ID: 1077423724

View in Genome Browser
Species Human (GRCh38)
Location 11:2464775-2464797
Sequence TAGGTGGGCTGGGGCTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 818
Summary {0: 1, 1: 0, 2: 7, 3: 80, 4: 730}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077423724 Original CRISPR TAGGTGGGCTGGGGCTGAGG CGG Intronic
900178568 1:1301670-1301692 GAGGTGGGGAGGGGCTGGGGAGG - Intronic
900345966 1:2210435-2210457 TAGGAGGGCAGGGTCTGGGGTGG - Intronic
900392613 1:2440264-2440286 TGGGAGGGCTGGAGCTGGGGAGG + Intronic
900659268 1:3774703-3774725 TAGGAGGGCTGGGGCTTGGGGGG - Intronic
900731000 1:4259671-4259693 TGTGTGGGCTGGAGCTGAGTAGG + Intergenic
901219105 1:7572931-7572953 GGGCTGGGCTGGGGCTGAGAGGG - Intronic
901745449 1:11370098-11370120 TATGTGAGCTGGGGCAGAGGCGG + Intergenic
901935451 1:12623128-12623150 GGGTGGGGCTGGGGCTGAGGGGG + Intergenic
902365343 1:15969496-15969518 TAGGTGCACGGGGGCCGAGGGGG + Intronic
902398261 1:16144032-16144054 GCGGTAGGCGGGGGCTGAGGTGG - Intronic
902568933 1:17334037-17334059 GAGGTGGGCAGGGGATGAGACGG - Intronic
902839475 1:19066072-19066094 CAGGTGTGGTGGGGCAGAGGAGG + Intergenic
902885592 1:19402599-19402621 TAGCTGGGCAGGGACTGAGCAGG - Intronic
902887510 1:19416551-19416573 GAGGTGGGCTGAGGTTGAGGTGG - Intronic
902897389 1:19488366-19488388 GGGGTGGGGAGGGGCTGAGGTGG - Intergenic
903023614 1:20411535-20411557 GAGGTGGGATGTGGCTGAGTTGG + Intergenic
903133918 1:21296937-21296959 CAGGTGGGCAGGGGCTGGGGAGG + Intronic
903279393 1:22242000-22242022 TGTGTGGGCCAGGGCTGAGGAGG + Intergenic
903811283 1:26036305-26036327 TAGGTGGGCTGGGCGCGAGCAGG + Exonic
903855536 1:26336047-26336069 TGGGGGCGCTGGGGCAGAGGCGG - Intronic
903858496 1:26351297-26351319 CAGGTGGACAGGGGCTTAGGAGG - Intronic
903864539 1:26388713-26388735 AAGGTAGGCTGTGGCTGATGGGG - Intergenic
903891281 1:26572109-26572131 TACTGGGGCTGGGGCTGCGGTGG - Intronic
904263636 1:29305315-29305337 CAGGTGGGCAGGGGCTGAACTGG - Intronic
904279701 1:29410093-29410115 TGGCTGGGGTGGGGCTGGGGCGG + Intergenic
904411225 1:30326096-30326118 AGGGTGGGCGGGGGCTGAGCAGG - Intergenic
904558414 1:31380603-31380625 TGGGTGGGCTGGGGGTGACCAGG + Intergenic
904563331 1:31413149-31413171 TAGGTGGGGCGGGGCCGGGGCGG + Intronic
904831231 1:33307735-33307757 TGGGTGGGGTGGGGGTGGGGGGG - Intronic
904944391 1:34188728-34188750 GAGGAGGGCTGGGGGTGGGGAGG + Intronic
905522105 1:38608277-38608299 AAGGTTGGCTGGGGCTGACAGGG + Intergenic
905580941 1:39082131-39082153 GGGGTGGGCTGGGGCTTGGGCGG + Intronic
905593969 1:39189506-39189528 TATTTGGGTTGGGGTTGAGGAGG - Intronic
905795450 1:40813516-40813538 TGGGTAGGCTGGAGGTGAGGAGG + Intronic
906034387 1:42741351-42741373 GAGGGGGGTTGGGGCTGTGGGGG - Intergenic
906099652 1:43251064-43251086 TAGGTGGGCAGCTGCTTAGGAGG + Intronic
906153650 1:43601855-43601877 TGGGTGTGCCAGGGCTGAGGAGG - Intronic
906290204 1:44614768-44614790 GAGGGAGGCTGGGGGTGAGGTGG - Intronic
906460358 1:46031547-46031569 TGAGAGGGCTGTGGCTGAGGCGG - Exonic
906880300 1:49582395-49582417 AAGGTTGGCTGGGACTGGGGAGG - Intronic
907074865 1:51568958-51568980 TGGGTGGCGGGGGGCTGAGGCGG - Intergenic
907116285 1:51971144-51971166 TAGGTTTGCTGGTGGTGAGGGGG - Intronic
907281635 1:53350822-53350844 TGGGTGGGCCTGGGCTGCGGTGG - Intergenic
908115720 1:60938121-60938143 TATGTGGGGTGAGGCTGAGCTGG - Intronic
908271426 1:62426397-62426419 TAAGTGGGCGGGTGCTGAGGGGG - Intergenic
908420162 1:63951712-63951734 CATGTGGGCTGGTGGTGAGGGGG - Intronic
908476088 1:64490085-64490107 AAAGTGGGCAGGGGCTGAGATGG - Intronic
908954671 1:69608317-69608339 AAGGAGGGCTGTGGCAGAGGTGG - Intronic
909410881 1:75350084-75350106 TAGTTGGGCTGGAGTTGGGGGGG - Intronic
911857814 1:102903973-102903995 TAGGTACTCTGAGGCTGAGGTGG - Intronic
912301958 1:108526928-108526950 GCGGTGGGCTGGGGCGGGGGCGG - Intergenic
912547504 1:110461419-110461441 TGCTTGGGCAGGGGCTGAGGTGG + Intergenic
913117125 1:115707483-115707505 TTGCAGGGCTGGGGGTGAGGTGG + Intronic
914005567 1:143729659-143729681 TAGGAGGGCTGGGGGTGGGGGGG - Intergenic
914081129 1:144412463-144412485 TAGGAGGGCTGGGGGCGGGGGGG + Intergenic
914267714 1:146052323-146052345 TAGGAGGGCTGGGGGGGAGGGGG - Intergenic
914300945 1:146376695-146376717 TAGGAGGGCTGGGGGTGGGGGGG + Intergenic
915063942 1:153209337-153209359 GAGGTGGGCTGGCGCTGTGAGGG + Intergenic
915303746 1:154966280-154966302 GAGGCGGGCTGGGGCTAGGGTGG - Intronic
915520611 1:156440209-156440231 AAAATGGGCTGGGGCTAAGGTGG - Intergenic
915545101 1:156592481-156592503 TATGTGGGGAGGGGCTGTGGGGG + Intronic
915599981 1:156916020-156916042 CAGAGGGGCTGAGGCTGAGGGGG + Exonic
915831964 1:159139782-159139804 TGTGAGGGCTGGGGATGAGGTGG - Intronic
915911362 1:159917684-159917706 CAGGCGGGCTTGGGGTGAGGTGG - Intergenic
916694556 1:167221769-167221791 GAGGTGGCCTGGGGCGGCGGGGG + Intronic
917155808 1:171997364-171997386 TAGGTAGGTTGGGGCTGGGGTGG + Intronic
917645124 1:177022234-177022256 GTGGTGGGCTGGGGTAGAGGGGG + Intronic
918107529 1:181426988-181427010 GAGGTGGGAAGGGGCTGAGATGG - Intronic
918381444 1:183959714-183959736 AAGATGGGGTGGGGCAGAGGGGG - Intronic
919605885 1:199683356-199683378 TGGGGGAGCTGGGGCAGAGGTGG + Intergenic
919981861 1:202646851-202646873 TAAGTGAGGTGGGGCTGCGGAGG - Intronic
920504278 1:206505815-206505837 GAGGAGGGGTGGGGCAGAGGCGG + Intergenic
920691966 1:208154019-208154041 AAGGTGGGGTGGGGGTGGGGTGG + Intronic
921065091 1:211616971-211616993 GGGTCGGGCTGGGGCTGAGGAGG - Intergenic
921346517 1:214191366-214191388 CAGGTGGGCAGTGGATGAGGGGG + Intergenic
921416486 1:214893757-214893779 TGGGTGGGGTGGGGAGGAGGTGG + Intergenic
922675742 1:227547844-227547866 CACGTGGGCTGGGGCTGTGAGGG + Intergenic
922758422 1:228109436-228109458 TAGGTGGGCGGGGCCTGCGGGGG + Intergenic
922874241 1:228927431-228927453 GAGGTGGGGTGGGGGTGGGGTGG - Intergenic
922884238 1:229005825-229005847 CAGGAGGGTTGGGGGTGAGGGGG - Intergenic
923716974 1:236433422-236433444 CAGCTGCTCTGGGGCTGAGGCGG - Intronic
923744363 1:236686646-236686668 TCGGTTGGCCGGGGCTGCGGCGG - Exonic
924946636 1:248851006-248851028 TTGGCGGGCAGGGGCTGGGGTGG - Intronic
1062822875 10:548132-548154 TAGGTGCACTGGGGCAGAGGTGG - Intronic
1062858905 10:794607-794629 GAGGTGGGGTGGGGAGGAGGGGG - Intergenic
1063105739 10:2989989-2990011 AAAGTAGGCTGGTGCTGAGGAGG + Intergenic
1063455773 10:6181891-6181913 GAGGTGGCCAGGGGCTGGGGAGG + Intronic
1063580309 10:7300543-7300565 TGGGTGGGCAGGGGTTGAGGAGG - Intronic
1063714432 10:8513568-8513590 CAGGTGGGCTGAGCCTCAGGTGG + Intergenic
1064250798 10:13704959-13704981 TCGGGAGGCTGAGGCTGAGGTGG + Intronic
1064299853 10:14113933-14113955 AGGATGGGCTGGGGGTGAGGTGG - Intronic
1064708236 10:18095117-18095139 TAGATGGGCTGGTGAGGAGGTGG - Intergenic
1064982025 10:21174371-21174393 CAGGTGGGCGGCGGCTGGGGAGG + Intergenic
