGGG + Intronic
907643231 1:56213866-56213888 CAAGGCTCAGACTGTGACCATGG - Intergenic
909033369 1:70568005-70568027 CCTGATTCAGACTCTGAGGATGG + Intergenic
919974583 1:202602404-202602426 CAGGGTTCAGTGTCTTCCGATGG + Exonic
920013755 1:202888897-202888919 CGGGGTTCAGATTCTGACTGCGG + Intronic
920846334 1:209595908-209595930 GAGGCTGCAGACTCTGACGCAGG + Intronic
922415098 1:225414178-225414200 CAGGGGTCAGACTCTGGAGCTGG + Intronic
923066907 1:230526771-230526793 CAGCGTTCAAACTCTGATAAGGG - Intergenic
924552173 1:245089139-245089161 CAGGTTTCTGGCTCGGACGATGG + Intronic
1064940977 10:20735204-20735226 CAGGGTTGAGAGTCTCAAGAGGG + Intergenic
1069557532 10:69407778-69407800 CAGGGGCCAGGCTCTGAGGAGGG - Intronic
1069595134 10:69665375-69665397 CTGGGTTCAGGCTCTGCCAAAGG - Intergenic
1070552835 10:77504348-77504370 CAGGGTGTAGACTATGATGAAGG - Intronic
1076965848 11:83488-83510 CAGGGGTCAGACTGTGACTTGGG - Intergenic
1077413083 11:2412523-2412545 CAGGGTTCAGACTCTGACGAGGG + Intronic
1080273978 11:30482888-30482910 CAGAGTTCAAACTCTGTAGAAGG + Intronic
1084583686 11:70041009-70041031 CAGGGTTCAGGCACTGATTAAGG + Intergenic
1085740905 11:79077693-79077715 GAGAGTTCAGACTCTGGGGAGGG + Intronic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1087326312 11:96727630-96727652 CAGCGTTCAAACTCTGATAATGG - Intergenic
1090529299 11:127574202-127574224 TAGGGTTCAGACTCTTACAGGGG + Intergenic
1094426368 12:30320959-30320981 TAGGTTTCAGCCTCTGATGAAGG - Intergenic
1097664480 12:62464011-62464033 TAGGCTTCAGACTCTGAAGTTGG - Intergenic
1103981153 12:124737818-124737840 CAGGGCTCTGACTTGGACGAGGG - Intergenic
1104188472 12:126455157-126455179 CAGGCTTCAGACTGTGAAAAGGG - Intergenic
1107343835 13:39438659-39438681 CAGGGTTCTGAGTCTGCAGAGGG - Intronic
1107732810 13:43365554-43365576 CAGGGTTCAGACCCAGCCCAGGG + Intronic
1110273849 13:73620639-73620661 CTGGGTTCAGTCTCTGACACAGG + Intergenic
1112418162 13:99222154-99222176 CAGGGTTTACATTCTGATGAAGG + Intronic
1117273996 14:54174052-54174074 CAGGCTCCAGACTCAGAAGAAGG + Intergenic
1118974445 14:70664881-70664903 CAGGGTTCAGACTTTGGGGGAGG - Intronic
1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG + Intergenic
1121555168 14:94830982-94831004 CAAGGTTTAGTTTCTGACGAGGG + Intergenic
1122781326 14:104145017-104145039 CAGAGCTCAGAGGCTGACGAGGG - Intronic
1124835445 15:33192428-33192450 CAGGGTTAAGCCTGTGACAAAGG + Intronic
1128152360 15:65371308-65371330 GAGGGTACAGACTCTCAAGAGGG + Intronic
1129191535 15:73940665-73940687 CAGGGTTCAGTATGTGACCAAGG + Intronic
1129193339 15:73950476-73950498 CAGGATTCAGTCTGTGACAAGGG + Intronic
