ID: 1077419846

View in Genome Browser
Species Human (GRCh38)
Location 11:2445027-2445049
Sequence TGCAGCGAAGGCGAGCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077419846_1077419856 11 Left 1077419846 11:2445027-2445049 CCCGGGCGCTCGCCTTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1077419856 11:2445061-2445083 CGCCGCTCGGGCCGGCCCCCCGG 0: 1
1: 0
2: 2
3: 20
4: 240
1077419846_1077419853 3 Left 1077419846 11:2445027-2445049 CCCGGGCGCTCGCCTTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1077419853 11:2445053-2445075 CCCGGTGCCGCCGCTCGGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 157
1077419846_1077419858 15 Left 1077419846 11:2445027-2445049 CCCGGGCGCTCGCCTTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1077419858 11:2445065-2445087 GCTCGGGCCGGCCCCCCGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 233
1077419846_1077419851 -1 Left 1077419846 11:2445027-2445049 CCCGGGCGCTCGCCTTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1077419851 11:2445049-2445071 AGCTCCCGGTGCCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1077419846_1077419865 30 Left 1077419846 11:2445027-2445049 CCCGGGCGCTCGCCTTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1077419865 11:2445080-2445102 CCGGCAGGCCCTCCTCGTTATGG 0: 1
1: 0
2: 0
3: 6
4: 40
1077419846_1077419850 -2 Left 1077419846 11:2445027-2445049 CCCGGGCGCTCGCCTTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1077419850 11:2445048-2445070 CAGCTCCCGGTGCCGCCGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077419846 Original CRISPR TGCAGCGAAGGCGAGCGCCC GGG (reversed) Exonic
903178969 1:21596028-21596050 TGCAGGGAAGGACAGCACCCCGG + Intergenic
903446063 1:23423880-23423902 TGCAGCGAGGGCGAGGGCGGAGG - Intronic
912576403 1:110675417-110675439 TGCAGGCCAGGCGGGCGCCCTGG + Intergenic
914490188 1:148146793-148146815 TGCAGTGGAGGCGGGAGCCCAGG - Intronic
1070384088 10:75908263-75908285 TGCAGAGAAGCCCAGGGCCCTGG - Intronic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1077419846 11:2445027-2445049 TGCAGCGAAGGCGAGCGCCCGGG - Exonic
1077498910 11:2900122-2900144 TGCAGTCAAGCCGAGAGCCCAGG - Intronic
1077528648 11:3084381-3084403 TGCAGAGAAGGCTGGCGACCTGG - Intergenic
1081528434 11:43942647-43942669 AGCAGCGGCGGCGAGCGCCTCGG + Exonic
1082824520 11:57567924-57567946 TGCACCGGCGGCGAGCGCTCAGG + Intronic
1083741312 11:64712957-64712979 TGCAGCGAAGGTGAGCCCCGGGG - Exonic
1085312636 11:75525486-75525508 TGCACCGGAGGCGAGGGCCTGGG + Exonic
1096811579 12:54173695-54173717 TGCAGAGGAGGCGAGCAGCCCGG - Intronic
1097251245 12:57633190-57633212 CGCGGGGAATGCGAGCGCCCCGG + Exonic
1101618107 12:106357825-106357847 TGCAGGGAAGGCGGGCGCGGAGG + Exonic
1104308877 12:127635825-127635847 TGCAGCTCAGGCGAGCTTCCTGG - Intergenic
1105017000 12:132792378-132792400 TGCAGCACAGGCGAGCGAGCAGG + Intronic
1113372643 13:109737064-109737086 TGCAGGGAAGGCGAGGGGCAGGG + Intergenic
1113973835 13:114211540-114211562 GGCAGGGAGGGCGAGCACCCGGG - Intergenic
1114714888 14:24814573-24814595 TGGAGCTAAGGGGAGCCCCCGGG + Intronic
1118705168 14:68473369-68473391 AGCAGCAAAGGAGAGCGCCTTGG - Intronic
1121637855 14:95465930-95465952 TGCAGTGAAGGCCAAGGCCCAGG - Exonic
1122796109 14:104207051-104207073 TGCACCCAAGGCCAGCACCCAGG - Intergenic
1124463955 15:29919636-29919658 TGCAGTGAGGGAGAGAGCCCTGG + Intronic
1134291139 16:12903296-12903318 TGCAGCGATGGCCACGGCCCCGG - Intronic
1136280351 16:29205003-29205025 TGCCGCGAAGGCCAGGGTCCAGG + Intergenic
1140927117 16:79593955-79593977 TCCAGCGGAGCCGAGCCCCCTGG - Exonic
1141818476 16:86429208-86429230 TGAAGAGAAGGGGAGAGCCCAGG - Intergenic
1142849568 17:2697835-2697857 TGCAGGGAGTGCGGGCGCCCTGG - Intronic
