ID: 1077416496

View in Genome Browser
Species Human (GRCh38)
Location 11:2426541-2426563
Sequence CCCCCAGACGGTGAAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077416488_1077416496 9 Left 1077416488 11:2426509-2426531 CCAGAACTCCCAAGAGGCAAAAC No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416482_1077416496 27 Left 1077416482 11:2426491-2426513 CCTGGCCAGAAGTCCACCCCAGA No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416486_1077416496 11 Left 1077416486 11:2426507-2426529 CCCCAGAACTCCCAAGAGGCAAA No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416490_1077416496 1 Left 1077416490 11:2426517-2426539 CCCAAGAGGCAAAACTGAGGCAG No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416483_1077416496 22 Left 1077416483 11:2426496-2426518 CCAGAAGTCCACCCCAGAACTCC No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416491_1077416496 0 Left 1077416491 11:2426518-2426540 CCAAGAGGCAAAACTGAGGCAGC No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416481_1077416496 28 Left 1077416481 11:2426490-2426512 CCCTGGCCAGAAGTCCACCCCAG No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416480_1077416496 29 Left 1077416480 11:2426489-2426511 CCCCTGGCCAGAAGTCCACCCCA No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416487_1077416496 10 Left 1077416487 11:2426508-2426530 CCCAGAACTCCCAAGAGGCAAAA No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data
1077416485_1077416496 14 Left 1077416485 11:2426504-2426526 CCACCCCAGAACTCCCAAGAGGC No data
Right 1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077416496 Original CRISPR CCCCCAGACGGTGAAGGCGC TGG Intergenic
No off target data available for this crispr