1065255325 10:23861000-23861022 TAGGTTCGCTGGAGCTCAGGAGG - Intronic
1065317996 10:24483347-24483369 AAGGTGGGCAGGGACTGAGTGGG - Intronic
1065607047 10:27428791-27428813 AGGGTGGGCTGGGGCAGAGAAGG - Intergenic
1067019368 10:42781786-42781808 TAGCTGGGCTGGGGATTAGATGG + Intergenic
1067036619 10:42925691-42925713 GAGGTGGGCTGGTGGGGAGGGGG - Intergenic
1067044416 10:42976281-42976303 CAGAGGAGCTGGGGCTGAGGGGG - Intergenic
1067484530 10:46635475-46635497 TGGTTGGGCCGGGGCTGAGGAGG - Intergenic
1067499035 10:46785838-46785860 TAGCTGGGCTGGGGATTAGATGG + Intergenic
1067595607 10:47554535-47554557 TAGCTGGGCTGGGGATTAGATGG - Intergenic
1067610229 10:47706172-47706194 TGGTTGGGCCGGGGCTGAGGAGG + Intergenic
1067660803 10:48235058-48235080 GAGGTGGGACTGGGCTGAGGAGG + Intronic
1069780842 10:70954411-70954433 TTGGTGGGCTGAAGATGAGGAGG - Intergenic
1069900742 10:71705376-71705398 TAGGAGGGGTGGGGTTGATGGGG - Intronic
1070282191 10:75058078-75058100 GAGGTGGGCTGGGGCTGGCACGG - Intronic
1070799711 10:79238076-79238098 TCGGTAGCCTGGGGCTGAGCAGG + Intronic
1071289262 10:84176822-84176844 TAGGTGGGAGGTGTCTGAGGAGG + Intronic
1071430284 10:85601700-85601722 TGGGTAGCCTGGGGCTGAGGAGG - Exonic
1071502838 10:86215686-86215708 GGGCTGGCCTGGGGCTGAGGAGG - Intronic
1071523685 10:86346221-86346243 AAGGTGGGCTGGGGCGGAGACGG - Intronic
1072100016 10:92220482-92220504 TGGGTGGGATGGGGGTGGGGTGG - Intronic
1072578120 10:96718844-96718866 TAGGTGGGCTGTGGGGGAGAGGG - Intronic
1072673195 10:97446479-97446501 AAGGTGCGCTCGGGCTGAGGAGG - Intronic
1072715965 10:97752895-97752917 TGGGTGGGCAGGGGCTGGGCTGG + Intronic
1073384788 10:103116679-103116701 TGGGGAGGCTGAGGCTGAGGAGG - Intronic
1074827299 10:117223763-117223785 TAGGTGGGGTGGACCTGAAGAGG - Intergenic
1075088035 10:119426542-119426564 ATTGTGGGCTTGGGCTGAGGAGG + Intronic
1075154361 10:119962106-119962128 CAGGTGAGCTGGGGGTGAGAAGG - Intergenic
1075686036 10:124365757-124365779 TAAGTGGTCAGGGGATGAGGAGG - Intergenic
1075899182 10:126025180-126025202 GAACTGGGCTGGGGCTGAGATGG + Intronic
1076280879 10:129244714-129244736 AGGGTGGGGTGGGGCTGAGCTGG - Intergenic
1076528504 10:131127861-131127883 TATGTGGGCTGGGACCGTGGTGG - Intronic
1076839830 10:133040560-133040582 CAGGGGGGCTGAGGGTGAGGTGG + Intergenic
1076902461 10:133346656-133346678 CAGGTGGGCTGGGGCTGGATGGG + Intronic
1077023440 11:429831-429853 TAGGTGGGCCGGAGAGGAGGTGG + Intronic
1077096399 11:800914-800936 TGGGAGAGCTGGGGGTGAGGAGG + Intronic
1077186678 11:1238597-1238619 TAGGTGGGCAGGTGCATAGGTGG + Intronic
1077264344 11:1641719-1641741 GAGGTGGTCTGGGGTGGAGGTGG - Intergenic
1077264523 11:1642253-1642275 GAGGTGGTCTGGGGTGGAGGTGG - Intergenic
1077264546 11:1642315-1642337 GAGGTGGTCTGGGGTGGAGGTGG - Intergenic
1077284398 11:1759309-1759331 CAGCAGGGCTGGGGCTGGGGTGG - Intronic
1077360941 11:2139829-2139851 CAGGTGGCTTGGGGCTGAGTCGG + Intronic
1077419723 11:2444706-2444728 CAGGTGGGCTCGGGCGGGGGTGG + Intronic
1077423724 11:2464775-2464797 TAGGTGGGCTGGGGCTGAGGCGG + Intronic
1077881633 11:6354958-6354980 TATGTGGGCTGGGGCTGGAGTGG - Intergenic
1078932249 11:15921518-15921540 CAGGTGGGGTGAGGCTGATGGGG + Intergenic
1079457708 11:20651251-20651273 TAGGAGGGGTGGGGGAGAGGAGG - Intronic
1079917493 11:26387844-26387866 AAGCTGGGGAGGGGCTGAGGTGG - Intronic
1080435332 11:32235749-32235771 TGGGTGGGATAGGGGTGAGGAGG - Intergenic
1081291462 11:41330682-41330704 TTGGAAGGCTGAGGCTGAGGTGG - Intronic
1081583167 11:44366204-44366226 TAGATTCGCTGGGGCTGGGGTGG - Intergenic
1081775032 11:45670889-45670911 TTTGTGGGCAGGGGCAGAGGAGG - Intergenic
1082085691 11:48047826-48047848 GGGGTGGGGTGGGGCTGACGTGG + Intronic
1082808052 11:57462347-57462369 TGAGGGGGCAGGGGCTGAGGAGG - Intronic
1083157347 11:60832288-60832310 GAGGTAGGCTGGTGCTGGGGAGG + Intergenic
1083158776 11:60842002-60842024 GAGGGGGGCTGTTGCTGAGGCGG - Intergenic
1083198515 11:61105199-61105221 CAGGCAGGCTGGGGCTGAGAGGG - Intronic
1083262172 11:61529088-61529110 TCAGTGGTCTGGGGCTCAGGCGG - Intronic
1083445738 11:62707043-62707065 TAGGTGGGCTGGCGTGAAGGGGG - Intronic
1083635462 11:64118314-64118336 CAGGGCAGCTGGGGCTGAGGCGG - Exonic
1083879195 11:65539930-65539952 CAGGTGGGGTGGGGCGGAGGCGG - Intronic
1084106599 11:66984701-66984723 TTGGTGGGGAGGGACTGAGGGGG - Intergenic
1084117817 11:67052212-67052234 CAGGTGGGGTTGGGCTGTGGAGG + Intergenic
1084275516 11:68049292-68049314 CAGGTGGGCTGCGGCTGGTGGGG + Exonic
1084332693 11:68439247-68439269 AAGGTGGCCTGGAGCTGTGGGGG - Intronic
1084670026 11:70600539-70600561 TGGGTGGGTTGGGGGTGAAGGGG + Intronic
1085024402 11:73228177-73228199 TACGTGGGGTGGGGGTGGGGGGG + Intronic
1085693735 11:78686538-78686560 TAGATGGGGTGGGGTTGGGGGGG + Intronic
1085719842 11:78903233-78903255 TAGGGAGGGTGAGGCTGAGGAGG - Intronic
1086610092 11:88745311-88745333 TTGGGAGGCTGAGGCTGAGGTGG - Intronic
1087139572 11:94752258-94752280 GAGGTGAGTGGGGGCTGAGGAGG - Intronic
1087241867 11:95789663-95789685 TGGGTGGGCTGGGGCGGAAGTGG - Exonic
1087444019 11:98223595-98223617 AAAGTGGGCGTGGGCTGAGGCGG - Intergenic
1088260774 11:107941849-107941871 TTGGGAGGCTGAGGCTGAGGCGG + Intronic
1088585618 11:111357806-111357828 TAGGTCGCCAGGGGCTGATGGGG + Exonic
1088843403 11:113645060-113645082 TGGGTGTGCTGGGAGTGAGGTGG + Intergenic
1088879536 11:113962749-113962771 AAGGTGGGATGGGGCAGATGAGG + Intergenic
1089352009 11:117826920-117826942 TGGGGTGGCTGGGGATGAGGTGG + Intronic
1089401388 11:118166559-118166581 TGGGTGGGCAGGGGTAGAGGAGG - Exonic
1089495987 11:118908936-118908958 TGGGTGTTTTGGGGCTGAGGTGG - Intronic
1089677575 11:120100094-120100116 TGGGTGGGGTGGGGGAGAGGAGG - Intergenic
1090257095 11:125292443-125292465 TGGGTGGGGTGGGAGTGAGGGGG + Intronic
1090432480 11:126657597-126657619 TAGATGGGTTGGGGGTGAGGTGG + Intronic
1090541409 11:127710563-127710585 TAGTTGGGCCAGGGCTGAAGGGG - Intergenic
1091161572 11:133426574-133426596 TCGGGGGCCTGGGGCAGAGGAGG - Intronic
1091251572 11:134148415-134148437 TAGCTGGGGTAGGCCTGAGGGGG + Intronic
1091793797 12:3286120-3286142 TGGGTGGGCAGGGGCTGGAGAGG - Exonic
1091875759 12:3931692-3931714 GGGGTGGGCTGGGGGTGGGGGGG - Intergenic
1092170376 12:6370539-6370561 CAGGTGGGATGGGGCCTAGGCGG - Intronic
1092409552 12:8243115-8243137 TAGGAGGGCGGGGCCTGGGGTGG + Intergenic
1092912943 12:13164357-13164379 CAGCTGGGCTGGGCCAGAGGTGG - Intergenic
1093680724 12:21999194-21999216 GAGGTGGGGTGGGGGTGAGCTGG - Intergenic
1095676154 12:44921055-44921077 TAGCTGGTAGGGGGCTGAGGAGG + Intronic
1095792836 12:46185907-46185929 TAGGTGGGATGTGGCTGGGATGG + Intronic
1095978184 12:47954099-47954121 TGGGTGGGCCTGGGCAGAGGGGG - Intergenic
1096378996 12:51139482-51139504 TTGGGAGGCTGAGGCTGAGGTGG - Intronic
1097195913 12:57242469-57242491 CAGCTGGGCTGGGGAAGAGGAGG - Intergenic