1145190782 17:20841396-20841418 TGCAGTGGAGGCGGGAGCCCAGG - Intronic
1145766768 17:27463619-27463641 TGCAGCAAAGGGGGGCCCCCTGG + Intronic
1146594255 17:34155792-34155814 TGCAGGGAAGGCTACCGGCCAGG - Intronic
1148559069 17:48595644-48595666 TTCAGCAAAGGCGAGAGCCCTGG - Intronic
1149456663 17:56793792-56793814 TGCAGGGGAGGCCAGCACCCTGG + Intronic
1154415127 18:14172180-14172202 AGCAGCGAAGGCCAGGGCCAAGG + Intergenic
1157453129 18:47802699-47802721 AGCAGGGAAAGCGAGGGCCCAGG - Intergenic
1160995423 19:1880027-1880049 TGCAGTGGAGGCGGGAGCCCAGG + Exonic
1161605890 19:5214738-5214760 TGCAGCCAGGGCGAGAGGCCAGG + Intronic
1163606929 19:18280834-18280856 GGCAGCGAAGGCGACCGTCGCGG + Exonic
1163609727 19:18294604-18294626 TGTAGGGAAGGTGAGCACCCTGG + Intergenic
1164806671 19:31122407-31122429 TCCAGGGAAGGCCAGTGCCCGGG - Intergenic
1165636882 19:37347813-37347835 TGGAGCGAGGGGAAGCGCCCTGG + Exonic
925752595 2:7103147-7103169 TGCAGAGATGCCGAGGGCCCTGG + Intergenic
933747945 2:85584484-85584506 AGCAGCGATGGTGAGGGCCCAGG + Exonic
948204706 2:236157055-236157077 TGCAGCGAAGGAGAGGCCACCGG - Intergenic
1179490185 21:41736219-41736241 TGCAGAGAAGGCCAGAGCCCAGG + Intergenic
1180342404 22:11628982-11629004 GGTCCCGAAGGCGAGCGCCCAGG - Intergenic
1181334454 22:22117588-22117610 TGCAGTGGAGGCGGGAGCCCAGG + Intergenic
1185327297 22:50233182-50233204 GGCAGGGAAGGCCAGCTCCCAGG - Intronic
950295782 3:11829039-11829061 TGCAGCGAGGGTGAGTGGCCAGG + Intronic
950740812 3:15050535-15050557 TGCAGCCAAGTAGAACGCCCAGG + Exonic
954406163 3:50346089-50346111 TGGAGAGAAGTCGTGCGCCCTGG - Exonic
955239346 3:57165379-57165401 GGCAGCGAAGGGGACCGCACTGG + Intronic
958641503 3:96813415-96813437 CGCGGCGGAGGCGGGCGCCCAGG - Intergenic
961357841 3:126350134-126350156 TGCAGAGAAGGCGAGGGCACAGG - Intronic
966861827 3:184234776-184234798 TGCAGCCAAGGCCAGGGGCCAGG - Intronic
969034698 4:4243792-4243814 TGCAGTGAAGTGGAGTGCCCAGG - Intronic
981578652 4:146230303-146230325 GGTAGCGAAGGCCAGCGGCCAGG - Intergenic
986297213 5:6449295-6449317 TGCAGCGCCGCCGGGCGCCCGGG + Intronic
1002632644 5:180591398-180591420 TGCAGCTCCGGTGAGCGCCCCGG - Exonic
1006441916 6:34058423-34058445 GGCAGGGAAGGAGAGGGCCCAGG + Intronic
1019054451 6:169213442-169213464 TGCAGGGGCGGCGGGCGCCCTGG + Intergenic
1022008875 7:26291975-26291997 AGCGGCGGCGGCGAGCGCCCAGG - Exonic
1028160131 7:87475774-87475796 TGCAGCCAGGGCGAGGGCCGCGG + Intronic
1032261040 7:130337549-130337571 TGCAGCCAAGGCCAGCCCCTTGG - Intergenic
1037705828 8:21314340-21314362 TCCAGCGACTGCCAGCGCCCTGG - Intergenic
1041449926 8:57995068-57995090 TGCAGCCAAGCCGAGCGCAGAGG - Intronic
1047323299 8:123810702-123810724 GGCAGCGAAGGCCAGTGCTCTGG + Intronic
1049382835 8:142325907-142325929 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1049382847 8:142325957-142325979 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1049382861 8:142326007-142326029 ACCAGCGAAGGGGAGGGCCCTGG + Intronic
1049382880 8:142326101-142326123 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1049382906 8:142326201-142326223 ACCAGCGAAGGGGAGGGCCCTGG + Intronic
1049382918 8:142326251-142326273 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1049382954 8:142326401-142326423 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1049382967 8:142326451-142326473 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1049382981 8:142326501-142326523 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1049382993 8:142326551-142326573 ACCAGCGAAGGGGAGGGCCCCGG + Intronic
1057305350 9:93909132-93909154 CGCAGCGAAGCCCAGCGCCATGG + Intergenic
1062464809 9:136676272-136676294 TGCAGCAGAGGCGAGCGGCCCGG + Intronic