ID: 1077414003

View in Genome Browser
Species Human (GRCh38)
Location 11:2416069-2416091
Sequence CCCTGTGCCCCGGCTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077414003_1077414012 14 Left 1077414003 11:2416069-2416091 CCTCACAGAGCCGGGGCACAGGG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1077414012 11:2416106-2416128 CTGCCTAGAGACGCGGAAACGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1077414003_1077414011 13 Left 1077414003 11:2416069-2416091 CCTCACAGAGCCGGGGCACAGGG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1077414011 11:2416105-2416127 GCTGCCTAGAGACGCGGAAACGG 0: 1
1: 0
2: 0
3: 7
4: 102
1077414003_1077414010 7 Left 1077414003 11:2416069-2416091 CCTCACAGAGCCGGGGCACAGGG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1077414010 11:2416099-2416121 AGGTGCGCTGCCTAGAGACGCGG 0: 1
1: 0
2: 1
3: 36
4: 653
1077414003_1077414014 27 Left 1077414003 11:2416069-2416091 CCTCACAGAGCCGGGGCACAGGG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1077414014 11:2416119-2416141 CGGAAACGGGAACTTCACGCTGG 0: 1
1: 0
2: 0
3: 0
4: 18
1077414003_1077414015 28 Left 1077414003 11:2416069-2416091 CCTCACAGAGCCGGGGCACAGGG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1077414015 11:2416120-2416142 GGAAACGGGAACTTCACGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077414003 Original CRISPR CCCTGTGCCCCGGCTCTGTG AGG (reversed) Intronic