ID: 1077414530

View in Genome Browser
Species Human (GRCh38)
Location 11:2418519-2418541
Sequence GCCCCTACCTCCAAGGTGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 218}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077414515_1077414530 18 Left 1077414515 11:2418478-2418500 CCCCTCCACAAGGCTTCGGCCAG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414511_1077414530 27 Left 1077414511 11:2418469-2418491 CCCACCGCACCCCTCCACAAGGC 0: 1
1: 0
2: 0
3: 22
4: 282
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414513_1077414530 23 Left 1077414513 11:2418473-2418495 CCGCACCCCTCCACAAGGCTTCG 0: 1
1: 0
2: 2
3: 14
4: 217
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414525_1077414530 -5 Left 1077414525 11:2418501-2418523 CCAGGGGGCCTCAGCCAGGCCCC 0: 1
1: 0
2: 8
3: 81
4: 631
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414518_1077414530 13 Left 1077414518 11:2418483-2418505 CCACAAGGCTTCGGCCAGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414523_1077414530 -1 Left 1077414523 11:2418497-2418519 CCAGCCAGGGGGCCTCAGCCAGG 0: 1
1: 1
2: 5
3: 49
4: 452
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414516_1077414530 17 Left 1077414516 11:2418479-2418501 CCCTCCACAAGGCTTCGGCCAGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414512_1077414530 26 Left 1077414512 11:2418470-2418492 CCACCGCACCCCTCCACAAGGCT 0: 1
1: 0
2: 1
3: 39
4: 502
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1077414517_1077414530 16 Left 1077414517 11:2418480-2418502 CCTCCACAAGGCTTCGGCCAGCC 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077414530 Original CRISPR GCCCCTACCTCCAAGGTGTT GGG Exonic
900377069 1:2359766-2359788 GCCTCAACCTCCAAGGAGCTGGG - Intronic
900904125 1:5538870-5538892 GCCTCTGCCTCCAAAGTGCTGGG + Intergenic
901956918 1:12793097-12793119 ACCCCTCCCTCCTTGGTGTTTGG + Intronic
901964911 1:12858779-12858801 ACCCCTCCCTCCTTGGTGTTTGG + Intronic
901980312 1:13029233-13029255 ACCCCTCCCTCCTTGGTGTTTGG + Intronic
901989138 1:13098182-13098204 ACCCCTCCCTCCTTGGTGTTTGG - Intergenic
901992675 1:13128585-13128607 ACCCCTCCCTCCTTGGTGTTTGG + Intergenic
902001775 1:13199698-13199720 ACCCCTCCCTCCTTGGTGTTTGG - Intergenic
902021001 1:13345423-13345445 ACCCCTCCCTCCTTGGTGTTTGG - Intronic
903145789 1:21371123-21371145 CCCCCAACCCCCAAGGTGCTGGG - Intergenic
904250998 1:29224229-29224251 GTCCCTACCTGCAAGCTGCTTGG + Intronic
905883022 1:41476761-41476783 GCCCCTGTTTCCAAGGTGTATGG + Intergenic
908393427 1:63703800-63703822 CCCCCCACCCCCAAGGGGTTGGG + Intergenic
911440013 1:97914048-97914070 GTCCCTACCTCCCAGGTGCTTGG - Intronic
912352598 1:109028459-109028481 GCCTCGACCTCCAAAGTGCTGGG + Intronic
912365807 1:109132847-109132869 GCCCCTATCTACAAGGACTTCGG + Intronic
912943166 1:114062576-114062598 GCCTCTGCCTCCAAAGTGCTGGG + Intergenic
914774112 1:150720309-150720331 GCCTCGGCCCCCAAGGTGTTGGG + Intronic
914875003 1:151506858-151506880 GCCTCGGCCTCCAAAGTGTTGGG - Intergenic
915622436 1:157093978-157094000 GCCCCTGCCCCCAAAGAGTTGGG - Intronic