1098733483 12:74067044-74067066 GAGCTGGGCTGAGGCTGAGGTGG + Intergenic
1099195873 12:79615291-79615313 TAGGTGAGCTGGGGTTTTGGGGG - Intronic
1099369598 12:81812780-81812802 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
1100871643 12:98915943-98915965 ATGGTGGGCTGAGGTTGAGGGGG + Intronic
1101370747 12:104127787-104127809 TAGGGGGCTGGGGGCTGAGGTGG - Intronic
1101916246 12:108898195-108898217 GAGGTGGTCTGGTGCTGATGAGG + Intronic
1101918910 12:108916854-108916876 TACTCGGGGTGGGGCTGAGGTGG - Intronic
1101998334 12:109540939-109540961 GCGGTGGGCGGGAGCTGAGGTGG + Intergenic
1102795654 12:115687065-115687087 TAGGGGGGCTGGGGGTGTGGGGG - Intergenic
1102929017 12:116848570-116848592 TAGCTGGGCTGGGGTTGTTGGGG - Intronic
1103587299 12:121965930-121965952 TTGGTGGCCTGAGGCTAAGGTGG - Intronic
1104858223 12:131911820-131911842 TCGGGGCGCTGGGGCTGAGAAGG - Intronic
1104874116 12:132021228-132021250 GAGGGGGCCTGGGGCTGGGGCGG - Exonic
1105700759 13:22934630-22934652 CAGGTGTGCAGGGGCTGAGCTGG - Intergenic
1105758562 13:23492374-23492396 GAGGTGGGAGGAGGCTGAGGTGG + Intergenic
1105817727 13:24051904-24051926 GGGGTGGGCCGGGGCTGAGGAGG - Intronic
1105930485 13:25047489-25047511 TGGGAGGGCCGGGGCTGAGCCGG + Intergenic
1106296966 13:28423184-28423206 TGGGTTGGCTGAGGCTGGGGTGG - Intronic
1106563071 13:30863301-30863323 TGGCTGGGGTGGGGCTGTGGAGG - Intergenic
1106606556 13:31234492-31234514 TAGCTAGGTTGAGGCTGAGGTGG + Intronic
1107132943 13:36915685-36915707 AATGTGGGCTGGGAATGAGGGGG + Intronic
1107707641 13:43123164-43123186 TAGGGGGGCTGGAGCAGAGTGGG - Intergenic
1108070893 13:46627600-46627622 TAGGTGGACCAGGGCTGAGAGGG - Intronic
1108470901 13:50766019-50766041 TAGGAGGGTTGGGGGTGGGGTGG + Intronic
1109143910 13:58752247-58752269 TAAGTGGGCTGAGGCTGATGTGG + Intergenic
1109593719 13:64522541-64522563 CAGGTGGGCTGGGGCCGAGCTGG - Intergenic
1110734074 13:78913924-78913946 TGGGTGGGATGGGGCAGAGCTGG - Intergenic
1112346085 13:98591045-98591067 TATGTGGGCTGGGGATGTGGTGG + Intergenic
1112370348 13:98788161-98788183 CAGGTGTGCAGGGGCTGAAGAGG - Intergenic
1113403962 13:110021178-110021200 TAGGAGCGCTGGGGGTGTGGGGG - Intergenic
1113759997 13:112840456-112840478 TAGGGAGGCTGAGGCTGGGGGGG - Intronic
1113760018 13:112840521-112840543 TAGGGAGGCTGAGGCTGGGGGGG - Intronic
1113982233 13:114285898-114285920 TATTTGGGATGGGGCTGGGGAGG + Intronic
1114050370 14:18916166-18916188 AAGGTGGGCTGCGGCCGGGGTGG - Intergenic
1114112188 14:19485766-19485788 AAGGTGGGCTGCGGCCGGGGTGG + Intergenic
1114414533 14:22532286-22532308 TAGGTGATCTGAGGCTGAGCAGG - Intergenic
1114636193 14:24188324-24188346 GAGGTGGGCTGGGCCTGGGGTGG - Exonic
1114739475 14:25080614-25080636 TAGGTGGGCTGGGGTAGGGGTGG - Intergenic
1115650471 14:35399234-35399256 TAAGGAGGCTGGGGATGAGGGGG + Intergenic
1116595675 14:46841324-46841346 AAGGTGGGATGGGGATAAGGTGG + Exonic
1118719085 14:68580921-68580943 AAGGGCGGCTGGGGCTCAGGAGG + Intronic
1119311678 14:73652146-73652168 GAACTGGGCAGGGGCTGAGGCGG - Intronic
1119650267 14:76378015-76378037 TAGCTGGGGTGGGGATGGGGTGG + Intronic
1119933028 14:78566466-78566488 TAAGTGTGCTGGGGCTGGGTGGG + Intronic
1121310360 14:92932401-92932423 TGGGAAGCCTGGGGCTGAGGAGG + Exonic
1121600317 14:95198527-95198549 AAGGTGGGCTGGGGATCAGTGGG + Intronic
1121659066 14:95621120-95621142 TAGGTGGGGAGAGGATGAGGAGG + Intergenic
1121724054 14:96133285-96133307 TGGGTGGGTTGGTGGTGAGGGGG - Intergenic
1121787474 14:96673319-96673341 GAGGTGGGCTGTGGCTGGTGAGG + Intergenic
1122052081 14:99067279-99067301 GAGCTGGGCTGGGTCTGAGCTGG - Intergenic
1122401638 14:101470865-101470887 GAGAGGGGCAGGGGCTGAGGTGG - Intergenic
1122501499 14:102203082-102203104 AAGGTGGGGTGGGGGTGATGAGG - Intronic
1122562824 14:102629001-102629023 TACTTGGGGAGGGGCTGAGGTGG - Intronic
1122739920 14:103866329-103866351 CAGCTGGGCGGGGGCTGCGGGGG + Intergenic
1122864389 14:104596952-104596974 GAGGTGGGCGGAGGCCGAGGCGG + Intronic
1123825589 15:24078734-24078756 TGGGTGGGCGGGGGCTCAGCAGG - Intergenic
1124030773 15:26009291-26009313 TCGGTGGGAGGTGGCTGAGGTGG - Intergenic
1125499776 15:40232358-40232380 CTGGTGGGCTGGGGCTGAGATGG + Intergenic
1125722521 15:41852105-41852127 CAGTGGGGCTGGGGCTGTGGGGG - Intronic
1125731210 15:41893715-41893737 AAGGTGGGGTGGGGCAAAGGGGG - Intronic
1126668353 15:51094495-51094517 CGGGTGGGCTGGGGCTGGGGAGG - Intronic
1128214413 15:65924358-65924380 TAGGTGGGGTGTGGGTGGGGGGG + Intronic
1128252951 15:66176403-66176425 TAGGGAGGCTGGGGTGGAGGGGG + Intronic
1128317617 15:66671128-66671150 GAGGAGGGGTGGGGCAGAGGGGG - Intronic
1128554690 15:68623476-68623498 GGGGTGGGGTGGGGGTGAGGAGG - Intronic
1128633571 15:69288600-69288622 CAGGTGGGCCAGGGCTCAGGGGG - Intergenic
1129007429 15:72385598-72385620 TAGATGGAATAGGGCTGAGGTGG - Intergenic
1129173301 15:73821227-73821249 TGTGTGGGCTGGAGCTGTGGAGG + Intergenic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1129718396 15:77864885-77864907 AGGGAGGGCTGAGGCTGAGGTGG - Intergenic
1129901091 15:79149901-79149923 TAGGTGGGGTGGGGTGGTGGGGG + Intergenic
1129923441 15:79340400-79340422 GATGCTGGCTGGGGCTGAGGAGG - Intronic
1130065909 15:80604877-80604899 AATGTGGCCTGGGGCTGATGAGG + Intergenic
1130069398 15:80633932-80633954 TTTGTGGGCTGAGGCTCAGGTGG - Intergenic
1130322144 15:82850339-82850361 AGGCTGGCCTGGGGCTGAGGAGG - Intronic
1130460527 15:84155980-84156002 AGGGAGGGCTGAGGCTGAGGTGG + Intergenic
1130910815 15:88269748-88269770 GTGATGGGCTGGGGCTGAGGGGG - Intergenic
1131321721 15:91399977-91399999 TGGGTGGCCTGGTGCTGAGATGG + Intergenic
1131448399 15:92518683-92518705 TAGGTGGGCAGGGGCTCAGCTGG + Intergenic
1131512876 15:93059106-93059128 TGGAAGGGCTGGGGCTGAGATGG + Intronic
1132117936 15:99151236-99151258 TGGGTGGCCTGGGGTGGAGGTGG - Intronic
1132514576 16:360181-360203 CAGGTGGGCGGGGGCGCAGGTGG - Intergenic
1132597826 16:761372-761394 GAGCTGGGCTGGGGCCGTGGAGG - Intronic
1132614698 16:834715-834737 CCTGTGGGCTGGGGTTGAGGGGG + Intergenic
1132649543 16:1014277-1014299 TGGCGGGGCTGGGGCTGGGGTGG + Intergenic
1132732897 16:1371626-1371648 TGGGTGGGCTGTGGATGATGGGG - Intronic
1132829266 16:1919493-1919515 CAGGAAGGCTGGGGCAGAGGTGG - Intergenic
1132835518 16:1951047-1951069 TTGGTGGGCTGGGGGTGAGGTGG - Intronic
1132929056 16:2449397-2449419 CAGGCGGGCTGGGGCGTAGGCGG - Exonic
1133041061 16:3059877-3059899 TGGGTGGCCTGGGGAGGAGGAGG - Exonic
1133069371 16:3235527-3235549 TGGGTGGGCGGGGGGTGGGGCGG - Intronic
1133156462 16:3880166-3880188 GAGGCGGGCAGGGGATGAGGGGG - Exonic
1133464838 16:6019477-6019499 CTGGGGGGCTGGGGCGGAGGGGG - Intronic
1133716182 16:8451448-8451470 TAGGTGCGCTGGAGCAGAGTGGG + Intergenic
1133730958 16:8578123-8578145 TAGGTGGGCAGTGGCGGTGGGGG + Intronic
