ID: 1077421737

View in Genome Browser
Species Human (GRCh38)
Location 11:2453665-2453687
Sequence GAGGGTAGACTCTGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 545}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077421728_1077421737 25 Left 1077421728 11:2453617-2453639 CCCTTCTGGCTGGCAGAAATCCT 0: 1
1: 0
2: 1
3: 35
4: 276
Right 1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG 0: 1
1: 0
2: 5
3: 56
4: 545
1077421729_1077421737 24 Left 1077421729 11:2453618-2453640 CCTTCTGGCTGGCAGAAATCCTT 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG 0: 1
1: 0
2: 5
3: 56
4: 545
1077421733_1077421737 5 Left 1077421733 11:2453637-2453659 CCTTTGGCATTTGCTGGTAGGCA 0: 1
1: 0
2: 1
3: 10
4: 194
Right 1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG 0: 1
1: 0
2: 5
3: 56
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077421737 Original CRISPR GAGGGTAGACTCTGTGAGGA AGG Intronic
901395863 1:8981111-8981133 AAGGGAAGACCATGTGAGGATGG - Intergenic
901527839 1:9835430-9835452 GAGGGTAGGCTCTGGGAGGAAGG - Intergenic
901741802 1:11346591-11346613 CAGTGTAGACTCTGTGCAGATGG + Intergenic
902718748 1:18290480-18290502 TAAGGTGGCCTCTGTGAGGACGG - Intronic
903280553 1:22247622-22247644 GAAGGTGGACTCCTTGAGGATGG + Intergenic
903663005 1:24990094-24990116 GAGGGAAGACTGTGGGAGGCAGG + Intergenic
904269525 1:29340615-29340637 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
905173282 1:36121784-36121806 GAGGGCAGCCTTTGTGAGGAAGG + Intronic
906927573 1:50135509-50135531 GAGGGTTGAAGCTGGGAGGATGG - Intronic
907141357 1:52188325-52188347 GAGGGTGGAGGCTGGGAGGAGGG + Intronic
907336855 1:53705322-53705344 GAGGGAGGAATCTGTGGGGATGG - Intronic
907949317 1:59166003-59166025 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
908811762 1:67988639-67988661 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
909928742 1:81470388-81470410 GGGGGTAGAATCTGTTGGGAAGG - Intronic
910376568 1:86578446-86578468 GAGGGTGGAGTTTGGGAGGAGGG - Intronic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911824430 1:102463187-102463209 GATAGTAGAGTCCGTGAGGAAGG + Intergenic
912084867 1:105987022-105987044 GAGGGTACACGGTGGGAGGAGGG - Intergenic
912326077 1:108764027-108764049 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
912589692 1:110804028-110804050 GAGGGTGGAGGCTGGGAGGAAGG - Intergenic
912890978 1:113530446-113530468 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
913505548 1:119513428-119513450 GAGGCTATACTCTGTGAATATGG - Intronic
914676462 1:149910428-149910450 GAGAGTGGACTCTGTGAGGAAGG + Intronic
914815023 1:151056936-151056958 GAGGATAGAATTGGTGAGGAGGG - Intronic
915357311 1:155262994-155263016 GAGGGTGGAAACTGTGTGGATGG + Exonic
915754394 1:158245174-158245196 GAGGGAAGACCATGTGAGGGTGG + Intergenic
916276081 1:162994753-162994775 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
916568235 1:166001576-166001598 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
917585214 1:176419266-176419288 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
918158892 1:181878648-181878670 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
918256540 1:182753785-182753807 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
918482862 1:184998363-184998385 GAGGGTGGAGGTTGTGAGGAGGG + Intergenic
918483012 1:184999981-185000003 GAGGGTGGAGTCTGGGAGGAGGG - Intergenic
919023454 1:192137695-192137717 GAGGGTAGAGGGTGTGAGGAGGG + Intergenic
919134271 1:193488831-193488853 GGGGGTAGAAGCTGGGAGGATGG - Intergenic
919739971 1:200975455-200975477 GAGGGTAGACTCGGGTAGGGTGG - Intronic
921014866 1:211179960-211179982 GAGGGTTGACTCTGTGTTGTAGG + Intergenic
922163535 1:223096320-223096342 GAGGGTAGAAGGTGGGAGGAAGG - Intergenic
922212294 1:223495524-223495546 TAGGGTAGAATGGGTGAGGAGGG - Intergenic
922336040 1:224618565-224618587 GAGGGGAAACTCGGGGAGGAAGG + Intronic
922888996 1:229046211-229046233 TAGGGTAGCCCCTGTGAGGAAGG - Intergenic
924559553 1:245146468-245146490 GAGGGTAGAGGATGGGAGGAGGG - Intergenic
1063269961 10:4497292-4497314 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1064102361 10:12474739-12474761 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1064171564 10:13038206-13038228 GAGGGTGGAGGGTGTGAGGAGGG + Intronic
1064614323 10:17136937-17136959 GATGGTAGGCTCTGTGTGCATGG + Intergenic
1065278167 10:24107026-24107048 GAGGGTGGAGGCTGGGAGGAGGG - Intronic
1065860416 10:29867872-29867894 GAGGGTAGAGGATGGGAGGAAGG - Intergenic
1068054183 10:51990710-51990732 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1068402485 10:56548504-56548526 GAGGGTGGAGAATGTGAGGAGGG - Intergenic
1069590560 10:69639162-69639184 GAGGGTGGAGTATGAGAGGAGGG - Intergenic
1069722471 10:70558509-70558531 GAGTGCAGACTCCATGAGGACGG - Intronic
1070413462 10:76166459-76166481 GAGGGTAGAGGTTGAGAGGAGGG - Intronic
1070871997 10:79763695-79763717 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG + Intergenic
1071039750 10:81292723-81292745 GAGGGTAGAGGTTGGGAGGAGGG + Intergenic
1071040384 10:81301811-81301833 GAGGGTAGAGAGTGAGAGGAGGG - Intergenic
1071638915 10:87285867-87285889 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1071656323 10:87452085-87452107 GAGGGTGGAGGCTGGGAGGAGGG + Intergenic
1072450026 10:95532357-95532379 GAGTGGAGGCTCTGTCAGGAAGG - Intronic
1072547696 10:96452680-96452702 GAGGGCAGGCTTTGTGAGCATGG - Intronic
1072839796 10:98759184-98759206 GAGGGTAGAGTGTGGGAGGAGGG + Intronic
1073806813 10:107107441-107107463 GAAGGTAGAATTTGTGAGCAAGG + Intronic
1073863733 10:107776548-107776570 GAGGGTAGAGGATGGGAGGAGGG + Intergenic