916149133 1:161768815-161768837 GCCTCAACCTCCCAGGTGATGGG + Intronic
922762857 1:228143173-228143195 GCCCCTGGCTCCAAGCTCTTCGG - Intronic
923083685 1:230684847-230684869 GACACTATCTCCCAGGTGTTTGG - Intronic
924183304 1:241461093-241461115 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
924530182 1:244887212-244887234 GCCCCTGCCCCCAAAGTGCTGGG + Intergenic
924559662 1:245147170-245147192 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
1063607378 10:7534572-7534594 GGCCCTCCCTCCAAGGCGTTTGG - Intergenic
1067092842 10:43278674-43278696 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
1068668828 10:59703969-59703991 GCCTCTGCCTCCAAAGTGCTGGG + Intronic
1070671002 10:78377244-78377266 GCCACTGCCTCCAAGGAGCTTGG + Intergenic
1070728002 10:78805079-78805101 TCCCCTACCTTAAAAGTGTTGGG - Intergenic
1074365109 10:112851549-112851571 GCCCCTTCCTCAAGGGTGTTTGG + Intergenic
1075394265 10:122115242-122115264 GCCCCCACCTTCAAGGAGGTAGG + Intronic
1076303810 10:129449208-129449230 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
1076333462 10:129689177-129689199 GCCCCAGCCTCCAAAGTGCTGGG + Intronic
1076872501 10:133200730-133200752 CCCCCCACCTCCAAGGTCCTGGG - Intronic
1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG + Exonic
1078451286 11:11442827-11442849 GTCCCTCCCTCCCAGGGGTTAGG - Intronic
1079097785 11:17522080-17522102 GCCTCGACCTCCAAAGTGCTGGG + Intronic
1079542160 11:21589551-21589573 GCCCTAACCCCCAAGGTGATGGG + Intergenic
1080578403 11:33621287-33621309 ACCCTTAGCTCCAAGGGGTTTGG + Intronic
1081842435 11:46212464-46212486 GTCTCAGCCTCCAAGGTGTTGGG - Intergenic
1082802334 11:57424380-57424402 ACCCCTTTCTCCAAGGGGTTGGG - Intronic
1083814357 11:65124135-65124157 GCCTCAGCCTCCAAGGTGCTGGG + Intronic
1083901436 11:65645422-65645444 GCCCCTACCTCCCTGGTGGAAGG + Intronic
1084326962 11:68406086-68406108 GCTCCTACCTCCAAGGTGAATGG + Intronic
1087457238 11:98402682-98402704 GCCCCTAGCTGCTAGGTGTCTGG + Intergenic
1087731868 11:101787919-101787941 ACCCCAACCTCCAAAGTGCTGGG + Intronic
1087929307 11:103957923-103957945 TCACCAACCTCCATGGTGTTTGG + Intronic
1088283064 11:108156209-108156231 GCCTCGGCCTCCCAGGTGTTGGG - Intergenic
1089162197 11:116447185-116447207 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
1089712642 11:120326844-120326866 CCCCCAACCTCCAAGATGTCTGG + Intronic
1091236138 11:134023463-134023485 GCACCTTCCCCCAAGGTGTAAGG + Intergenic
1091323978 11:134670474-134670496 GCACCTCCCTCCAAGGTGCAGGG + Intergenic
1092733492 12:11557027-11557049 ACCCCTTCTTCCATGGTGTTGGG - Intergenic
1095249362 12:39960627-39960649 ACCTCAACCTCCAAAGTGTTGGG + Intronic
1096133801 12:49182793-49182815 GCCTCAACCTCCAAAGTGCTAGG - Intergenic
1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG + Intergenic
1101107215 12:101452551-101452573 GCCTCTGCTTCCAAAGTGTTAGG - Intergenic
1101129950 12:101678909-101678931 GCCTCAGCCTCCAAAGTGTTCGG - Intronic
1101208570 12:102513500-102513522 GCCTCAACCTCCCAGGTGTCTGG - Intergenic
1101959964 12:109241595-109241617 GCCTCGACCTCCAAAGTGCTGGG + Intronic