1129255985 15:74334385-74334407 CAGGGTTCAGTGTGTGACCAGGG + Intronic
1129513051 15:76138988-76139010 CAGACTTCCGACTCTGACAAGGG + Intronic
1129689332 15:77704581-77704603 CGGGGTTCAGTGTCTGACCAGGG - Intronic
1139359278 16:66387515-66387537 CAGGGCTCAGTCTATGACTAGGG - Intronic
1141928374 16:87184185-87184207 CAGGGTTCACAGTCTGATGGGGG + Intronic
1142808651 17:2385091-2385113 CAGGGCTCAGCCTCTGAGGATGG + Exonic
1143088361 17:4433770-4433792 CAGGTCTCAGAGGCTGACGATGG + Exonic
1143327647 17:6109943-6109965 CAGGATTCAGCCTCTGTGGAGGG - Intronic
1143357278 17:6339746-6339768 CAGAGTTCAGTTTGTGACGAAGG - Intergenic
1143861511 17:9894584-9894606 CCAGGCTCAGACTCTGACCATGG - Intergenic
1147888897 17:43703352-43703374 CAAGGTTTAGACTCTAACCAAGG - Intergenic
1151643033 17:75410387-75410409 CAGGCTGCAGACTCTGTGGAGGG - Intergenic
1151803457 17:76391211-76391233 CAGGGCTCAGACTCAGAGGGCGG - Exonic
1153518339 18:5926213-5926235 CAGGCTTCAAACACTGACGTTGG - Intergenic
1156470313 18:37373692-37373714 CAGGTTTCAGACTCTAACAGTGG + Intronic
1157323185 18:46649610-46649632 CTGGGTGCAGGCTCTGAAGAAGG - Intronic
1160157789 18:76446575-76446597 CAGGGTTCAGGCTCTAGCTAGGG - Intronic
1160642652 19:153118-153140 CAGGGGTCAGACTGTGACTTGGG - Intergenic
1163672141 19:18635894-18635916 CAGGGTGGAGGCTCTGAAGAGGG + Intergenic
1163685923 19:18711605-18711627 CAGGTTACAGGCTCTGACGTGGG + Intronic
1164638408 19:29807846-29807868 TATGGTTCAGGCTCTGATGATGG - Intergenic
1165970335 19:39623827-39623849 CAGGGTTCAAGCTCTGCCAAGGG - Intergenic
1167854804 19:52228938-52228960 CAGGGTGCAGAATCTGCCTATGG + Exonic
1168313526 19:55473507-55473529 CAGGGCTCAGAGTCTGAGGCTGG + Intergenic
926295588 2:11566443-11566465 CAGGGTTCACACGCTGCCCAGGG - Intronic
928314151 2:30232761-30232783 CAGGGTGAAGAGTCTGACGTAGG - Intronic
929773630 2:44913996-44914018 CAGGATTCTGACTCTGACTAGGG - Intergenic
935093143 2:99916386-99916408 CAGGGCTCAAATTCTGATGAGGG - Intronic
938109273 2:128553210-128553232 CAGGGACCAGAATCTGAGGAGGG - Intergenic
938611344 2:132950479-132950501 CAGTTTTCAGACACTGAGGATGG + Intronic
938727213 2:134119820-134119842 CAGGGTTGAGAGTTTGCCGACGG + Intergenic
942327408 2:174787728-174787750 CAGGGTTCAGCCTTTGTTGAGGG - Intergenic
943540597 2:189209024-189209046 CAGGGCTCAGACTTGGAAGAAGG - Intergenic
943572691 2:189592466-189592488 CAAGATTCAGACTCTGACTTTGG + Intergenic
946986442 2:225279292-225279314 CACATTTTAGACTCTGACGATGG + Intergenic
1176124214 20:63468307-63468329 CAGGGTCCAGTCTCTGCTGACGG - Intronic
1176377922 21:6095932-6095954 CAGAGTCCAGACTCTAAGGAGGG - Intergenic