1134017806 16:10901569-10901591 CAGGTGGGCTGGGGTTGGGAAGG + Intronic
1134106995 16:11492409-11492431 CAGGTGGACAGGGGCTGAGTTGG - Intronic
1134168096 16:11946458-11946480 TAAGGAGGCTGAGGCTGAGGTGG + Intronic
1135240460 16:20802506-20802528 TTGGGAGGCTGAGGCTGAGGTGG - Intronic
1136066482 16:27762244-27762266 TAGTTGGCATGGGGCAGAGGCGG - Intronic
1136280689 16:29208694-29208716 TGGGTAGGCTGAGGCAGAGGAGG - Intergenic
1136399805 16:30011090-30011112 GAGGGGCGCTGGGGCTGGGGAGG + Intronic
1136491196 16:30609709-30609731 GAGGTGGGCAGGGGCTTAGCAGG - Intronic
1136496239 16:30646576-30646598 TTGGTGGGGTGGGGGGGAGGTGG + Intergenic
1136810818 16:33174978-33175000 GAGGTGAGCAGGGGCTCAGGGGG - Intergenic
1136817294 16:33285058-33285080 GAGGTGAGCAGGGGCTCAGGGGG - Intronic
1136823857 16:33341587-33341609 GAGGTGAGCAGGGGCTCAGGGGG - Intergenic
1137993102 16:53180111-53180133 TCGGGAGGCTGAGGCTGAGGTGG - Intronic
1138230651 16:55333243-55333265 TGGGTGTGCTGGGGGTGGGGGGG - Intergenic
1138270940 16:55695416-55695438 TCAGTGGGCTGGGGCCCAGGTGG - Intronic
1138271723 16:55700334-55700356 AGGGTGGGAGGGGGCTGAGGGGG + Intronic
1138349760 16:56340240-56340262 TTGGTGGGCTGGAGCGGGGGAGG - Intronic
1138350870 16:56345599-56345621 GAGGTGGACTTGGGCTGATGGGG - Exonic
1138406839 16:56802299-56802321 AAGGTGGGGTGGGGGTGGGGGGG - Intronic
1138578482 16:57923916-57923938 TAGGGAGCCTGGGGCTCAGGAGG - Intronic
1138594543 16:58022798-58022820 TGGGCAGGCTGGGCCTGAGGAGG + Intergenic
1139494347 16:67305508-67305530 GAGGTGGGCTGAGGCTGGAGTGG + Intronic
1140108791 16:71985529-71985551 TGGCGGGGCAGGGGCTGAGGTGG - Intronic
1140477461 16:75246073-75246095 AAGGTGGGAGGTGGCTGAGGTGG - Intronic
1140564916 16:76030764-76030786 ATGGTGGGATGGGGCTGAGATGG + Intergenic
1140912755 16:79468600-79468622 AGGGTGAGCTGGGGCTGAGCAGG - Intergenic
1140931716 16:79634094-79634116 TAGGTTGGCTGGGTCAGGGGAGG + Intergenic
1141475527 16:84270609-84270631 TGGGTTGGCTGGGGCTCAGCTGG + Intergenic
1141518908 16:84564585-84564607 GGGGCGGGCTGGGGCTGGGGAGG + Intergenic
1141620685 16:85235343-85235365 GAGGTGGGAGGGGGGTGAGGGGG - Intergenic
1141768946 16:86077103-86077125 AGGCTGGGCTGGGTCTGAGGGGG + Intergenic
1141780040 16:86153145-86153167 CAGGTGGTCTGGGGCTGCGCTGG + Intergenic
1141788755 16:86218756-86218778 GGGGTGGGGTGGGGCTGAAGAGG - Intergenic
1142085048 16:88174630-88174652 TGGGTAGGCTGAGGCAGAGGAGG - Intergenic
1142549927 17:732388-732410 CGGGTGGGCGGGGGCGGAGGCGG - Intergenic
1142715509 17:1745078-1745100 AAGGTGGGGTGGGGTGGAGGGGG + Intronic
1143604885 17:7977300-7977322 AAGGTGGGCTGGCGCTGGAGGGG - Intergenic
1143764145 17:9126700-9126722 TAGGAGGGCTGTGGCTAAAGAGG + Intronic
1144422342 17:15109901-15109923 GAGGTGGGATTAGGCTGAGGGGG - Intergenic
1144726558 17:17505302-17505324 TGGGTGTGCTGGGGCAGGGGTGG + Intergenic
1144771779 17:17763471-17763493 GAGCTGTGCTGGGGCAGAGGGGG + Intronic
1144847348 17:18226751-18226773 GAGGGAGGCGGGGGCTGAGGCGG - Intronic
1146550628 17:33777497-33777519 TTGGTGGGCTGGGAGGGAGGTGG - Intronic
1146846301 17:36183661-36183683 CAGCTGGGCTGGGGCTGGTGGGG - Intronic
1146937094 17:36818680-36818702 GGGGTGGGCTGGGGCTGGGCTGG + Intergenic
1147026270 17:37587257-37587279 TAGCTACTCTGGGGCTGAGGCGG - Intronic
1147156939 17:38548749-38548771 GAGGTGAGCTGGTGCTGAAGTGG - Intronic
1147302433 17:39540728-39540750 TAATTGGGCTGGGACTGGGGCGG + Intronic
1147422130 17:40327107-40327129 GTGGTGGGCTGGGGGTGAGGTGG + Intronic
1147550828 17:41440389-41440411 TGGGTGTGCTGGGTCTGAGATGG - Intronic
1147554216 17:41466061-41466083 TCGGGGGGCTGGAGCTGGGGAGG - Intronic
1147602305 17:41754198-41754220 GAGGTGGGCAGGAGCTGGGGTGG + Intergenic
1147715784 17:42507319-42507341 AGGTTGGGCTGGGGCTGGGGAGG + Intronic
1148188415 17:45661381-45661403 AAGGTGGAGTGGGGCTGAGTAGG + Intergenic
1148339861 17:46866971-46866993 TAGGAGGCCTGGGGGTGAGGAGG - Intronic
1148568463 17:48647480-48647502 TCGCTGGGCTGCGGCTGGGGCGG - Intergenic
1148857154 17:50585005-50585027 TACCTGGGCTGGGGCTGGGCAGG + Intronic
1149582664 17:57762172-57762194 TAGGGGGGCTGGGGGTGGAGTGG - Intergenic
1149638268 17:58187005-58187027 TGGGTGGGGTGGGGCAGGGGTGG - Intergenic
1149849651 17:60027074-60027096 CAGCTGGGCTGGGGCTGGTGGGG - Intergenic
1149860517 17:60119450-60119472 CAGCTGGGCTGGGGCTGGTGGGG + Intergenic
1150126735 17:62640947-62640969 TTGGGAGGCTGAGGCTGAGGCGG - Intronic
1150149538 17:62797933-62797955 CTGGTGGGATGGGGATGAGGAGG + Intronic
1150313248 17:64146567-64146589 TAGGGGGGCGGTGGCTGACGGGG + Intergenic
1150423094 17:65056253-65056275 CAGGGGGGCTGGGGCGGCGGCGG - Intronic
1150765014 17:67995723-67995745 TGGGTGAGCAGGGGCTGCGGGGG - Intergenic
1151177121 17:72297832-72297854 TAGGTGGTGTGGGGATGACGAGG + Intergenic
1151824635 17:76517514-76517536 TAGGAGGGGTGGGGGTGGGGGGG - Intergenic
1151878606 17:76881330-76881352 CAGGTTCCCTGGGGCTGAGGCGG - Intronic
1151925725 17:77194865-77194887 CAGGTGCGCTGGGGCTGCTGAGG - Exonic
1152231174 17:79114804-79114826 TAGGCCGGCTGGGGCTCTGGGGG + Intronic
1152514336 17:80814026-80814048 TTGGGAGGCTGAGGCTGAGGTGG + Intronic
1152581281 17:81166467-81166489 ACGGCGGCCTGGGGCTGAGGGGG + Intergenic
1152710508 17:81868688-81868710 TGGGTGGGGGAGGGCTGAGGAGG + Exonic
1153781483 18:8498962-8498984 TGGGTGGGCTGAGGAGGAGGAGG + Intergenic
1154201269 18:12302347-12302369 GAGGTGGGGTGGGGATGATGTGG - Intergenic
1155041067 18:22066075-22066097 TAGGTGGGGTGGGGTGGAGGAGG - Intergenic
1157113025 18:44838825-44838847 AGTGTGGGGTGGGGCTGAGGGGG - Intronic
1157456764 18:47837808-47837830 TTGGTGGGCAGGGGCTTGGGAGG + Exonic
1158010373 18:52721102-52721124 GAGGTGGGCTGGGGCAGAGAAGG + Intronic
1158603741 18:58876814-58876836 TCGGGAGGCTGAGGCTGAGGTGG + Intronic
1159902426 18:74060163-74060185 AAGGTGGCCCGGAGCTGAGGAGG - Intergenic
1160217390 18:76944502-76944524 AAGGTTGGCTGGGGGTGTGGTGG + Intronic
1160385286 18:78493048-78493070 AAGGGGGACTGTGGCTGAGGAGG + Intergenic
1160699086 19:497618-497640 TCGGGGGACTGGGGCAGAGGCGG + Intronic
1160710747 19:549925-549947 GAGGTGGGCTGGGACTCAGGCGG - Intergenic
1160772501 19:839268-839290 TCAGGGGGCTGGGGCAGAGGGGG + Intergenic
1160989282 19:1853975-1853997 TCGGTGGGGTGGGGGTGGGGTGG + Exonic
1161043070 19:2120408-2120430 CAGGCAGGCTGGGGCTGAGCAGG + Intronic
1161257352 19:3316686-3316708 AAGGGTGGCTGGGGCTGATGTGG + Intergenic
1161401407 19:4067415-4067437 GGGGTGGGTTGGGGGTGAGGCGG + Intergenic
1161453063 19:4357423-4357445 TACGCGGGATGGGGCTGTGGGGG + Intronic
1161591613 19:5131581-5131603 CAGGTGGGGTGGGGCAGGGGAGG + Intronic
1161609262 19:5231814-5231836 CAGGTGGGATGGGGCTGGGAGGG + Intronic
1161759071 19:6157448-6157470 TGGGGAGGCTGAGGCTGAGGTGG + Intronic
1161800703 19:6415581-6415603 CCGGTGGGTGGGGGCTGAGGGGG + Exonic