1103499706 12:121391810-121391832 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
1103600229 12:122050228-122050250 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
1104843613 12:131835965-131835987 GCCCTGACCTCCAGGGTGTGGGG - Intronic
1105942687 13:25163854-25163876 ACCTCTACCTCCAAAGTGTTGGG - Intronic
1106224051 13:27771767-27771789 GCCTCTCTTTCCAAGGTGTTTGG + Intergenic
1106591667 13:31103811-31103833 GCCCTAACCTCCAATGTGATAGG - Intergenic
1107879918 13:44824010-44824032 GCCTCAGCCTCCAAAGTGTTTGG + Intergenic
1108376572 13:49819537-49819559 CCCCCTACCTCCTTGGTTTTGGG - Intergenic
1109267274 13:60216212-60216234 GCCTCAACCCCCAAAGTGTTAGG + Intergenic
1109689717 13:65869969-65869991 GCCTCAACCTCCAAGTTGCTGGG + Intergenic
1112558192 13:100488521-100488543 GCCTCAGCCTCCAAGGTATTGGG - Intronic
1113081965 13:106529590-106529612 GCCCTTGCCTCCAGGCTGTTGGG - Intronic
1114313158 14:21485949-21485971 GCCTCGGCCTCCAAAGTGTTGGG - Intronic
1115248357 14:31319793-31319815 GCCTCCACCTCCAACGTGCTGGG - Intronic
1116277861 14:42859964-42859986 GTTCCTACCTCCATGGTGTATGG + Intergenic
1116445509 14:45005162-45005184 GCCTCAACCTCCAAAGTGCTGGG + Intronic
1117328590 14:54690912-54690934 GCCCCTATGTCCAGGGAGTTTGG - Intronic
1117499582 14:56338707-56338729 GGCCCTACCTCTCAGGTGTCTGG + Intergenic
1117877817 14:60273914-60273936 GCCCCAGCCTCCAAGCAGTTGGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120798487 14:88662792-88662814 GCCTCTGCTTCCAAAGTGTTGGG + Intronic
1122573768 14:102727292-102727314 CCCCCCACCTCCAAGAGGTTCGG + Exonic
1124812694 15:32957034-32957056 CCCCCTTCCCCCAAAGTGTTTGG + Intronic
1126072301 15:44875691-44875713 GCTCCTAACTCCAAAGAGTTGGG + Intergenic
1126546930 15:49884349-49884371 GCCTCGACCCCCAAAGTGTTGGG - Intronic
1127806995 15:62530470-62530492 GCCCCAGCCTCCAAGTAGTTGGG + Intronic
1130779176 15:87016854-87016876 GCCCATACCACCAAGGCCTTGGG + Intronic
1130903056 15:88221539-88221561 GCCTCAGCCTCCCAGGTGTTGGG - Intronic
1132839176 16:1970241-1970263 CCTCCTGCCTCCAAAGTGTTGGG + Intergenic
1133489321 16:6251570-6251592 CCCCCTACCTCCAAGGGGTAGGG - Intronic
1134020939 16:10921115-10921137 GCCTCGGCCTCCAAAGTGTTAGG + Intronic
1134409645 16:13993351-13993373 GTCCCTACCTCATAGGGGTTTGG + Intergenic
1135337661 16:21617167-21617189 GCCTCTGCCTCCAAAGTGCTGGG - Intronic
1135390490 16:22089315-22089337 GCCTCGACCTCCAAAGTGCTGGG + Intergenic
1136013726 16:27381858-27381880 GCCCCTACCTGCATGGGATTGGG + Intergenic
1136191650 16:28619260-28619282 GCCTCAGCCTCCCAGGTGTTGGG + Intronic
1137906737 16:52331194-52331216 GCCCCTAGCCCCATGGTGTCTGG - Intergenic
1138359417 16:56414796-56414818 ACCCCTACCTCCTATTTGTTTGG - Intronic
1138856617 16:60701362-60701384 GCCCCAAACTCCAAGGCTTTGGG - Intergenic
1139413549 16:66786881-66786903 GCCCAAACCCCCAGGGTGTTGGG - Intronic
1139684337 16:68590979-68591001 GCCTCGGCCTCCAAAGTGTTAGG - Intergenic
1141047232 16:80726835-80726857 GCCTCAGCCTCCAAAGTGTTGGG - Intronic
1141346808 16:83254128-83254150 GCCCCTAACTCCAGGGTGCTTGG - Intronic