1179745552 21:43442316-43442338 CAGAGTCCAGACTCTAAGGAGGG + Intergenic
1179955958 21:44738742-44738764 CAGGGGTCAGCCTCTGACCTGGG + Intergenic
1182615841 22:31589508-31589530 CATGGAACAGACTCTGGCGATGG + Exonic
1182860284 22:33553885-33553907 CAGGGCTCAGACTCTCACGGAGG - Intronic
1183085796 22:35486249-35486271 CAGGGTTCAGGGTCTGAGGACGG - Intergenic
949141446 3:638189-638211 CAGGGTTCAGTTTCTGGTGAGGG - Intergenic
949584826 3:5427244-5427266 CAGGGCTCAGACTCAGAGCAGGG - Intergenic
954541604 3:51396535-51396557 CAGGGTTCAGGCCCTGTCTAAGG + Exonic
955948994 3:64223381-64223403 CAGGGCTCAGACTCTGGAGCTGG - Intronic
961430172 3:126875694-126875716 CAGGGTTTAGACTCTAACCCGGG + Intronic
962715524 3:138122758-138122780 CAGGCCTCAGAGCCTGACGATGG + Intergenic
964287090 3:155129968-155129990 CAGAGTTCAGACTCTTCTGAAGG - Intronic
966958560 3:184910052-184910074 CAGGGGTCAGACAGTGATGAGGG + Intronic
967932623 3:194701453-194701475 CAGGATTCAGACTCAGAGGCTGG + Intergenic
974940788 4:68465299-68465321 CAGCCATCAGACTCTGACAAGGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
981886199 4:149675708-149675730 CAGCCTTCAGACTCTTAAGACGG - Intergenic
986924551 5:12731215-12731237 CAGAGTTCAGACCCTGAAGTGGG + Intergenic
990279203 5:54231683-54231705 GAGGGTTCAGTTTCTGATGAGGG + Intronic
997673813 5:135697544-135697566 CAGGGTCCAGTCTCTGGCAAAGG - Intergenic
1001026142 5:168225933-168225955 TAGGGTTTTGACTGTGACGAGGG + Intronic
1002734223 5:181371367-181371389 CAGGGGTCAGACTGTGACTTGGG + Intergenic
1002750319 6:102758-102780 CAGGGGTCAGACTGTGACTTGGG - Intergenic
1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG + Intronic
1006164458 6:32056427-32056449 CAGGGGTCAGCCTCAGAGGAAGG + Intronic
1007894922 6:45344829-45344851 CAAGATTCAGACTATGACAAGGG + Intronic
1012593574 6:101013799-101013821 AAGGCTTCAGGCTCTGACAAGGG - Intergenic
1014352610 6:120363270-120363292 CAGCGTTCAAGCTCTGATGAGGG - Intergenic
1015856035 6:137625477-137625499 CTGGGTGCAGGCTCTGACGGAGG - Intergenic
1018693689 6:166372174-166372196 CAGTGTTCAGATACTGACAAAGG - Intronic
1019238471 6:170643682-170643704 CAGGGGTCAGACTGTGACTTGGG + Intergenic
1019440330 7:1042754-1042776 CACGGTGCATACTCTGACCAGGG + Intronic
1022013238 7:26327330-26327352 CAGGGTTCAGACTCAAACCTAGG - Intronic
1025813054 7:64887823-64887845 CAGGGCTCTGACTCTGAGCAGGG + Intronic
1026193158 7:68148042-68148064 CAGGGGTCAGACCCTCACCAGGG - Intergenic
1026603157 7:71793377-71793399 CAGGGTACTGACTCAGACTAAGG - Intronic
1026900160 7:74032636-74032658 CACCGTTCAGACCCTGATGATGG - Intronic
