ID: 1077414011 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:2416105-2416127 |
| Sequence | GCTGCCTAGAGACGCGGAAA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 110 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 102} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077414003_1077414011 | 13 | Left | 1077414003 | 11:2416069-2416091 | CCTCACAGAGCCGGGGCACAGGG | 0: 1 1: 0 2: 0 3: 26 4: 294 |
||
| Right | 1077414011 | 11:2416105-2416127 | GCTGCCTAGAGACGCGGAAACGG | 0: 1 1: 0 2: 0 3: 7 4: 102 |
||||
| 1077414005_1077414011 | 3 | Left | 1077414005 | 11:2416079-2416101 | CCGGGGCACAGGGTCCCCAAAGG | 0: 1 1: 0 2: 2 3: 25 4: 272 |
||
| Right | 1077414011 | 11:2416105-2416127 | GCTGCCTAGAGACGCGGAAACGG | 0: 1 1: 0 2: 0 3: 7 4: 102 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077414011 | Original CRISPR | GCTGCCTAGAGACGCGGAAA CGG | Intronic | ||