1073876343 10:107926451-107926473 GAGGGTGGACGGTGGGAGGAGGG + Intergenic
1073989239 10:109244036-109244058 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1074001092 10:109373584-109373606 GAGGGTGGAGGCTGGGAGGAGGG + Intergenic
1074026390 10:109640461-109640483 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1074867660 10:117554205-117554227 GAGGTTTGACTTGGTGAGGAAGG - Intergenic
1075245211 10:120816090-120816112 GAGGGTAGAGGATGGGAGGAGGG - Intergenic
1075319253 10:121476819-121476841 GATGGTAGCCTCTGGCAGGATGG - Intergenic
1075926339 10:126254533-126254555 GCAGGTGGACTCTGTGAGCAAGG - Intronic
1077274622 11:1698287-1698309 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG + Intronic
1077994999 11:7445474-7445496 GAGGGTAGGGTCAGGGAGGAGGG - Intronic
1080193667 11:29581906-29581928 GAGGGTGGAGGCTGGGAGGAGGG + Intergenic
1080431945 11:32207533-32207555 GAGGAGGAACTCTGTGAGGACGG + Intergenic
1080607572 11:33876312-33876334 GAATGTAAACTCTGTGAGGGTGG + Intronic
1081718782 11:45271012-45271034 GATGGTAAACTCTCTGAGGGTGG - Intronic
1081783137 11:45727358-45727380 GAGGGTAGCCACAGTGGGGAGGG + Intergenic
1082823573 11:57561517-57561539 GAGGGTGCACTCTGTGAGCTGGG + Intronic
1083266844 11:61550772-61550794 GAGGGCAGACTCCTTGAAGAGGG + Intronic
1083417764 11:62536398-62536420 GAGGGTGGGCCCTGTGTGGATGG - Intronic
1083547032 11:63556532-63556554 GAGGGGAGACCCTGTCAGCAGGG + Intronic
1084334339 11:68447862-68447884 GCAGGTAGCCTCTGGGAGGATGG + Intronic
1085067162 11:73507475-73507497 GAGGGTAGTGGCTGGGAGGAGGG + Intronic
1085904767 11:80747128-80747150 GAGTGAATACTCTGTGAGAATGG - Intergenic
1085914227 11:80865509-80865531 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1086537246 11:87862508-87862530 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1087006532 11:93477396-93477418 CAGGGCAGATGCTGTGAGGATGG - Intergenic
1087978092 11:104575408-104575430 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1088701976 11:112421448-112421470 GAGGGGAGAGTATGTGAGAATGG + Intergenic
1089157914 11:116416144-116416166 CAGGGCAGACTTTGTGGGGATGG - Intergenic
1089704733 11:120269779-120269801 GAGGTTAGACTTAGTTAGGAAGG + Intronic
1089708259 11:120296546-120296568 GAGGGTAGAAGGTGAGAGGAGGG - Intronic
1090591428 11:128274352-128274374 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1091046693 11:132331840-132331862 GAGGGGAGAGTGTGTGAGGGTGG + Intronic
1092724391 12:11470798-11470820 GAGGGTGGACGGTGGGAGGAGGG + Intronic
1093263096 12:16965173-16965195 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1093481637 12:19610080-19610102 GAGGGTGGAGACTGGGAGGAGGG - Intronic
1093686026 12:22054869-22054891 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1094209831 12:27877569-27877591 GAGGATAAACTCTGGCAGGAGGG - Intergenic
1094734329 12:33217267-33217289 GAGGGTAAACGTTGAGAGGAGGG - Intergenic
1095634563 12:44417729-44417751 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1095722500 12:45415777-45415799 CAGGGATGACTCTGTCAGGAAGG - Intronic
1095746809 12:45668601-45668623 GAATGTATACTCTGTGAGCAGGG - Intergenic
1095836386 12:46643882-46643904 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1097337296 12:58397104-58397126 GAGGGTAGAGTTTGGGAGAAGGG - Intergenic
1098895977 12:76061272-76061294 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1098989915 12:77054073-77054095 GAGGGTAGAGGGTGAGAGGAGGG + Intronic
1099110416 12:78553147-78553169 CAAGGTAGACTCTGAGAAGAGGG + Intergenic
1099662853 12:85587546-85587568 GAGAGTAGAGGGTGTGAGGAGGG + Intergenic
1099680112 12:85816154-85816176 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1101998483 12:109541837-109541859 GAGGGAAGACTATATGGGGATGG - Intergenic
1102281046 12:111619187-111619209 GAGGGTAGAGTGAGTTAGGATGG + Intergenic
1103047927 12:117753662-117753684 GAGGGTAGACGGTGGGAGGAGGG + Intronic
1103329545 12:120144596-120144618 AAGGGTAGAGTCCTTGAGGAGGG - Intronic
1104154308 12:126116523-126116545 GAGGGTAGAATGTGTCTGGAGGG - Intergenic
1104330494 12:127839894-127839916 GAGGGTGGAGGCTGGGAGGAGGG + Intergenic
1104517945 12:129445308-129445330 GAGGGTGGAGTGTGGGAGGAAGG + Intronic
1104880531 12:132067719-132067741 GGGGGTATAGTCTGTGAGGATGG + Intronic
1104887732 12:132120580-132120602 GAAGGTGGCCTCTGTGAAGAAGG + Intronic
1105056503 12:133104940-133104962 GAGGGTGGAATGTGGGAGGAGGG - Intronic
1105776026 13:23661184-23661206 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1106363578 13:29055511-29055533 GAGGGTAGAAGGTGGGAGGAGGG - Intronic
1106520992 13:30497596-30497618 GAGGGTGGAGGCTGAGAGGAGGG - Intronic
1108106626 13:47017531-47017553 GAGGGTTGAAACTGTGAGAATGG + Intergenic
1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG + Intergenic
1108701600 13:52948679-52948701 GTGGGAAGACTCAGTGAGGTGGG + Intergenic
1108946861 13:56037346-56037368 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1109311915 13:60705127-60705149 GAGGGTAGAAGGTGTGAGGAGGG + Intergenic
1109706140 13:66094959-66094981 GAGGGAAGATTATGTGAGAATGG + Intergenic
1109890902 13:68613252-68613274 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1110304561 13:73970165-73970187 GAGGGTAGAATCTGATAAGATGG + Intronic
1110442721 13:75543175-75543197 GAGGGTAGAGAGTGGGAGGAAGG + Intronic
1110758386 13:79202536-79202558 ATGGGTAGACTGTGTGAGGAAGG - Intergenic
1110811548 13:79816799-79816821 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1111050023 13:82870804-82870826 GAGGGTGGAGTATGGGAGGAGGG - Intergenic
1111892380 13:94099960-94099982 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1112721217 13:102248087-102248109 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