1143634360 17:8155975-8155997 GCCCCTGCTCCCAGGGTGTTTGG - Intronic
1146401210 17:32501426-32501448 ATTCCTTCCTCCAAGGTGTTGGG - Intronic
1146407193 17:32548961-32548983 GCCTCGGCCTCCAAAGTGTTGGG + Intronic
1147337761 17:39737705-39737727 CCCCCTCCCTCCCAGGTGGTCGG + Intergenic
1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG + Intronic
1153544437 18:6191736-6191758 GCCACAGCCTCCAAAGTGTTGGG - Intronic
1153563234 18:6393601-6393623 CCCCATGGCTCCAAGGTGTTTGG - Intronic
1154109550 18:11554177-11554199 TTCCCTACCTCCAAGCTGTCTGG - Intergenic
1155151026 18:23123037-23123059 GCCTCTGCCTCCAAAGTGCTGGG - Intergenic
1155502857 18:26504479-26504501 GCCTCGGCCTCCAAAGTGTTGGG + Intronic
1156279564 18:35622500-35622522 GCCTCAGCCTCCAAAGTGTTAGG + Intronic
1156463110 18:37332684-37332706 GCCCCTCCCTGCTAGGGGTTTGG + Intronic
1157554041 18:48601114-48601136 GCCCTCACCACTAAGGTGTTAGG + Intronic
1158109629 18:53926978-53927000 GCCTCGACCCCCAAAGTGTTGGG - Intergenic
1160879337 19:1312480-1312502 GTCCCTGCCTCCCAGGTGCTGGG + Intergenic
1160892121 19:1384406-1384428 GCCCTTACCTCCCAGGGGTGGGG - Intronic
1160952834 19:1675809-1675831 GCCCCCACCTCCAGGCTGTGTGG - Intergenic
1162448000 19:10736017-10736039 CCACCTGCCTCCAAAGTGTTAGG - Intronic
1163637706 19:18445118-18445140 CCCGCTACTTCCAAGGTGTGGGG - Intronic
1164617810 19:29677221-29677243 GCCCCAAGTCCCAAGGTGTTAGG + Intergenic
1164881233 19:31734344-31734366 GCCCACCCCTCCAAGGTGTCTGG - Intergenic
1165508547 19:36251392-36251414 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
1166218716 19:41352493-41352515 CCCCCTACCACCCAGGTGTCTGG - Intronic
1166811502 19:45517240-45517262 GCCTCAACCTCCAAAGTGCTGGG + Intronic
1167010304 19:46802771-46802793 GCCTCGACCTCCCAAGTGTTGGG - Intergenic
1167426704 19:49433342-49433364 GCCTCCACCCCCAAAGTGTTGGG + Intronic
1168625976 19:57918194-57918216 GCCTCACCCTCCAATGTGTTGGG + Intergenic
925842057 2:8001739-8001761 GCCCTAACCTCCAATGTGATGGG + Intergenic
926028052 2:9561893-9561915 GCCTCTGCCTCCCAAGTGTTGGG + Intergenic
926164259 2:10508978-10509000 GCCTCTGCCTCCAAAGTGCTGGG - Intergenic
931419186 2:62110318-62110340 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
933815962 2:86069083-86069105 GCACCTACCTCCAAGGACTGTGG + Intronic
934844411 2:97653199-97653221 GCCTCAGCCTCCAAGGTGCTGGG - Intergenic
937388097 2:121455640-121455662 GCCTCAACCTCCAAAGTGCTGGG - Intronic
938812101 2:134863040-134863062 CCCCCTACCTCCCAGGAGGTCGG - Intronic
938983192 2:136546237-136546259 GCCCCTCCCTCTGAGGGGTTTGG - Intergenic
942814916 2:180041757-180041779 ACCCCTACCTACAAGGGTTTTGG - Intergenic
944859158 2:203798293-203798315 GCCTCAACCTCCAAAGTGCTGGG + Intergenic
945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG + Intergenic
946320160 2:218948877-218948899 GCCTCTGCCTCCAAGGTGCTGGG - Intergenic
947297946 2:228654008-228654030 GGGCCTTCCTCCAAGGTCTTTGG + Intergenic
947513729 2:230783075-230783097 GCCTCGGCCTCCAAGGTGTTGGG + Intronic
1168876087 20:1173292-1173314 TCCCCTACCTACAAGGGCTTTGG + Intronic
1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG + Intergenic