1162131065 19:8526560-8526582 AAGGAGGGCTGGGGCGGTGGCGG - Exonic
1162319648 19:9963638-9963660 TTGGGAGGCTGAGGCTGAGGTGG - Intronic
1162534610 19:11255418-11255440 TTGGGAGGCTGAGGCTGAGGTGG - Intronic
1163018618 19:14471433-14471455 TGGGGGGACTGGGGCTCAGGAGG - Intronic
1163489165 19:17606801-17606823 GGGGTGGGCTGGGGGTGTGGGGG - Intronic
1163548617 19:17952914-17952936 CAGCTGGGCTGGGGCAGAGCAGG + Intronic
1164452814 19:28381338-28381360 TAGGAGGCCTGGGCCTGAGCTGG + Intergenic
1164532249 19:29057487-29057509 TGGCTGGGGTGGGGTTGAGGGGG - Intergenic
1165330416 19:35138757-35138779 TGGGTGGGGTGGGGCTGGGAGGG + Intronic
1165343305 19:35227539-35227561 CAGGTGGACTGGGGGAGAGGAGG + Intronic
1165561281 19:36682168-36682190 TTGGGGAGCTGAGGCTGAGGTGG + Intergenic
1165810280 19:38607808-38607830 TAGGAAGGTGGGGGCTGAGGTGG + Intronic
1165832997 19:38738398-38738420 CAGGTGGGATGGGTCTGGGGTGG - Exonic
1165950483 19:39471545-39471567 TTGGTTGGTTGGGGGTGAGGGGG + Intronic
1166080129 19:40438817-40438839 TTGGGAGGCTGAGGCTGAGGTGG + Intergenic
1166110958 19:40622665-40622687 CAGGTGGGCATGGGCTGATGGGG + Exonic
1166359710 19:42248011-42248033 AGGCAGGGCTGGGGCTGAGGAGG + Exonic
1166364974 19:42273766-42273788 TAGGGGTGCTGGCGCTCAGGTGG - Intronic
1166478598 19:43151009-43151031 TAGGTGGGCGGCTGCTCAGGAGG + Intronic
1166734964 19:45078827-45078849 TAGCTGGGCTGGATCAGAGGCGG - Intergenic
1166921448 19:46231528-46231550 CAGGTGGGGTGGGGAGGAGGTGG + Intergenic
1167277012 19:48545004-48545026 GAGCTGGGCTGGGGCTGGGCTGG - Intergenic
1167853580 19:52220304-52220326 TGGATTGGCTGGGGCTGTGGCGG + Intronic
1168090471 19:54079744-54079766 TTGGGAGGCTGAGGCTGAGGCGG + Intronic
925076349 2:1019459-1019481 TAGGTGTGCTGGGAATGTGGAGG + Intronic
925532800 2:4883569-4883591 GAGGTGCGTGGGGGCTGAGGCGG + Intergenic
925856807 2:8137013-8137035 TGGGTAAGCTGGGGCTGAGAGGG - Intergenic
925910852 2:8572839-8572861 CAGGTGGGCTGGGGCAGGAGAGG - Intergenic
925942189 2:8831305-8831327 TGGGAGGGATGGGGCTGAGGAGG - Intronic
926098819 2:10100375-10100397 TATGTGGGGGGGGGTTGAGGGGG - Intergenic
926305694 2:11636078-11636100 GAGGTGGGCTGGGTCTGAATTGG + Intronic
926707087 2:15844606-15844628 TGGGTGGGGTGGGGCGGAGGGGG - Intergenic
926801657 2:16665330-16665352 CAGGTGTGCAGGGGCTGGGGAGG + Intronic
927111828 2:19869208-19869230 TGGGTGGGCTGGGGGTCAGGAGG - Intergenic
927154707 2:20214725-20214747 TTGGTGGGCAGGGGGTGTGGTGG + Intronic
927478932 2:23435079-23435101 TGGGTGTGATGGGGGTGAGGAGG + Intronic
927868802 2:26610361-26610383 TGGGTGGGCAGGGGGAGAGGCGG - Intronic
928537844 2:32257653-32257675 TAGTTGGGCTGGGGTGGAGGTGG + Intronic
928942654 2:36742257-36742279 AAGGTTGCCTGGGGATGAGGTGG - Intronic
928958764 2:36900134-36900156 TTGGGAGGCTGAGGCTGAGGCGG - Intronic
929189363 2:39124874-39124896 GAGCTGGGGTGGGGCTGTGGTGG - Intergenic
929584869 2:43107225-43107247 TTGGAGGGCTGGGGCTGACCTGG - Intergenic
931235102 2:60406379-60406401 TTGGTGTGTGGGGGCTGAGGTGG - Intergenic
931385384 2:61793614-61793636 GCGGTGGGCTCGGGCAGAGGCGG + Intergenic
931994355 2:67825445-67825467 GTGATGGGCTGGGGCTGAGGTGG - Intergenic
932294073 2:70609772-70609794 TGGGTGGGCAGGGGATGAGCAGG + Intronic
933942133 2:87253709-87253731 CAGGTGGGCTGGGGCTGGAGGGG + Intergenic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934561405 2:95315419-95315441 AAGGGGCGCTGGGGCCGAGGAGG - Intronic
934918002 2:98316532-98316554 TACTTGGGGTGGGGCTGAAGTGG + Intergenic
934992733 2:98932958-98932980 GAGCAGGGGTGGGGCTGAGGGGG + Intronic
935152359 2:100449485-100449507 TGGGTGAGCAGGGGCTGTGGTGG - Intergenic
935189232 2:100762674-100762696 GAGGTGGGTGGAGGCTGAGGTGG - Intergenic
935804829 2:106735069-106735091 GAGGTGGGTTAGGGATGAGGGGG + Intergenic
935952526 2:108344365-108344387 GAGCTGGGCTGAGGCTGAGATGG - Intergenic
936338093 2:111607860-111607882 CAGGTGGGCTGGGGCTGGAGGGG - Intergenic
936343133 2:111655145-111655167 AAGGTGGGATGAGGCTCAGGTGG - Intergenic
936794274 2:116187651-116187673 CAGATGGGATGGGGCTTAGGAGG + Intergenic
937229408 2:120388884-120388906 GAGGTGGGGTGGGGATGGGGTGG + Intergenic
937375835 2:121335115-121335137 GAGGTGGGCTGAGCCTGCGGGGG + Intergenic
937591877 2:123623713-123623735 TAGGTAGGCTGGGGCTGGCTTGG - Intergenic
937871763 2:126791310-126791332 TGTGTGGGCTGCAGCTGAGGAGG + Intergenic
937997300 2:127704009-127704031 TACTTGGGGTGGGGCTGAGGTGG + Exonic
938302676 2:130228234-130228256 GAGGAGGGCTAGGCCTGAGGGGG - Intergenic
938453992 2:131445988-131446010 GAGGAGGGCTAGGCCTGAGGGGG + Intergenic
938467554 2:131533260-131533282 CAGGTGGGCTCAGGCTGGGGCGG - Exonic
939447035 2:142323331-142323353 TAAGAGTGCTGTGGCTGAGGAGG - Intergenic
940004601 2:148999239-148999261 TGGGTGGGGTGGGGGTGGGGAGG - Intronic
940017093 2:149118176-149118198 TGTGTGTGCTGGGGCTGGGGCGG + Intronic
940269872 2:151878796-151878818 TTGGGAGGCTGAGGCTGAGGTGG + Intronic
941044161 2:160653501-160653523 CAGGTTGGTTGGGGCTGGGGAGG + Intergenic
941353401 2:164461438-164461460 CAGGTGGGATGCGGCTTAGGAGG - Intergenic
941475162 2:165942533-165942555 AAGGTGGGATGGGGGTGAGGAGG - Intronic
942043543 2:172086102-172086124 GAGGTGGGGTGGGGGTGGGGAGG + Intronic
942401938 2:175611952-175611974 TAGGTGGTCTGGGGCTGATATGG - Intergenic
942954852 2:181762125-181762147 TTGGTGGGCAGGGGCTGACGGGG + Intergenic
943811417 2:192194247-192194269 TAGGAGGTGAGGGGCTGAGGAGG + Intronic
944363795 2:198892437-198892459 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
945241017 2:207676914-207676936 AAGGTAGGCAGGGGCTGGGGAGG + Intergenic
945260179 2:207835873-207835895 TTGGGGGGATGGGGATGAGGAGG + Intronic
946253569 2:218428120-218428142 GTGGAGGGCAGGGGCTGAGGAGG + Intronic
946409970 2:219510991-219511013 TGGGGGGGCTGGGGCTGGGCTGG - Intergenic
946437423 2:219666683-219666705 TTGGGAGGCTGAGGCTGAGGTGG + Intergenic
946437509 2:219667365-219667387 TTGGGAGGCTGAGGCTGAGGTGG - Intergenic
946643150 2:221805490-221805512 GAGGTAGGCAGGGGCTGTGGTGG + Intergenic
947469875 2:230391643-230391665 TAGGTGCCCTGTGGCTCAGGAGG - Intronic
947666767 2:231910900-231910922 TGGGTGGGGAGGGGCAGAGGCGG - Intergenic
947772867 2:232684790-232684812 TTGGGAGGCTGAGGCTGAGGTGG + Intergenic
947916133 2:233833021-233833043 AAGGTGGGCAGGGGCAGACGGGG - Intronic
948067044 2:235088343-235088365 AAGGTGGGCTGGGGCAGGAGAGG + Intergenic
948112975 2:235471750-235471772 AAGGAGTGCTGGGGCTGAGTGGG - Intergenic
948518129 2:238519149-238519171 TGGGTGGGAGGGGGGTGAGGGGG - Intergenic
948719844 2:239892688-239892710 TAGGTGGGCTGTGGGTGAAGCGG - Intronic
948836052 2:240626480-240626502 CAGGTGGGCTGAGGCTGTTGGGG + Intronic
948842419 2:240660205-240660227 CAGGTGTGGTGGTGCTGAGGAGG - Intergenic
948971770 2:241433921-241433943 TAGGAGGGGAGCGGCTGAGGTGG + Intronic
1170011592 20:11729135-11729157 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