1113133971 13:107068631-107068653 GAGGCCAGAGACTGTGAGGAAGG - Intergenic
1114162580 14:20185577-20185599 AAGGGTAGAGGGTGTGAGGAGGG - Intergenic
1114698055 14:24645884-24645906 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1115940556 14:38603746-38603768 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1116381034 14:44268189-44268211 GAGGGTAGAGGTTGGGAGGAGGG - Intergenic
1116766591 14:49079535-49079557 GAGGGTAGAGGTTGGGAGGAGGG - Intergenic
1116816613 14:49590035-49590057 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1117043105 14:51785959-51785981 GAGGGTAGAAGGTGGGAGGATGG - Intergenic
1118215039 14:63800808-63800830 GAGGGTGGAATCTGGGAGGAGGG + Intergenic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1118536037 14:66765610-66765632 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1120543741 14:85783988-85784010 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1121465023 14:94110254-94110276 GCTGGTAAACTCTGTGAGGATGG + Intronic
1122182713 14:99967609-99967631 GAGGGGTGACTCTGGGATGAGGG - Intergenic
1122983290 14:105201130-105201152 GAGGGTGGGCTGTGTGGGGATGG + Intergenic
1123419237 15:20118056-20118078 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1123446628 15:20335443-20335465 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1123528459 15:21124599-21124621 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125444406 15:39737815-39737837 GAGAGTAGAGGCTGGGAGGAGGG - Intronic
1127330530 15:57934775-57934797 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1127369120 15:58320288-58320310 GACAGCAGACTCTGTGAGGCAGG - Intronic
1127733172 15:61818691-61818713 GAGGGAACACTCTGTGGGGATGG - Intergenic
1127968610 15:63942188-63942210 GAGGTGAGCCTGTGTGAGGAAGG - Intronic
1128302399 15:66574720-66574742 GAGGAGAGTCTCTGTGAAGATGG + Intergenic
1128883310 15:71263109-71263131 GAGGGCAGAGACTGGGAGGAGGG - Intronic
1129491325 15:75928582-75928604 GAGGGTGGAGGGTGTGAGGAAGG + Intronic
1129913963 15:79251621-79251643 GAGGCTAAACACGGTGAGGAGGG - Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130139170 15:81209264-81209286 GAGGGCAGACAGTGTGGGGAGGG + Intronic
1130141391 15:81229268-81229290 GAGGGCAGACAGTGTGGGGAGGG + Intronic
1130191157 15:81737512-81737534 GAGGGTCGAGTGTGAGAGGAGGG + Intergenic
1130909170 15:88259141-88259163 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1131374938 15:91915713-91915735 GAGGGTAGAAGCTTTCAGGATGG + Intronic
1132288643 15:100684141-100684163 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1132684501 16:1156645-1156667 GAGGGTGAACTCTGAGAGGGAGG + Intronic
1132818929 16:1851477-1851499 GAGGGTAAACTCCATGAGGGTGG + Intronic
1133087125 16:3373545-3373567 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1133520682 16:6553610-6553632 GAGAGTAGACGCGGTGGGGATGG + Intronic
1134285823 16:12861340-12861362 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1134423557 16:14116853-14116875 GAAGGAAGACTCTTTGAGGAAGG + Intronic
1134779536 16:16883220-16883242 GAGGAAAGGCTGTGTGAGGATGG + Intergenic
1135518741 16:23157151-23157173 GAAGATAGCCTCTCTGAGGAAGG + Intergenic
1137784657 16:51128357-51128379 GTGGGTAGGCTCTGTGTGGCTGG + Intergenic
1137969330 16:52968417-52968439 GAGGGTAGAGTGTGGGAAGAGGG - Intergenic
1139027879 16:62841524-62841546 GAGGGAAGGCACAGTGAGGATGG + Intergenic
1140152036 16:72377342-72377364 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1140159744 16:72476402-72476424 GAGAGTTTTCTCTGTGAGGAAGG + Intergenic
1141070030 16:80945741-80945763 GAGGTTAGAATCTGTGAGGCGGG - Intergenic
1141937385 16:87250113-87250135 GAGGGTAGAGGGTGAGAGGAGGG + Intronic
1142265905 16:89063872-89063894 GAAGGGAGACTGGGTGAGGAGGG + Intergenic
1142277904 16:89132598-89132620 GAGGGAAGACTCCGTGGGAAGGG - Intronic
1142589070 17:993321-993343 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589094 17:993457-993479 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589102 17:993501-993523 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589105 17:993516-993538 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589113 17:993560-993582 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589142 17:993739-993761 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589183 17:993973-993995 GAGGGTGGATTATGTGAGGGCGG - Intergenic
1142589186 17:993988-994010 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589223 17:994210-994232 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589226 17:994225-994247 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142589229 17:994240-994262 GAGGGTGGATTATGTGAGGGTGG - Intergenic
1142722537 17:1786265-1786287 GAGGGAAGTCTATCTGAGGATGG + Intronic
1143836884 17:9699957-9699979 GAGGGGAGGCACTGTGAGGTTGG + Intronic
1144383227 17:14723738-14723760 GAGGGTAGAGGGTGAGAGGAGGG + Intergenic
1144407330 17:14964717-14964739 GAGGATAAACTCTGTCAGGACGG - Intergenic
1144797000 17:17898513-17898535 GAGGGAAGGCCCTGTGAGGGGGG + Intronic
1145063042 17:19744448-19744470 GAGGGTAGTCGGTGGGAGGATGG + Intronic
1146322865 17:31859861-31859883 GAGGTTAGGCACTGTGGGGAAGG - Intergenic
1147438326 17:40431519-40431541 GAGGCTAGGGTCTCTGAGGAGGG + Intergenic
1147542653 17:41373680-41373702 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1148942649 17:51228219-51228241 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1149362117 17:55906351-55906373 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1151103369 17:71581788-71581810 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1151186383 17:72367187-72367209 GAGGTCAAACTCAGTGAGGAGGG + Intergenic
