ID: 1077414011

View in Genome Browser
Species Human (GRCh38)
Location 11:2416105-2416127
Sequence GCTGCCTAGAGACGCGGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077414003_1077414011 13 Left 1077414003 11:2416069-2416091 CCTCACAGAGCCGGGGCACAGGG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1077414011 11:2416105-2416127 GCTGCCTAGAGACGCGGAAACGG 0: 1
1: 0
2: 0
3: 7
4: 102
1077414005_1077414011 3 Left 1077414005 11:2416079-2416101 CCGGGGCACAGGGTCCCCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1077414011 11:2416105-2416127 GCTGCCTAGAGACGCGGAAACGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077414011 Original CRISPR GCTGCCTAGAGACGCGGAAA CGG Intronic