1170459185 20:16560670-16560692 TTGGGGGGCTGAGGCTGAGGTGG + Intronic
1172010248 20:31842284-31842306 TTGGGGGGTTGGGGCTGAGGGGG + Intergenic
1172125093 20:32621061-32621083 TAGTGGGGAGGGGGCTGAGGTGG + Intergenic
1172133465 20:32671880-32671902 TGGGTTGCCAGGGGCTGAGGGGG + Intergenic
1172520918 20:35564962-35564984 GAGGTGGTCTGGGGAGGAGGCGG + Intergenic
1172850059 20:37955394-37955416 GTGGTGGGGTGGGGTTGAGGTGG - Intergenic
1173528257 20:43749378-43749400 ATGGTGGGCTGGGGGAGAGGAGG - Intergenic
1173539481 20:43840730-43840752 TTGGTGGGGTGGGGCTGGGAGGG + Intergenic
1173662910 20:44746266-44746288 CAGCTGGGCGGGGGCAGAGGTGG - Intronic
1173763895 20:45588524-45588546 TGGATTGGCTGGGACTGAGGAGG + Intergenic
1174601573 20:51729326-51729348 GAGGTGGGGTGGGGTGGAGGGGG - Intronic
1175024855 20:55891073-55891095 TAGTGGGGGTGGGGGTGAGGGGG + Intergenic
1175517146 20:59577119-59577141 AAAATGGGCTGGGGCTGAAGTGG - Intergenic
1175958199 20:62622054-62622076 GAGGACAGCTGGGGCTGAGGCGG + Intergenic
1175990281 20:62785300-62785322 AAGGTGGGATGGGGCTGGGTGGG + Intergenic
1176061398 20:63174406-63174428 TAGGTGGGATGGGCCTTCGGGGG + Intergenic
1176149245 20:63581031-63581053 GAGGTGAGCAGGGGCTGAGAAGG - Intergenic
1176180697 20:63748050-63748072 GAGGGGGTCAGGGGCTGAGGGGG - Intronic
1176309279 21:5141240-5141262 GGGCTGGGCTGGGGCTCAGGAGG - Intronic
1176615661 21:9026764-9026786 CAGGTGGACAGGGGTTGAGGGGG - Intergenic
1176709511 21:10137039-10137061 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1177293202 21:19142223-19142245 GAGGTGGGGTGGGGTCGAGGTGG - Intergenic
1177615304 21:23509327-23509349 TTGGGAGGCTGAGGCTGAGGTGG - Intergenic
1179011218 21:37557699-37557721 TTGGAGGGCTGGGCCTGAGCTGG - Intergenic
1179141543 21:38730212-38730234 TGGGTGGCCAGGGGCTGGGGTGG - Intergenic
1179826297 21:43968267-43968289 CAGGAGGGCTGGGGATGAGCAGG + Intronic
1179847783 21:44120793-44120815 GGGCTGGGCTGGGGCTCAGGAGG + Intronic
1180070962 21:45435614-45435636 GAGGTTGGCTGGGGCAGAGGTGG + Intronic
1180261510 21:46672713-46672735 GAGGTGGGAGGAGGCTGAGGTGG + Intergenic
1180468846 22:15638540-15638562 AAGGTGGGCTGCGGCCGGGGTGG - Intergenic
1180858605 22:19063983-19064005 GAGGTGGGCTGGCTCTGAGTGGG - Intronic
1181183048 22:21080616-21080638 GAGGTGGGGAGAGGCTGAGGAGG + Intergenic
1181765633 22:25089908-25089930 TAGGTGGGCTGGGACTGGCAGGG + Intronic
1181774250 22:25148240-25148262 TGGGAGGGCTGGGACTGAGGGGG - Intronic
1182434914 22:30324446-30324468 CTGTAGGGCTGGGGCTGAGGTGG - Intronic
1182565189 22:31193237-31193259 TAGGTGGCCTGGGAATGTGGGGG + Intronic
1182583383 22:31328545-31328567 GAGGAGGGCTGGGGAAGAGGAGG + Intronic
1183101213 22:35585411-35585433 AAGGTGGGGAGGGGCAGAGGAGG - Intergenic
1183329452 22:37211729-37211751 TTGGGAGGCTGGGGCTGGGGAGG - Intronic
1183332789 22:37230263-37230285 GAGGTGGGGCGGGGCTGGGGCGG + Intronic
1183335512 22:37243904-37243926 GGGGTGGGGTGGGGCTGAAGAGG + Intronic
1183415380 22:37678694-37678716 TGGGTGGGCTGGGGCGGGGCTGG + Intronic
1183427372 22:37746810-37746832 GAGGTGGGCCTGGGCTGGGGAGG + Intronic
1183688477 22:39375326-39375348 GAGGTGGGCTGGGCCCCAGGTGG + Intronic
1183743181 22:39679443-39679465 CAGGTGGGCAGGGGCTGGAGAGG + Exonic
1184069327 22:42138340-42138362 TGGGTGGGCAGGGGCTCAGCGGG + Intergenic
1184555729 22:45232106-45232128 TAGGTGGACCTGGGGTGAGGTGG - Intronic
949959366 3:9299484-9299506 TGGGTTGGCTGGGGCTCAGCTGG - Intronic
950536599 3:13582493-13582515 TGTGTGGGCTGGGGCTCTGGTGG + Intronic
951825128 3:26859853-26859875 CAGGAGGACTGGGGCGGAGGTGG - Intergenic
952899733 3:38102121-38102143 TAGATGGGTTGGGGCTGGGATGG - Intronic
953065631 3:39467151-39467173 TGGGTGGGATGGCGCTGTGGTGG + Intergenic
953833373 3:46322179-46322201 GATCTGGGGTGGGGCTGAGGAGG - Intergenic
953857340 3:46509689-46509711 TATCTGGGCTGGTGGTGAGGGGG - Intergenic
954325530 3:49861382-49861404 CAGCTGGGCTGGTGCTGGGGTGG - Intronic
954349391 3:50030168-50030190 TGGGTGGGGCGGGGGTGAGGTGG + Intronic
954675825 3:52314853-52314875 AAGGTGGGCAGGGGATTAGGTGG + Intergenic
954714240 3:52519110-52519132 GAGGTGGGCGGGGTCTGGGGCGG - Intronic
955059957 3:55485668-55485690 GGGGAGGGCAGGGGCTGAGGAGG + Intronic
955530012 3:59863190-59863212 TAGAGTGGCTGGGGCTGAGAGGG - Intronic
955711450 3:61783576-61783598 TATGTGTGCTGTGGTTGAGGAGG + Intronic
955994832 3:64669082-64669104 AAGGTGGCCTGTGGCTGGGGAGG - Intronic
956217562 3:66864538-66864560 GCGGGGGGCTGGGGATGAGGAGG - Intergenic
957960807 3:87248744-87248766 TAGGTGTGTTGGGGGTGGGGAGG + Intronic
959109398 3:102103935-102103957 TAGTGGGGCTTGGGCTGTGGAGG + Intronic
961117033 3:124339237-124339259 CAGGTGGGCTGGGGCTGGAGAGG + Intronic
961265118 3:125635306-125635328 TTGGGAGGCTGAGGCTGAGGTGG - Intergenic
961479451 3:127170757-127170779 CAGGTGGGCTTGGGGGGAGGTGG + Intergenic
961652091 3:128421751-128421773 GAGGTGGGCCGAGGCTCAGGGGG - Intergenic
961786403 3:129349732-129349754 TAGGTGAGCTGGGGCGGGGGTGG + Intergenic
961862252 3:129926315-129926337 TCGGTGGGGTAGGGCTGGGGTGG + Intergenic
962164974 3:133038771-133038793 GACCTGGGCTGGGGCCGAGGAGG + Intronic
964304493 3:155326049-155326071 GAGGTGGGGTGGGGGTGTGGAGG - Intergenic
964565850 3:158051760-158051782 AATGTGGGCAGGTGCTGAGGTGG - Intergenic
965901312 3:173644867-173644889 AAGGTGGGCAGGTGTTGAGGGGG + Intronic
966839527 3:184077367-184077389 GAGGTGGGGTGTGGGTGAGGTGG + Intergenic
967185552 3:186941582-186941604 AAGATGGGCGGGGGGTGAGGAGG + Intronic
967469361 3:189844025-189844047 CAGGTGGTCTGGGGTTGGGGTGG - Intronic
967764660 3:193265461-193265483 GTGGTTGCCTGGGGCTGAGGTGG + Intronic
967854269 3:194104583-194104605 TATGAGTGTTGGGGCTGAGGAGG + Intergenic
967915892 3:194577928-194577950 TAGGTGGGTTGAGGCTGTGTTGG + Intergenic
968669597 4:1841996-1842018 GACGTGGTGTGGGGCTGAGGGGG - Intronic
968764890 4:2463030-2463052 CAGGGGGGCCGGGGCCGAGGGGG - Intronic
968772417 4:2516190-2516212 TAGGTGGTCAGGGGCAAAGGGGG - Intronic
968878806 4:3288221-3288243 TGGGAGGGCTGGGGCTGGAGTGG + Intergenic
969060647 4:4431695-4431717 TGGGCAGGCTGGGGCTGAGCAGG - Intronic
969178253 4:5416487-5416509 TAGGTGGGCTATGGCTGGGGCGG - Intronic
969527649 4:7712115-7712137 TAGGTGGGTGGGGGAAGAGGCGG - Intronic
969632610 4:8347169-8347191 TAGGTGGGCCAGGCCTGGGGTGG + Intergenic
970048025 4:11877816-11877838 TTGGGAGGCTGAGGCTGAGGTGG - Intergenic
970412236 4:15819381-15819403 GAACTGGGCTGAGGCTGAGGTGG + Intronic
970464325 4:16307672-16307694 TAGATGGGCTGTGACTGAGTAGG + Intergenic
971310973 4:25525512-25525534 TGTTTGGGCTGGAGCTGAGGAGG - Intergenic
971509571 4:27407302-27407324 AGAGTGGGCAGGGGCTGAGGGGG - Intergenic
971771258 4:30899762-30899784 TTTGTGGGGTGGGGGTGAGGTGG + Intronic
972495006 4:39626211-39626233 TCAGTGGGCTGGGGCAGGGGTGG - Intronic