1151576224 17:74953815-74953837 GAGTGTAGACTCTGGAGGGATGG - Intronic
1151576248 17:74953910-74953932 GAGTGTAGACTCTGGAGGGATGG - Intronic
1152482553 17:80564738-80564760 GAGGGTAGACGGTGGGAGGAGGG - Intronic
1153068733 18:1079573-1079595 GAGGGTAGAGAATGGGAGGAGGG + Intergenic
1153272924 18:3341096-3341118 GAGGGTGGAGGTTGTGAGGAGGG + Intergenic
1153290264 18:3494591-3494613 GAGAGTAGACTCTGTGATATGGG + Intergenic
1153398721 18:4656776-4656798 GAGTGTATACTCTTTGAAGATGG - Intergenic
1153589366 18:6657150-6657172 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1153760378 18:8325306-8325328 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1155567174 18:27148006-27148028 GAGGGTGGAATTTGGGAGGATGG - Intronic
1155672932 18:28394100-28394122 GAGGGTAGAGAATGTGAGGAAGG + Intergenic
1156409396 18:36813224-36813246 GAGGGAAGAGTCTGCGAGGAAGG + Intronic
1157054718 18:44212938-44212960 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1157592319 18:48843192-48843214 GAGGGTGGCCTCAGTGGGGAGGG + Intronic
1157741220 18:50095156-50095178 GAGGGGATACTCTGTGAGAAAGG - Intronic
1157923388 18:51737121-51737143 AAGAGGAGACCCTGTGAGGATGG + Intergenic
1159489896 18:69118693-69118715 GAGGGTGGACAGTGAGAGGAGGG - Intergenic
1159776574 18:72609481-72609503 GAGGCTAGAGTCTGAGATGAAGG - Intronic
1160138887 18:76301008-76301030 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1162194157 19:8971408-8971430 GAGGGTGGAGGCTGGGAGGAGGG + Intronic
1162308509 19:9890355-9890377 AAGGGAAGACTCTGGGGGGAGGG + Intronic
1163965832 19:20746438-20746460 GAGAGTAGAGGGTGTGAGGAGGG - Intronic
1164467992 19:28504696-28504718 GGGGGTGGACACTGTAAGGAAGG - Intergenic
1165344959 19:35239592-35239614 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
1167918080 19:52758619-52758641 GAGGGTAGAGAGTGGGAGGAAGG + Intergenic
1168362660 19:55755430-55755452 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1168519872 19:57041095-57041117 GAGGGCAGATTCTGATAGGACGG - Intergenic
925831806 2:7903479-7903501 GATGGAAGACTCTGTGAGATGGG - Intergenic
926037413 2:9646382-9646404 GAGGGCAGACACTGTGCAGATGG - Intergenic
926783610 2:16498545-16498567 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
926856378 2:17260659-17260681 GAGGGTAGAGGGTGAGAGGAAGG - Intergenic
927165616 2:20317697-20317719 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
928592378 2:32830834-32830856 GAGGATAGAGACTGGGAGGAGGG + Intergenic
928730432 2:34225564-34225586 GAGACAAGACACTGTGAGGAGGG + Intergenic
928886144 2:36150675-36150697 GAGGGTAGAGGATGGGAGGAGGG + Intergenic
929412143 2:41708846-41708868 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
930068411 2:47345431-47345453 GAGGGGAGACTCTGAAAGGCAGG - Intronic
930368326 2:50471730-50471752 GAGGGTGGAGAGTGTGAGGATGG + Intronic
930369530 2:50485697-50485719 GTGGTAAGAGTCTGTGAGGAGGG + Intronic
930833272 2:55768398-55768420 AAGGAAAGACTCTGTGAAGAAGG - Intergenic
931546757 2:63396806-63396828 GAGGGTGGAGTTTGGGAGGAGGG - Intronic
931634611 2:64330101-64330123 GAGGGCAGATGCTGTGAGGAGGG + Intergenic
931638575 2:64362090-64362112 GAGGCTAGAATTAGTGAGGAAGG + Intergenic
931901930 2:66799200-66799222 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
932466761 2:71929075-71929097 TTGGGTAGTCTCTGTGAGAATGG - Intergenic
932511481 2:72297369-72297391 GAGGGTGGAACGTGTGAGGAGGG - Intronic
932690471 2:73908728-73908750 TAGGGGAGCCTCTGTGAGCAGGG - Exonic
932787248 2:74617525-74617547 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
933170071 2:79115213-79115235 AAGGGAGGACTCTGGGAGGAGGG - Intergenic
933225192 2:79740156-79740178 GAGGGTAGAGGTTGGGAGGAGGG - Intronic
933593072 2:84254527-84254549 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
934078910 2:88451689-88451711 GAAGGAAGACTCAGTGAGAAAGG - Intronic
934159194 2:89232060-89232082 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934167542 2:89308016-89308038 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934199732 2:89874430-89874452 GGGGGCAGAGGCTGTGAGGAAGG - Intergenic
934208078 2:89950365-89950387 GGGGGCAGAGACTGTGAGGAAGG - Intergenic
934965225 2:98715641-98715663 GAGGGTGGAGGGTGTGAGGAGGG + Intronic
935027104 2:99287375-99287397 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
935341832 2:102065667-102065689 CACGGAAGACTCTGTCAGGAGGG - Intronic
936392416 2:112087404-112087426 CAGGGTAGAGTCTGAGAGAAAGG - Intronic
937575562 2:123417382-123417404 GAGGGTGGAGTTTGAGAGGAGGG - Intergenic
937791485 2:125967341-125967363 GAGGGGAGACTCTGTGAGCCTGG - Intergenic
938115187 2:128597663-128597685 GAGGGAAGACTCCTTCAGGATGG - Intergenic
939532887 2:143387002-143387024 GAGGGTGGAGGCTGGGAGGAGGG + Intronic
940208723 2:151234369-151234391 GAGGGTGGAAGCTGAGAGGAGGG + Intergenic
940457651 2:153921463-153921485 GAGGGTGGAGTCTTGGAGGAGGG + Intronic
940527041 2:154829271-154829293 GAGGGTAGCGGCTGGGAGGAGGG - Intronic
941566000 2:167109012-167109034 GAGGGTAGAGGGTGGGAGGAAGG - Intronic
941569974 2:167158542-167158564 CATGGTAAACTCTGTGAAGATGG - Intronic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
942072581 2:172329176-172329198 GAAGGTAGACACAGTGGGGAAGG + Intergenic
942121183 2:172779334-172779356 GAGGGTAGACTTCATTAGGAAGG + Intronic
942377214 2:175349953-175349975 GAAGGTAGCCTCTTTGAGCATGG + Intergenic
943030043 2:182675098-182675120 GAGGGTAGAGGGTGAGAGGAGGG - Intergenic
943562278 2:189478019-189478041 GAGGCTCCACTCTGTGAGTAGGG + Intergenic
945519206 2:210802232-210802254 GAGGGTGGAGGGTGTGAGGAGGG - Intergenic
945604112 2:211906695-211906717 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
945608968 2:211974080-211974102 GAGGGTGGACGGTGGGAGGAGGG + Intronic