1172155550 20:32821264-32821286 GCCTCGGCCTCCAAAGTGTTGGG + Intronic
1172203938 20:33148628-33148650 GCCCCTGCCTATAAGGAGTTTGG + Intergenic
1172747804 20:37226433-37226455 ACCTCTGCCTCCAAAGTGTTGGG - Intronic
1172789609 20:37493784-37493806 TTCCCTACCTCCAGGCTGTTGGG + Intronic
1172840656 20:37901390-37901412 GCCCCTTCCTCCAAGGCATGTGG + Intergenic
1177180416 21:17739000-17739022 TCCCCTCCCTCCCTGGTGTTGGG + Intergenic
1178987402 21:37318534-37318556 GCCTCAGCCTCCAAAGTGTTAGG - Intergenic
1179881667 21:44295697-44295719 CCCCCTTCCTCCAGGGTGGTTGG + Intronic
1181801769 22:25352346-25352368 GCTCCTAACTCCAAGGTGGATGG - Intronic
1181916730 22:26287308-26287330 GCCCCTGCCCTCAAGGAGTTAGG - Intronic
1182889831 22:33808456-33808478 GCCCCTACCACCAAGGTGCTTGG + Intronic
1183921640 22:41174179-41174201 GCCTCAACCTCCAAAGTGCTGGG - Intronic
1183928087 22:41220096-41220118 GCCTCTGCCTCCAAAGTGCTGGG - Intronic
950434482 3:12970542-12970564 GCCCCTCTCTCCAAGCTGTCAGG + Intronic
951509900 3:23488775-23488797 GCCCCCACCTCCCACCTGTTAGG - Intronic
953062947 3:39443040-39443062 GCCTCGACCTCCAAAGTGTTGGG - Intergenic
954606141 3:51911415-51911437 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
961462280 3:127058548-127058570 GACCCTACCTCCAGGGTATCTGG + Intergenic
965493700 3:169371342-169371364 TCCCCTACCTCCTAGTTCTTGGG - Intronic
966356002 3:179079452-179079474 GCCCCGGCCTCCAAAGTGCTGGG - Intergenic
966730401 3:183146206-183146228 GCCTCTATCTCCAAGATGTCAGG - Intronic
968437723 4:602711-602733 GCACCTGCCTCCAAGGTCTGTGG - Intergenic
969251217 4:5970029-5970051 GCCTCTGCCTCCAAGGTCTCAGG + Intronic
971916393 4:32875187-32875209 GCCCAGACCTCCAAAGTGCTGGG - Intergenic
972647750 4:40985162-40985184 GCCTCAGCCTCCAACGTGTTGGG + Intronic
975406317 4:73994626-73994648 GCCTCAGCCTCCAAAGTGTTGGG - Intergenic
975454942 4:74579106-74579128 GCCTCGGCCTCCAAAGTGTTGGG + Intergenic
977883815 4:102235986-102236008 GCCCCCAACTCCAAAGAGTTGGG - Intergenic
980785810 4:137553326-137553348 CCTCCTCCTTCCAAGGTGTTGGG - Intergenic
981600713 4:146485459-146485481 GCCCTCAGCACCAAGGTGTTAGG - Intronic
982082464 4:151804025-151804047 GCCCCAACCCCCAATGTGATGGG - Intergenic
983890300 4:173023322-173023344 GCCACAACCTGCCAGGTGTTTGG - Intronic
989561481 5:42857207-42857229 GCCCCTACACCCAGGATGTTTGG + Intronic
995453104 5:112324473-112324495 GCCTCGGCCTCCAAAGTGTTAGG - Intronic
996036195 5:118762071-118762093 GCCCATGCCACCAAGGTCTTGGG + Intergenic
996691408 5:126344223-126344245 ACCTCAACCTCCAAAGTGTTGGG - Intergenic
1000768988 5:165327560-165327582 TCCCTTACCTCCAAAGTTTTTGG + Intergenic
1001552220 5:172611330-172611352 GCCTCTACCTCCAAAGTGCTGGG - Intergenic
1001973138 5:175973264-175973286 GCCTCAGCCTCCAAGGTGCTGGG - Intronic
1002244298 5:177870519-177870541 GCCTCAGCCTCCAAGGTGCTGGG + Intergenic
1003243583 6:4365677-4365699 GCCCCTTCCCCCATGGTGTTTGG + Intergenic
1003261864 6:4524633-4524655 GCCCCAGCCTCCAAGTAGTTGGG + Intergenic
1004241680 6:13928757-13928779 GCCTCTACCTCCTAGTTCTTTGG - Intronic
1005032296 6:21522051-21522073 GCCTCTACCCCAAATGTGTTTGG - Intergenic