973647308 4:52962534-52962556 TAGCTGGGCTGGGAATGGGGTGG + Intronic
975035146 4:69670167-69670189 CATGTGGGCTGGGGTGGAGGTGG + Intergenic
976052744 4:81028614-81028636 AAGGAGGACTGGAGCTGAGGGGG + Intergenic
976203153 4:82599345-82599367 GAGGTGGGGTGGGGGAGAGGAGG + Intergenic
977414934 4:96721250-96721272 GAACTGGGCTGAGGCTGAGGTGG - Intergenic
977570706 4:98626575-98626597 CAGGTGGGCCAGGGGTGAGGAGG - Intronic
977607391 4:98996103-98996125 CATGTGGGCTGGGGCGGAAGCGG + Intronic
978754199 4:112285606-112285628 GCGGCGGGCTGGGGGTGAGGTGG - Intronic
978789452 4:112645605-112645627 TCGCTTGGGTGGGGCTGAGGGGG - Intronic
978800631 4:112752301-112752323 TCGCTGGGCTGGGGCTGAGGAGG + Intergenic
980253110 4:130343730-130343752 GAGGTGGGCTGAGCCTGAGGGGG - Intergenic
981000510 4:139824841-139824863 TATATGGGCTGGGGCGGGGGTGG - Intronic
982728199 4:158927875-158927897 CAGGTGGGCTGGGACTGCTGGGG - Intronic
983092829 4:163525190-163525212 TAAGGGTCCTGGGGCTGAGGTGG - Exonic
983650605 4:170032713-170032735 CAGGAGGGATGAGGCTGAGGTGG + Intronic
984758246 4:183343158-183343180 CACGTGGGCTGGGGGTCAGGGGG - Intergenic
985490126 5:174272-174294 AATGGGGGCTGGGGCTGGGGTGG + Intronic
985657586 5:1140187-1140209 CAGGTGGGCCGGGGCTGCAGCGG - Intergenic
985672303 5:1213153-1213175 TATGTGGGATGGTGCGGAGGGGG - Intronic
985846979 5:2357082-2357104 TTGGGAGGCTGAGGCTGAGGTGG + Intergenic
985881546 5:2642175-2642197 AAGGTGGCCTGGGCCAGAGGAGG + Intergenic
985936155 5:3100159-3100181 AGTGTGAGCTGGGGCTGAGGAGG - Intergenic
985952023 5:3229625-3229647 TGTTTGGGCTGGGGCAGAGGTGG - Intergenic
985955812 5:3265413-3265435 GAGGTGGGCTGGGGCTGTAAAGG - Intergenic
985997749 5:3606206-3606228 CACGTGGCCTGGGACTGAGGAGG + Intergenic
986070415 5:4277719-4277741 TGGGTGGGCAGAGGCTGGGGAGG - Intergenic
986463068 5:7993113-7993135 TAGGGGGGCTGAGGCTGAGGTGG + Intergenic
988635717 5:32981728-32981750 TAGGTGGGTTAGGGGTGGGGTGG + Intergenic
990553778 5:56909862-56909884 CGGGTGGGCAGGGACTGAGGTGG + Intronic
990903331 5:60777104-60777126 TAGGGGGGTTGGGGGGGAGGTGG + Intronic
991770645 5:70037711-70037733 TTGGGAGGCTGAGGCTGAGGTGG + Intronic
991777584 5:70100105-70100127 TAGGTGGGTGGGGGCTGAGGTGG - Intergenic
991849939 5:70913129-70913151 TTGGGAGGCTGAGGCTGAGGTGG + Intronic
991856872 5:70975549-70975571 TAGGTGGGTGGGGGCTGAGGTGG - Intronic
992603020 5:78424105-78424127 GAGGTGGGCAGAGGCCGAGGTGG - Intronic
992676650 5:79112160-79112182 AAGCTGGGCTGGGGCTGGAGGGG - Intronic
993375817 5:87148784-87148806 GAGCTGGGCTGAGGCTGAGATGG - Intergenic
994245460 5:97471388-97471410 AAGTTGGGAGGGGGCTGAGGCGG + Intergenic
994298924 5:98122514-98122536 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
994952774 5:106486105-106486127 GAGGTGAGGTGGGGCAGAGGGGG - Intergenic
995499089 5:112783686-112783708 TTGGGAGGCTGAGGCTGAGGAGG + Intronic
997196805 5:131985754-131985776 TAGGTGGGATTGGGCTGCAGTGG + Intronic
997584051 5:135034295-135034317 TGGGTGGGAGGGGGCTGGGGAGG + Exonic
997653952 5:135541916-135541938 TAGCAGGGCAGGGGCCGAGGGGG - Intergenic
997829133 5:137133943-137133965 CAGATGGGCTGGGGGTGGGGGGG + Intronic
998091741 5:139375050-139375072 CTGGTGGGTTGGGGCTGGGGAGG - Intronic
998166420 5:139846980-139847002 TAGGTGGGTTGGGGGCTAGGAGG + Intronic
998242768 5:140463912-140463934 TTGGGAGGCTGAGGCTGAGGCGG - Intronic
998386491 5:141760149-141760171 CAGGTGGCAGGGGGCTGAGGAGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999231329 5:150063776-150063798 AAGCTGGGCTGGGGCGGTGGAGG + Intronic
999307591 5:150530138-150530160 TAGCTGGGGTGGGGGTTAGGGGG + Intronic
1000062782 5:157671536-157671558 TAGGTGGGCGCGCGCTGACGCGG - Exonic
1001313996 5:170629939-170629961 TGATGGGGCTGGGGCTGAGGCGG + Intronic
1001547076 5:172576953-172576975 AAGGTGGGCTTGGGTGGAGGTGG + Intergenic
1002001043 5:176196391-176196413 TAGGTAGGGAGGGGCTGAGGGGG + Intergenic
1002103665 5:176869490-176869512 CGGGTGGGCTGTGGCTGAGCTGG - Intronic
1002169532 5:177367372-177367394 CAGGTGAGCCGGGGCTGGGGTGG - Intronic
1002201974 5:177534060-177534082 ACGCTGGGCTGAGGCTGAGGTGG + Intronic
1002210938 5:177599049-177599071 TGGGGGGGCTGGGGGTGAGGGGG + Intergenic
1002253292 5:177942581-177942603 TAGGTAGGGAGGGGCTGAGGGGG - Intergenic
1002273091 5:178085721-178085743 TAGCCGGGCAGAGGCTGAGGCGG + Intergenic
1002564039 5:180100080-180100102 GAGGTGGGCTGGGGCGGTGCAGG + Intergenic
1002858857 6:1062013-1062035 CTGGTGGGTTGAGGCTGAGGAGG - Intergenic
1003155321 6:3588909-3588931 GAGGTGGGATAAGGCTGAGGTGG + Intergenic
1003248000 6:4400505-4400527 TAGGTTGCCTGGGGAGGAGGAGG - Intergenic
1003638395 6:7855672-7855694 TAGCTGGGCATGGGCTGAGGTGG - Intronic
1003788511 6:9515492-9515514 TAGGAGGTGTGAGGCTGAGGGGG - Intergenic
1004424899 6:15500654-15500676 TAGGTGGGGAGCGTCTGAGGAGG - Intronic
1004648941 6:17589894-17589916 TGGGTCCTCTGGGGCTGAGGAGG - Intergenic
1005562335 6:27053665-27053687 TGGGTGGTTTGGGACTGAGGTGG - Intergenic
1006379668 6:33690210-33690232 TGGGTGGGCTGGGGCTGGATGGG + Intronic
1006712294 6:36084329-36084351 GATGTGGGCTGAGGCTGAGATGG + Intronic
1006712771 6:36089377-36089399 TTGGTGGGGTGGGGGTCAGGCGG + Intronic
1006982157 6:38155291-38155313 TTGGTGGCCTGGGTGTGAGGCGG + Intergenic
1007223536 6:40296992-40297014 GGGGTGGGCTGGGGGTGGGGGGG + Intergenic
1007619534 6:43203590-43203612 CAGGTGGGTGGGGCCTGAGGAGG + Exonic
1007673516 6:43576102-43576124 TAGGTGGGCGGGGCGGGAGGCGG + Intergenic
1007734434 6:43971900-43971922 TGGCTGGGGTGGAGCTGAGGAGG + Intergenic
1008711709 6:54235808-54235830 TAGGTAGGGTGGGGTTGTGGAGG + Intronic
1009522042 6:64695121-64695143 TGGGTTGGATGGGGCTGAGATGG - Intronic
1010285188 6:74069077-74069099 TAGGTGGGTTGAGGCTGAGAGGG + Intergenic
1010447779 6:75967341-75967363 TTGGTGGGTTGGGGGTGAGAAGG + Intronic
1011548041 6:88502107-88502129 TGTGTGGGGTGGGGCTGAGGTGG - Intergenic
1011921159 6:92578336-92578358 GAAGTGGGCTGAGGCTGATGTGG + Intergenic
1013058571 6:106609414-106609436 TAGGTATGGTGGTGCTGAGGTGG + Intronic
1013066544 6:106689454-106689476 GGGGTGGTGTGGGGCTGAGGTGG - Intergenic
1014640607 6:123904818-123904840 TAGCTGAGCTGGGGGTGAGAAGG + Intronic
1014778068 6:125533538-125533560 GAGGTGGCCTGGGGCAGGGGTGG - Intergenic
1015368458 6:132424551-132424573 GAACTGGGCTGAGGCTGAGGTGG - Intergenic
1015929966 6:138349290-138349312 TAAGTGAGCTGGGGGGGAGGAGG - Intergenic
1015999348 6:139028018-139028040 TAGCTGGGCTGGGGGTGGGGAGG + Intergenic
1016330034 6:142945771-142945793 GAGGCGGGCTGGAGGTGAGGGGG - Intergenic
1017001453 6:150000252-150000274 GAGGGGGGCAGGAGCTGAGGAGG - Intergenic
1017145375 6:151229981-151230003 TTTGTGGGGTGGGGGTGAGGGGG - Intergenic
1017449263 6:154538818-154538840 TAGGAGGGCAGGAGCTGAGATGG + Intergenic
1017451144 6:154555486-154555508 TGGGTGGGGTGGGGGTGGGGGGG + Intergenic