946884845 2:224212822-224212844 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
947393119 2:229660266-229660288 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
947633593 2:231668766-231668788 AAGGGTAGTCGCTGGGAGGAAGG - Intergenic
1168816829 20:743466-743488 AAGGTTAGACCCTGTAAGGATGG - Intergenic
1168970882 20:1929991-1930013 GAGGGCAGACTGTGGGAGGAGGG - Intronic
1170020613 20:11833301-11833323 GAGGAGGGCCTCTGTGAGGATGG + Intergenic
1172012690 20:31855409-31855431 GAGGGTCGACTGTGTGTGGTGGG + Intronic
1172632180 20:36385945-36385967 CAGGGTAGGGTGTGTGAGGAGGG - Intronic
1172967596 20:38848809-38848831 GAGGGTGGATTGTGGGAGGAGGG + Intronic
1175601572 20:60278394-60278416 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1175737625 20:61398371-61398393 GTGGATGGACTCTGTGAGGCAGG + Intronic
1176951842 21:15056998-15057020 GAGGGTAGACTGTGTCAGGAGGG - Intronic
1177718087 21:24866510-24866532 GAGGGTGGAGGGTGTGAGGAGGG - Intergenic
1177886418 21:26751231-26751253 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1179164141 21:38922486-38922508 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
1179386295 21:40945947-40945969 GAGAGTAGAGTATGGGAGGAAGG + Intergenic
1182649649 22:31840857-31840879 GACTGTAGACTCTGAGGGGAGGG - Intronic
1182994136 22:34797415-34797437 GAGGGAAGAGTACGTGAGGAAGG + Intergenic
1183107029 22:35622287-35622309 GAGGGTAGACTCTGCCAGGGAGG - Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183699895 22:39445349-39445371 GAGGGTTGGCCCTGTGAGGAAGG + Intergenic
1185223029 22:49638558-49638580 GAGAGGAGGCTCTGTGAGAAGGG + Intronic
949300882 3:2582574-2582596 GAGAGTTCACTCTCTGAGGAAGG - Intronic
950503408 3:13378103-13378125 GAGTGTAGACCCACTGAGGACGG - Intronic
950847718 3:16031090-16031112 GAGGCAATACTCTGTGAGAATGG + Intergenic
950967516 3:17156310-17156332 GATGGTAGAACCTGTGGGGAGGG + Intergenic
951720547 3:25693216-25693238 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
951988465 3:28648596-28648618 AATGGTTGACTCTGGGAGGAAGG - Intergenic
952833901 3:37588415-37588437 AAGGGCAGCCTCTGTGGGGAGGG - Intronic
953573817 3:44096726-44096748 GAATGTAAACTCTGTGAGGGTGG - Intergenic
953675425 3:44997885-44997907 GGGAGTAGACTCTGTGTGGGAGG - Intronic
953960755 3:47264034-47264056 CATGGGAGACTGTGTGAGGAGGG - Intronic
953980970 3:47412869-47412891 TGGGGTAGACTCTGGGAGGCTGG - Exonic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954946823 3:54433249-54433271 CAGTGTAGACTCTATCAGGATGG + Intronic
956032269 3:65051402-65051424 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
956354475 3:68376397-68376419 GAGGGTAGATGGTGGGAGGAGGG - Intronic
956577450 3:70768958-70768980 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
958793082 3:98674731-98674753 GAGGATAGAGGCTGGGAGGAGGG - Intergenic
958843272 3:99234623-99234645 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
959430843 3:106252918-106252940 GAGGGTAAAGGGTGTGAGGAGGG + Intergenic
960098168 3:113708206-113708228 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
960347388 3:116550908-116550930 GAGGGTAGAGGGTGAGAGGAGGG - Intronic
960856146 3:122104008-122104030 GAGTGTAGAGTCTGGGAGTAGGG + Intronic
961683242 3:128612839-128612861 AAGGGGAGAGTCTGTGAGAAAGG + Intergenic
962385103 3:134926596-134926618 GAGGGAAGAGTCTGTGTGTATGG + Intronic
962529984 3:136270385-136270407 AAGGGTTGCCTCTGTGAGGTAGG + Intronic
963611298 3:147472127-147472149 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
964158839 3:153621285-153621307 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
964607219 3:158571928-158571950 GAGGGTTGAGGCTGTGAGGTGGG + Intronic
965084629 3:164079018-164079040 GATGGTAGACAGTGGGAGGATGG + Intergenic
965123092 3:164589038-164589060 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
966647786 3:182266101-182266123 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
967604102 3:191423885-191423907 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
967640430 3:191856340-191856362 GAGAGTGGACTGTGGGAGGAGGG - Intergenic
967959060 3:194904995-194905017 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
968222920 3:196951742-196951764 GACGGGAGACTTTGTGGGGAGGG - Intronic
971620174 4:28845626-28845648 GAGGGTAGAAAGTGGGAGGAGGG - Intergenic
972682320 4:41318237-41318259 GGGCATAGACTCTGTGAAGATGG + Intergenic
973093182 4:46163974-46163996 GAGGGTGGAGGCTGGGAGGAGGG + Intergenic
973761038 4:54116074-54116096 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
974239760 4:59231658-59231680 GAGGGTGGACGGTGGGAGGATGG - Intergenic
975028144 4:69577108-69577130 GAGGGTGGAAGTTGTGAGGAGGG + Intergenic
975371833 4:73597965-73597987 GAGGGTGGAATTTGGGAGGAGGG + Intronic
975559765 4:75698235-75698257 GAGAGAAGGCTATGTGAGGAAGG + Intronic
976443495 4:85104043-85104065 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977186578 4:93945683-93945705 GAGGGTAGATGGTGGGAGGAGGG + Intergenic
977655400 4:99515545-99515567 GAGGGTGGAGACTGGGAGGAGGG + Intronic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978390131 4:108216543-108216565 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
978392375 4:108240755-108240777 GAGGGAAGACTCAGTGGAGAAGG + Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979019461 4:115477725-115477747 GAGGGTAGAGCATGGGAGGAGGG + Intergenic
979033793 4:115685713-115685735 GAGGATAGAGAGTGTGAGGAAGG - Intergenic
979152777 4:117341493-117341515 GAGGTCAGACCCAGTGAGGAGGG + Intergenic
979709948 4:123767682-123767704 GAGGGTAGAGGGTGTGAGGAGGG + Intergenic
981001093 4:139829905-139829927 GAGGATAGCCTCTGTGACAATGG + Intronic
