ID: 1077414005

View in Genome Browser
Species Human (GRCh38)
Location 11:2416079-2416101
Sequence CCTTTGGGGACCCTGTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 272}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077414005_1077414017 27 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414017 11:2416129-2416151 AACTTCACGCTGGGACTTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1077414005_1077414012 4 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414012 11:2416106-2416128 CTGCCTAGAGACGCGGAAACGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1077414005_1077414015 18 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414015 11:2416120-2416142 GGAAACGGGAACTTCACGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1077414005_1077414016 26 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414016 11:2416128-2416150 GAACTTCACGCTGGGACTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 108
1077414005_1077414010 -3 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414010 11:2416099-2416121 AGGTGCGCTGCCTAGAGACGCGG 0: 1
1: 0
2: 1
3: 36
4: 653
1077414005_1077414011 3 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414011 11:2416105-2416127 GCTGCCTAGAGACGCGGAAACGG 0: 1
1: 0
2: 0
3: 7
4: 102
1077414005_1077414018 28 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414018 11:2416130-2416152 ACTTCACGCTGGGACTTGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1077414005_1077414014 17 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414014 11:2416119-2416141 CGGAAACGGGAACTTCACGCTGG 0: 1
1: 0
2: 0
3: 0
4: 18
1077414005_1077414019 29 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414019 11:2416131-2416153 CTTCACGCTGGGACTTGAGGGGG 0: 1
1: 0
2: 0
3: 13
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077414005 Original CRISPR CCTTTGGGGACCCTGTGCCC CGG (reversed) Intronic