ID: 1077416476

View in Genome Browser
Species Human (GRCh38)
Location 11:2426464-2426486
Sequence ACGATGGCCCCTGGCTGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077416476_1077416484 16 Left 1077416476 11:2426464-2426486 CCGGGACAGCCAGGGGCCATCGT No data
Right 1077416484 11:2426503-2426525 TCCACCCCAGAACTCCCAAGAGG No data
1077416476_1077416489 27 Left 1077416476 11:2426464-2426486 CCGGGACAGCCAGGGGCCATCGT No data
Right 1077416489 11:2426514-2426536 ACTCCCAAGAGGCAAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077416476 Original CRISPR ACGATGGCCCCTGGCTGTCC CGG (reversed) Intergenic
No off target data available for this crispr