982735419 4:159001496-159001518 GAGGGTAGAGGATGGGAGGAGGG - Intronic
983467620 4:168114632-168114654 GAGGGTGGATTTTGGGAGGAGGG - Intronic
983728428 4:170961036-170961058 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
985696970 5:1346152-1346174 GTGAGAAGACTCTGTGGGGAGGG - Intergenic
985868039 5:2530723-2530745 GAGGAAAGAGTCTTTGAGGATGG - Intergenic
986381025 5:7185838-7185860 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
986576432 5:9218046-9218068 GAGGGTAGAGGCGGGGAGGAGGG + Intronic
986589577 5:9354766-9354788 CATGGTAGAGTCTGTGAGGAAGG + Intronic
986908758 5:12527704-12527726 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
987002164 5:13670751-13670773 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
987796352 5:22632061-22632083 GAGGGTAGAGGTTGGGAGGAGGG + Intronic
988163116 5:27547147-27547169 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
988689028 5:33553713-33553735 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
988715308 5:33820971-33820993 GAGGGTGGAGTGTGAGAGGAGGG + Intronic
990630066 5:57659027-57659049 GAGGGTGGAAGCTGGGAGGAGGG - Intergenic
990782254 5:59378280-59378302 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
991964860 5:72080701-72080723 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
992255268 5:74914779-74914801 TAGGGGAAATTCTGTGAGGAGGG + Intergenic
992263329 5:74992407-74992429 AAGAGGAGACTCTGTGAAGATGG - Intergenic
993219702 5:85076405-85076427 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
993275901 5:85858223-85858245 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
993282751 5:85949131-85949153 GAGGGTAGAAGCTTGGAGGAGGG - Intergenic
994010615 5:94897821-94897843 GAGGGCAGAGTTTGGGAGGAGGG - Intronic
994218917 5:97172039-97172061 GAAGGTATGATCTGTGAGGAAGG - Intronic
994409210 5:99385005-99385027 GAGAGTAGAGTTTGGGAGGAGGG + Intergenic
994545438 5:101161314-101161336 GAGGGTGGAGTTTGAGAGGAAGG - Intergenic
994558465 5:101334617-101334639 GAGGGTGGAATGTGGGAGGAGGG + Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995633074 5:114155029-114155051 GAGGGTGGAGAGTGTGAGGAGGG - Intergenic
995653367 5:114396866-114396888 GAGGGTAGAGGGTGGGAGGAAGG - Intronic
996046523 5:118879802-118879824 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
996159692 5:120147178-120147200 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
996588747 5:125121488-125121510 GAGGGTAGAGGTTGGGAGGAGGG - Intergenic
997820356 5:137060448-137060470 GAGGGTTGAGTGTGGGAGGAGGG + Intronic
997835651 5:137191002-137191024 AAGGGTAGACACTGACAGGAAGG - Intronic
997927274 5:138042334-138042356 GAGGGAAGTCTTTTTGAGGAAGG + Intronic
998497521 5:142603513-142603535 AAGTGTACACTCTGAGAGGAAGG + Intronic
998595669 5:143527328-143527350 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
998720448 5:144940692-144940714 GTGGGGGGAGTCTGTGAGGAGGG + Intergenic
999071061 5:148744598-148744620 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
999556552 5:152749053-152749075 GAGTGTAGAGGCTGGGAGGAGGG + Intergenic
1001067232 5:168546046-168546068 GAGGGTGGAAGCTGGGAGGAGGG - Intergenic
1001206274 5:169766213-169766235 GAGGGTAGAGGGTGGGAGGAGGG - Intronic
1001263162 5:170250276-170250298 GAGGTTTGGCTCTGTGAGGATGG - Intronic
1001871527 5:175160072-175160094 GAACGTAGACTCTGCTAGGAGGG + Intergenic
1001898896 5:175406173-175406195 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1002323466 5:178389529-178389551 GTGGGCACCCTCTGTGAGGAGGG - Intronic
1002340225 5:178511603-178511625 GAGGTTAAACTCTGGAAGGAAGG + Intronic
1002421196 5:179149968-179149990 GTGGGTGGTCTCTGTGAGGTGGG + Intronic
1002821209 6:726673-726695 GAGGGTAGAGGGTGAGAGGAGGG + Intergenic
1002870119 6:1159470-1159492 AAGGGTAGAGGCTGGGAGGAGGG - Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1004902353 6:20206060-20206082 GAGGGTGGGCTTTGTGAAGAAGG - Intronic
1005191662 6:23230393-23230415 GAGGGTAGAGGTTGTGAAGAGGG + Intergenic
1005244915 6:23872648-23872670 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1005373347 6:25157478-25157500 GAGAGTTAAATCTGTGAGGAAGG - Intergenic
1005784110 6:29225058-29225080 GAAGGTAGAATCAATGAGGAAGG - Intergenic
1007470488 6:42087016-42087038 GAGGGAGGGCTCTGAGAGGAGGG - Intronic
1007504946 6:42328488-42328510 GAGGGTGGAGGCTGGGAGGAGGG - Intronic
1007810105 6:44479641-44479663 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1007849231 6:44788197-44788219 GAGGTGAGACTCTTTGTGGAGGG + Intergenic
1007973020 6:46072084-46072106 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1009330646 6:62415519-62415541 AAGGGTAGACGGTGAGAGGAGGG + Intergenic
1009423081 6:63485177-63485199 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1009609307 6:65919583-65919605 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1009734475 6:67659216-67659238 GAGGGTAGAGGGTGAGAGGAGGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010659025 6:78547313-78547335 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1012161874 6:95895355-95895377 GAGGGTAGACGGTGGGAGGTGGG - Intergenic
1013411737 6:109889394-109889416 GAGGGGAGGCTCTGGGAGGAGGG + Intergenic
1015481616 6:133717435-133717457 GAGGGTAGAGGATGGGAGGAGGG + Intergenic
1015622128 6:135142187-135142209 GATGGTAAGCTCTGGGAGGACGG + Intergenic
1015660915 6:135572371-135572393 GAGGCAATACTCTGTGAGGATGG + Intergenic
1016054025 6:139559708-139559730 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1017280768 6:152622410-152622432 GAGGGTGGAGGCTGGGAGGAGGG - Intronic
1018001451 6:159582018-159582040 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1019040218 6:169097835-169097857 GAGGAAAGACTCAGTGAGGACGG + Intergenic