1005465651 6:26109786-26109808 GCCTCTGCCTCCAAAGTGCTGGG + Intergenic
1008082569 6:47209705-47209727 CCCCCTACCTCCAGGGCCTTGGG + Intergenic
1014090271 6:117396787-117396809 GCCACTGACTCCATGGTGTTGGG - Intronic
1014740916 6:125146918-125146940 GCTCCTCCCTCCAGGGTGTGGGG + Intronic
1015684694 6:135846812-135846834 GTCCTTACCTCCAATGTATTTGG - Intergenic
1015941129 6:138453222-138453244 GCCTCAGCCTCCAAAGTGTTGGG + Intronic
1017462457 6:154664258-154664280 GCCTCTGCCTCCAAAGTGCTGGG + Intergenic
1018744600 6:166751972-166751994 GCCCCTTTCTCCAAGGAGTCTGG - Intronic
1023423649 7:40011271-40011293 GCCTCGGCCTCCAAGGGGTTGGG - Intronic
1026672884 7:72405041-72405063 GCCCCAACCTCCGAGGTCTCTGG + Intronic
1029184810 7:98730904-98730926 GCCTCGACCTCCAAAGTGCTGGG - Intergenic
1029186251 7:98740994-98741016 GCCTCTAACACCAAGGTGGTGGG - Intergenic
1029390977 7:100273909-100273931 GCCTCGGCCTCCAAAGTGTTGGG + Intergenic
1030348451 7:108457476-108457498 CCCCCAGCCTCCAAGGTGCTGGG + Intergenic
1031944845 7:127828947-127828969 GCCCCTACCTCTAAGAGGTCAGG - Intronic
1034177003 7:149107984-149108006 GCCCCTACCTCCAAGTAGCTGGG + Intronic
1034562471 7:151889959-151889981 GCTCCTAACTCCAAGGTGCCAGG - Intergenic
1034925704 7:155119772-155119794 GCCCCTTCCTCATAGCTGTTTGG + Intergenic
1036243648 8:7099183-7099205 GCCTCAACCTCCAAAGTGCTGGG + Intergenic
1036900990 8:12669024-12669046 GCCTCTGCCTCCAAAGTGCTGGG + Intergenic
1038143101 8:24867605-24867627 GCCCCTGCCTCCCAAGTGCTGGG + Intergenic
1041245894 8:55888235-55888257 GCCCCTTCTTCCAGGGTGTGTGG - Intronic
1041846205 8:62331425-62331447 GTCCCTGCCTTCAAGGAGTTTGG - Intronic
1042271122 8:66956817-66956839 GCTCTTACCTCTAAGGTGATGGG + Intronic
1045626939 8:104063809-104063831 GCCCCTACTTCAAAGAAGTTTGG + Intronic
1047641901 8:126829507-126829529 GCCAGTACTTCCAAAGTGTTTGG + Intergenic
1049675646 8:143887706-143887728 GCCCCTTCCTCCCAGGGGCTTGG - Intergenic
1049777690 8:144414088-144414110 GCCCCTACTCCCCAGGTGCTGGG - Exonic
1050435795 9:5608933-5608955 GCACCTACCTCCTGAGTGTTAGG + Intergenic
1054866410 9:70006819-70006841 GCCCCTTCCTTCATGGTCTTTGG - Intergenic
1058369889 9:104254023-104254045 GCCTCGACCTCCAAAGTGCTAGG + Intergenic
1059596980 9:115731393-115731415 GCCCCTACATACAAGGTCTTAGG - Intergenic
1061165778 9:128921545-128921567 GCCTCTGCCTCCAAAGTGCTGGG + Exonic
1061504453 9:131023731-131023753 GCCCGTGCCTCCAAGCTGCTTGG - Intronic
1062714778 9:138003388-138003410 GTCTCTATCTCCAAAGTGTTGGG + Intronic
1187927871 X:24266583-24266605 GCCTCGGCCTCCAAAGTGTTGGG - Intergenic
1189769096 X:44404801-44404823 GCCTCGGCCTCCAAAGTGTTGGG - Intergenic
1192251050 X:69414022-69414044 GCCTCAGCCTCCAAAGTGTTGGG + Intergenic
1198012429 X:132572042-132572064 TTCCCTACTTCCAAGGTTTTGGG - Intergenic
1200234838 X:154463304-154463326 GCCACAACCTCCAAAGTCTTTGG + Intronic
1200983469 Y:9283237-9283259 CCCCCTACGTCCATGGTGTAAGG - Intergenic
1201690253 Y:16755707-16755729 GCCTCTACCTCCCAAGTGCTTGG + Intergenic
1202126908 Y:21576450-21576472 CCCCCTACATCCATGGTGTAAGG + Intergenic