1028087902 7:86658822-86658844 CAGGGTACTGACTCTGACTTGGG - Intronic
1029170785 7:98627809-98627831 CAGGGTTAAGACCCTGAGCAGGG - Intronic
1030822565 7:114113023-114113045 CATGGTTCAATCTCTGATGAAGG - Intronic
1035509297 8:162925-162947 CAGGGGTCAGACTGTGACTTGGG - Intergenic
1038168341 8:25106290-25106312 CAGGGTTCAGTTTCTGGCGAAGG + Intergenic
1044792784 8:95864912-95864934 CAGGTGTCAGAGTCTGACCAGGG + Intergenic
1046004605 8:108464051-108464073 CAGGGGCCAGACTGTGACGTGGG + Intronic
1049196524 8:141318713-141318735 CAGGGTTCAGTGTGTGACCAGGG + Intergenic
1049196542 8:141318833-141318855 CAGGGCTCAGAATGTGACCAGGG + Intergenic
1049196552 8:141318905-141318927 CAGGGTTCAGTGTGTGACCAGGG + Intergenic
1049196558 8:141318929-141318951 CAGGGCTCAGAATGTGACCAGGG + Intergenic
1049196567 8:141318977-141318999 CAGGGCTCAGAATGTGACCAGGG + Intergenic
1049196599 8:141319169-141319191 CAGGGCTCAGAGTGTGACCAGGG + Intergenic
1049196605 8:141319193-141319215 CAGGGGTCAGAGTGTGACCAGGG + Intergenic
1049196611 8:141319217-141319239 CAGGGGTCAGAGTGTGACCAGGG + Intergenic
1049196649 8:141319452-141319474 CAGGGCTCAGAGTGTGACCATGG + Intergenic
1049196657 8:141319500-141319522 CAGGGTTCAGTGTGTGACCAGGG + Intergenic
1049208795 8:141375848-141375870 CAGGGCTCAGCCTGTGACCAGGG + Intergenic
1049269304 8:141685802-141685824 CAGGGCTCAGCCTGTGACCAGGG - Intergenic
1049410726 8:142472907-142472929 CAGGGTTCAGTATGTGACCAGGG + Intronic
1049413122 8:142482454-142482476 CAGGGTTCAGCATGTGACCAAGG - Intronic
1049413146 8:142482594-142482616 CAGGGTTCAGCATGTGACGAGGG - Intronic
1049413237 8:142483124-142483146 CAGGGTTCAGCATGTGACCAAGG - Intronic
1049413347 8:142483717-142483739 CAGGGTTCAGCATGTGACCAGGG - Intronic
1051066257 9:13107092-13107114 CAGGGAGCAGCCTCTGAAGACGG - Exonic
1055992001 9:82116436-82116458 CTGCGTTCTGACTCTGAGGAAGG - Intergenic
1059495071 9:114702695-114702717 CAGTTTCCAGACTCTGACGTGGG - Intergenic
1061172799 9:128970829-128970851 CTGGGTTCAGAGTGTGACGGAGG - Exonic
1062758674 9:138323974-138323996 CAGGGGTCAGACTGTGACTTGGG + Intergenic
1185773601 X:2784632-2784654 GAGTGTTCACACTCTGAAGATGG - Intronic
1188386358 X:29564422-29564444 CAGGATTCAGAATCTGACTAAGG + Intronic
1188849149 X:35110664-35110686 CAGGGATCAGACTCCCAAGATGG + Intergenic
1189061128 X:37754665-37754687 CAGGGTTCAGAGTGTGGCTATGG - Intronic
1191978524 X:66900391-66900413 CAGAGTTCAGACTCTTTCAATGG - Intergenic
1193238161 X:79133941-79133963 CAGGGTTCATTTTCTGATGAGGG + Intergenic
1197780440 X:130153786-130153808 CAGGGTTCAGTTTCTGGTGAGGG - Intronic
1199856825 X:151766058-151766080 CAGGGGACAGACTTTGAGGAGGG - Intergenic