1020015870 7:4831381-4831403 GAGGGTGGAGGCTGGGAGGAGGG + Intronic
1021327973 7:19297752-19297774 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1021364226 7:19756511-19756533 GAGGGTGGACGATGGGAGGAGGG - Intronic
1022083714 7:27046581-27046603 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1023502954 7:40870262-40870284 GATGCTGGACTATGTGAGGAAGG - Intergenic
1023822309 7:43986970-43986992 GAGGGGAGACCCTGTCTGGATGG + Intergenic
1024005574 7:45223022-45223044 GAGGATAGAGTCTGGGAGTAGGG - Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024298087 7:47862375-47862397 GAGGGGAGACTCAGGCAGGAGGG + Intronic
1024423322 7:49196199-49196221 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1025823733 7:64994457-64994479 GAGGGGAGGCTCTGGGAGGAGGG + Intronic
1026131650 7:67625975-67625997 GAGTTAAGACTCTGTAAGGATGG + Intergenic
1027346081 7:77261263-77261285 GAGGGTAGAGGATGGGAGGAGGG - Intronic
1028170326 7:87588324-87588346 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1028565757 7:92228733-92228755 GAGGGTGGAAGCTGGGAGGAGGG - Intronic
1028640377 7:93035751-93035773 GAGGGTAGAGGGTGAGAGGAAGG + Intergenic
1028696305 7:93717146-93717168 GAAGGGAGACTATGTGATGAAGG + Intronic
1028738487 7:94245642-94245664 GAGGGTAGATTCTATGATTAAGG + Intergenic
1028913400 7:96232441-96232463 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
1029750572 7:102540384-102540406 GAGGGGAGACCCTGTCTGGATGG + Intronic
1029768525 7:102639492-102639514 GAGGGGAGACCCTGTCTGGATGG + Intronic
1030399366 7:109028914-109028936 GAGGCAATACTCTGTGAAGATGG - Intergenic
1030733779 7:113019654-113019676 GAGGGTAGAGGCTGTGAGGAGGG - Intergenic
1030982772 7:116206273-116206295 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1031181956 7:118430720-118430742 GAGGGTAGAAGGTGAGAGGAAGG - Intergenic
1031663860 7:124460864-124460886 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1032129850 7:129218992-129219014 GAGGGCAGAGCCTGTGATGAGGG - Intergenic
1033989413 7:147265431-147265453 GAGGGCCCACTCAGTGAGGAGGG - Intronic
1034577499 7:152013191-152013213 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034577668 7:152015023-152015045 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1035245556 7:157560264-157560286 GCTGGTACACTCAGTGAGGACGG + Intronic
1035355222 7:158272639-158272661 GAGATTTGACTCTGTGAGGTTGG - Intronic
1035417036 7:158697935-158697957 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG + Intronic
1035559412 8:593603-593625 GAGGGGAGCCCCTGAGAGGAGGG + Intergenic
1037491766 8:19403004-19403026 GAGGGTGGACTGTGGGAGGAGGG + Intergenic
1038212934 8:25536639-25536661 GGTGGTAGTCTCTCTGAGGAGGG + Intergenic
1038357178 8:26840221-26840243 GAGGTTTGACTTTGAGAGGATGG + Intronic
1038482835 8:27913592-27913614 GAGGGTGGAGGCAGTGAGGAAGG - Intronic
1041399808 8:57430189-57430211 GAGGGTCCAATCTGTGAGTAGGG - Intergenic
1041419791 8:57653730-57653752 GAGGGTAGACACAGTGAAAATGG - Intergenic
1041738655 8:61136685-61136707 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
1041755173 8:61305699-61305721 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1042059407 8:64800413-64800435 GAGGGCAGAGTGGGTGAGGAGGG + Intergenic
1042630922 8:70815313-70815335 GAGGGTAGAGTGTGGGAGCAGGG - Intergenic
1042713645 8:71747084-71747106 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
1043267738 8:78287622-78287644 GAGGGTAGAGGGTGGGAGGATGG - Intergenic
1043289341 8:78577341-78577363 GAGGGTAGAGCGTGGGAGGAGGG + Intronic
1043541192 8:81264542-81264564 GAGGGTAGAGGTTGGGAGGAGGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044065410 8:87692960-87692982 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1044351264 8:91169252-91169274 GAGGGTAGAAAGTGGGAGGAGGG + Intronic
1044545957 8:93459672-93459694 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1046188902 8:110763491-110763513 GAGGGTAGAAAGTGGGAGGAGGG + Intergenic
1046282650 8:112053860-112053882 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1046814366 8:118568003-118568025 GAGTGTGAACTCTGTGAGGCAGG - Intronic
1047099252 8:121658054-121658076 GAGGGTAGAGGGTGAGAGGAGGG - Intergenic
1047398273 8:124523796-124523818 GAGGGAAGACAGTGTAAGGAAGG + Intronic
1048089671 8:131225433-131225455 GAGGGTGGAGGCTGGGAGGAAGG + Intergenic
1048214578 8:132482302-132482324 GAGGGGAGACCCTGTGAACAAGG + Intergenic
1048236580 8:132696888-132696910 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1048488764 8:134872239-134872261 GAATGTAGAATCTCTGAGGAGGG - Intergenic
1048538302 8:135318098-135318120 GAGAGCAGCCTGTGTGAGGAGGG - Intergenic
1048622372 8:136147927-136147949 GAGGTTATGCTCTGTGAAGATGG - Intergenic
1048775223 8:137938345-137938367 GAGTGTAGACTCAGTGGGGATGG - Intergenic
1049615780 8:143575335-143575357 GAGTGGAGACCCTGTGTGGACGG + Exonic
1049702253 8:144020624-144020646 GAGAGTATACTCAGGGAGGAGGG - Intronic
1050238379 9:3607779-3607801 GAGGGTGGAGTTTGGGAGGAGGG - Intergenic
1050333775 9:4571231-4571253 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1050786322 9:9406729-9406751 GAGGAAAGAGTCTGTGGGGAAGG + Intronic
1051183726 9:14437949-14437971 GAGGCAGGACTCTGGGAGGAGGG - Intergenic
1051267866 9:15326109-15326131 GAGGGTGGAGGCTGGGAGGATGG + Intergenic
1051494609 9:17705800-17705822 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1052626824 9:30986038-30986060 GAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1053025191 9:34723607-34723629 GAAGCTAGACTCTGTAAGGCTGG + Exonic
1053036720 9:34832670-34832692 GAAGCTAGACTCTGTAAGGCTGG + Intergenic
1054714570 9:68544611-68544633 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1055173043 9:73284276-73284298 GAAGGAAGACACTGTGTGGAGGG + Intergenic
1055673321 9:78629253-78629275 GAGAGTAGACTCTAAGAAGAGGG - Intergenic
1056497929 9:87178342-87178364 AAGGTTAGTCTCTGTCAGGATGG - Intergenic
1056580508 9:87885868-87885890 GAGTGTGCATTCTGTGAGGAAGG - Exonic
1056936678 9:90919972-90919994 GAGGGAAAACTATGTGGGGAAGG - Intergenic
1057004291 9:91543288-91543310 GAGGGTAGAGTGTGTGTGCAGGG - Intergenic
1057724193 9:97556663-97556685 TAATGTAGACTCTGTGAGGGTGG - Intronic
1058169794 9:101666489-101666511 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1058910162 9:109513500-109513522 GAGCTTGGACTCAGTGAGGAAGG - Intergenic
1059003327 9:110374144-110374166 GAGGGTAGAGGGTGGGAGGAAGG - Intronic
1059601634 9:115784999-115785021 GAGGGTAGAGGCTGGGAGGAGGG + Intergenic
1186135111 X:6511068-6511090 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1187053641 X:15718831-15718853 GAGGGTAGAGGGTGGGAGGAGGG + Intronic
1187124789 X:16445108-16445130 GAGGTAACCCTCTGTGAGGAGGG - Intergenic
1187586782 X:20671753-20671775 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1187600217 X:20820951-20820973 GAGGGTAGAGGCTGGGAGGAGGG + Intergenic
1187683869 X:21796862-21796884 GAGGGAAGTCTTTGTGATGATGG + Intergenic
1187756432 X:22532179-22532201 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188140960 X:26550435-26550457 GAGGGAAGAGTCTGGGAGGAGGG - Intergenic
1188289430 X:28369497-28369519 GATGGTGGACTGTGGGAGGAGGG - Intergenic
1188493768 X:30762147-30762169 GAGGGTGGAGGCTGGGAGGAGGG + Intergenic
1188828942 X:34872559-34872581 GAGGGTAGAGTGTGGGAGGAGGG + Intergenic
1188880318 X:35484418-35484440 GAGGGTGGAGTCTGGGAGGAGGG - Intergenic
1188908177 X:35813102-35813124 GAGGGACGATTTTGTGAGGAAGG + Intergenic
1188969130 X:36591682-36591704 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1189384342 X:40524961-40524983 GAGGTAAGATTCTGTGAGGGTGG - Intergenic
1189755932 X:44271306-44271328 GAGGGTAGCTTAGGTGAGGATGG + Intronic
1189855515 X:45220692-45220714 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1189898309 X:45679473-45679495 GAGGGTGGAATGTGGGAGGAGGG + Intergenic
1189938867 X:46099790-46099812 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1190447932 X:50549236-50549258 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1190498874 X:51055635-51055657 GAGGAAACACTCTGGGAGGATGG - Intergenic
1190642324 X:52492725-52492747 GAGGGTAGAGGCTGGGAGGAGGG - Intergenic
1190645349 X:52520142-52520164 GAGGGTAGAGGCTGGGAGGAGGG + Intronic
1191088102 X:56590825-56590847 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1191738371 X:64411044-64411066 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1191780518 X:64859258-64859280 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1191824105 X:65345542-65345564 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1191991052 X:67037410-67037432 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1192415079 X:70972552-70972574 GAGGGTAGAGGGTGAGAGGAAGG + Intergenic
1192595620 X:72405114-72405136 GAGGGTGGAGTATGGGAGGAGGG - Intronic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193165959 X:78280726-78280748 GAGGGTAGAGGCTGTGAGGAGGG - Intronic
1193523802 X:82563855-82563877 GAGGGTGGACGTTGTGAAGAGGG + Intergenic
1193722190 X:85000270-85000292 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1193857042 X:86615917-86615939 GAGGGTAGAGTGTGGGAGGAGGG - Intronic
1194022355 X:88707672-88707694 GAGGGTAGAAAGTGAGAGGAGGG - Intergenic
1194460473 X:94161097-94161119 GAGGGTAGAGACTGTGAGAAGGG - Intergenic
1194913300 X:99673661-99673683 GAGGGTAGGGAATGTGAGGAGGG + Intergenic
1195785046 X:108510153-108510175 GAGGGTGGAGGCTGGGAGGAGGG + Intronic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196641005 X:118060908-118060930 GAGGGAAGACCATGTGAAGATGG - Intronic
1197166553 X:123383850-123383872 GAGGGTGGAGGCTGAGAGGAGGG - Intronic
1197279351 X:124517148-124517170 GAGGGTGGAGGCTGGGAGGAGGG + Intronic
1197353595 X:125406334-125406356 GAGGGTAGAGGGTGAGAGGATGG - Intergenic
1197830856 X:130640752-130640774 GAGGGTAGGGACTGGGAGGAGGG + Intronic
1197837948 X:130715139-130715161 GTAGGTTGACTCTGAGAGGATGG + Intronic
1198383837 X:136108905-136108927 GAGGGTGGAGGCTGGGAGGAGGG - Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1198605334 X:138331296-138331318 GAGGGAATTCTCTTTGAGGATGG - Intergenic
1199338465 X:146647201-146647223 GAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1199640338 X:149854469-149854491 GAGGGTAGAGGGTGGGAGGAAGG + Intergenic
1199806316 X:151304433-151304455 GAGGGTAGCTACTGTGAAGAGGG - Intergenic
1199816159 X:151398339-151398361 GAGGGTGGAGGCTGGGAGGAGGG - Intronic
1199841374 X:151653018-151653040 GAGAATAGACTGTGGGAGGAAGG + Intronic
1199917239 X:152356734-152356756 GAGGGTAGAGTGTGGAAGGAGGG - Intronic
1200180969 X:154150500-154150522 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200186612 X:154187614-154187636 GAGGGGAGACTGTCTGAGGATGG + Intergenic
1200192264 X:154224752-154224774 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200198019 X:154262556-154262578 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200304183 X:155008147-155008169 GAGGCAGGTCTCTGTGAGGATGG + Intronic
1200336813 X:155359718-155359740 GAGGATAGAGGGTGTGAGGAGGG + Intergenic
1200349657 X:155481509-155481531 GAGGATAGAGGGTGTGAGGAGGG - Intergenic
1200383268 X:155862121-155862143 GAGGGTAGAGGGTGGGAGGAAGG - Intergenic
1201640328 Y:16170724-16170746 GAGGGAAGAGGCTGTGAGTATGG + Intergenic
1201662486 Y:16414601-16414623 GAGGGAAGAGGCTGTGAGTATGG - Intergenic