1018182699 6:161238052-161238074 TTGGGGGGCTGGGGGTGGGGGGG + Intronic
1018734212 6:166675297-166675319 TAGGTGGGCTGGAACTGCAGGGG - Intronic
1019170527 6:170130964-170130986 GATGTGGCCTGGGGATGAGGAGG - Intergenic
1019296678 7:280630-280652 CAGCTTGGCTGGGGCTCAGGAGG + Intergenic
1019340620 7:507247-507269 AAGGGGGCCTGGGTCTGAGGAGG + Intronic
1019367825 7:644404-644426 TGGGTGTGCAGAGGCTGAGGGGG + Intronic
1019478331 7:1254809-1254831 CAGCTGGGCAGGGGCTGACGAGG + Intergenic
1019528065 7:1489701-1489723 TTGGTGCGCTGGGCCTGAGTCGG - Intronic
1019643832 7:2118655-2118677 TATGTGGGCAGGGGCTGGGAGGG - Intronic
1019890093 7:3939567-3939589 TTGGTGGGCTGGGGATGACCTGG + Intronic
1019961202 7:4461398-4461420 AAGATGGGCAGGGGCTGAAGTGG - Intergenic
1019982770 7:4633661-4633683 GAGGTGGGCGGGGACAGAGGTGG - Intergenic
1021331155 7:19340315-19340337 TAGTTGGGTCGGGGGTGAGGGGG - Intergenic
1021541017 7:21758509-21758531 TAGGTGGGCAGTGGCTGGGTTGG - Intronic
1022213719 7:28237272-28237294 CAGGAGGGCTAGAGCTGAGGTGG + Intergenic
1022214781 7:28247968-28247990 TTGGTTGCCTGGGGCTGGGGTGG - Intergenic
1023090880 7:36616172-36616194 CAGCTGGGCTGAGGCTGGGGAGG + Intronic
1023149449 7:37187283-37187305 TTGGTTGCCTGGGGCTGGGGAGG + Intronic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1024182070 7:46906658-46906680 TAGCTGGGCATGGGCTGAGCTGG + Intergenic
1026527920 7:71171955-71171977 TAGGTGGGCTGGGGGTGGGAGGG - Intronic
1026767771 7:73171382-73171404 TGGGTGGGCTGGGTGGGAGGGGG - Intergenic
1026829028 7:73600364-73600386 TGAGTGGGATGGGGGTGAGGGGG + Intronic
1027079404 7:75221268-75221290 TGGGTGGGCTGGGTGGGAGGGGG + Intergenic
1027113633 7:75460943-75460965 TAAATGGGGTGGGGCAGAGGAGG - Intronic
1027285882 7:76645538-76645560 TAAATGGGGTGGGGCAGAGGAGG - Intergenic
1027741897 7:82018986-82019008 TTGGTGGGGTGGGGGTGGGGTGG + Intronic
1028613118 7:92734401-92734423 TAGGTGGGCTTTGGCTGAGGGGG - Intronic
1028994565 7:97085893-97085915 TAGGTGGGCTGGGTGGGAGGCGG - Intergenic
1029275320 7:99400527-99400549 TACGTGGGCTGGGGTGGAGCAGG - Intronic
1029388626 7:100259851-100259873 TGGGTGGGCTGGGTGGGAGGAGG + Intronic
1031101580 7:117486870-117486892 TGGGTGGGGTGGGGGGGAGGGGG + Intronic
1032020785 7:128406184-128406206 TAGGAGGTGTGGGGCTGCGGGGG + Intronic
1032716315 7:134511962-134511984 TGGGTGAGATGGGGCTGCGGAGG + Intergenic
1033521267 7:142162953-142162975 TTGGTTGCCAGGGGCTGAGGAGG - Intronic
1033589770 7:142799559-142799581 TGGCTGGGCTGGGGCCGAAGTGG - Intergenic
1034400705 7:150859805-150859827 TAAGTGGGCTGAGGAAGAGGAGG + Intronic
1034509013 7:151519520-151519542 TGGTTGGGCCGGGGCTGAGGAGG - Exonic
1034996934 7:155583628-155583650 TAGGTGGGCTTGAGCCCAGGTGG - Intergenic
1035035937 7:155893793-155893815 TAGGTGGTTTGTGGCTGAGCCGG + Intergenic
1035045265 7:155961638-155961660 GAGGTGGGTGGGAGCTGAGGGGG + Intergenic
1035944881 8:3951268-3951290 AAGGTGGGCCAGGGCTGAGGAGG - Intronic
1036379635 8:8228411-8228433 TAGGAGGGCGGGGCCTGGGGTGG - Intergenic
1036747853 8:11422911-11422933 GATGTGGGTGGGGGCTGAGGTGG + Exonic
1036769025 8:11566093-11566115 CCTGTGGGGTGGGGCTGAGGAGG + Intergenic
1036771049 8:11578643-11578665 TAAGTGGGGCGGGGCTGGGGTGG + Intergenic
1036787238 8:11696285-11696307 GAGGTTGCCAGGGGCTGAGGAGG - Intronic
1037088398 8:14881518-14881540 GAGGTTGGCTGAGGCTGATGTGG - Intronic
1037376715 8:18238186-18238208 TAGGGGAGGTGGGGCGGAGGTGG + Intergenic
1038285470 8:26202816-26202838 AAAGTGGGATGGGGCTGTGGCGG - Intergenic
1039567232 8:38560174-38560196 TAGGTGGGTGGAGGCAGAGGTGG + Intergenic
1041271969 8:56117784-56117806 TTGCTGCGCTGGGGCCGAGGAGG + Intergenic
1042224351 8:66503992-66504014 TTGGTGGGCTGGAGAAGAGGAGG + Intronic
1042807491 8:72787282-72787304 TACTTGGGGTGGGGCTGAGCTGG + Intronic
1042908185 8:73795973-73795995 TTGGGAGGCTGAGGCTGAGGTGG + Intronic
1044203877 8:89468748-89468770 TTGGTGGGCTGCTGCTGTGGTGG - Intergenic
1044430011 8:92096965-92096987 TGGGTGGGGTGGGGGAGAGGGGG - Intronic
1044666953 8:94641291-94641313 TAGGTGGGGAGGGGGAGAGGGGG - Exonic
1045289621 8:100821374-100821396 TGGGTTGGCTGGGGGTGAGAAGG - Intergenic
1045420394 8:102008896-102008918 TAGGGGGGCGGGGGTGGAGGTGG - Intronic
1045509500 8:102803771-102803793 TAGGTGGGCCAGGGATGAGGGGG + Intergenic
1046644943 8:116776063-116776085 CAGGTGGGGTGGGGGTGGGGGGG - Intronic
1046787385 8:118282574-118282596 TAGGGGGGCTGGGGTGGTGGTGG + Intronic
1046959393 8:120094240-120094262 TAGATGGGCTGAGGATGGGGAGG + Intronic
1046984550 8:120372811-120372833 TTGGTGGGGTGGGGCAGGGGCGG + Intergenic
1048295170 8:133208756-133208778 TGTGTGTGCTGGGGCTGAAGAGG - Intronic
1048512310 8:135073780-135073802 TTGGTGGGCTGGGGCTGAGAAGG - Intergenic
1048744123 8:137594260-137594282 TAGATGGTCTAGGGCTGATGTGG + Intergenic
1048926520 8:139276940-139276962 TAGGTAGCCTGGGGCAGGGGAGG + Intergenic
1048965075 8:139609239-139609261 TAGGTGGGGGGGGGGTGGGGGGG - Intronic
1049236410 8:141514570-141514592 GGAGTGGGCTGGGGCTGTGGGGG - Intergenic
1049262323 8:141646373-141646395 AAGGGTGGCTGGGGCGGAGGGGG - Intergenic
1049469273 8:142768222-142768244 GAGGTGGGGTGGGGGGGAGGGGG + Intronic
1049566748 8:143344313-143344335 GAGCTGGGCTGGGGCAGAGGGGG - Intronic
1049691866 8:143965052-143965074 CAGGTGGGCTGGGGCCAAGTGGG - Intronic
1049756676 8:144313917-144313939 TAGGCGGGCGGGGGGTGAGGGGG + Intronic
1051603582 9:18897835-18897857 GAAGTGGGCTGAGGCTGAGATGG + Intronic
1051696566 9:19774187-19774209 TTGGTGGGTTGGGGAGGAGGAGG + Intronic
1051867358 9:21696639-21696661 CCGGTGGGCGGGGACTGAGGGGG - Intergenic
1052173992 9:25434388-25434410 TTAGTGGGGTGGGCCTGAGGGGG - Intergenic
1052840525 9:33288797-33288819 TAGGTAGGCGGGGGTTGGGGAGG - Intergenic
1053456028 9:38233684-38233706 AATGTGGGCAGGGGCTGGGGAGG + Intergenic
1053646484 9:40122575-40122597 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1053759229 9:41340976-41340998 CAGGTGGACAGGGGTTGAGGGGG - Intergenic
1054327495 9:63720477-63720499 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1054354960 9:64051570-64051592 TAGTTAGGCTGGGGCAGGGGTGG - Intergenic
1054538085 9:66253398-66253420 CAGGTGGACAGGGGTTGAGGGGG - Intergenic
1056132646 9:83601157-83601179 GAGGTGAGCTGGGTCTCAGGTGG - Intergenic
1056165687 9:83938854-83938876 GCGGTAGGCTGAGGCTGAGGAGG - Exonic
1056213728 9:84389115-84389137 CAGGTTTGCTGGGGGTGAGGTGG - Intergenic
1056404312 9:86259434-86259456 GAGGTGGGCAGTGGCTAAGGTGG - Intronic
1057904693 9:98974727-98974749 CTGGGGGGCCGGGGCTGAGGGGG - Intronic
1058706467 9:107641600-107641622 TTGGTGGGGTGGGGATGGGGTGG - Intergenic
1058879420 9:109273663-109273685 GAGGTGGGCTGGGGGTGTGGGGG - Intronic
1059437077 9:114283506-114283528 AAGGAGGGCTGGGGCAGGGGTGG + Intronic
1059710771 9:116865719-116865741 TGGGTGGGCTGGCCCTGAAGAGG + Intronic
1059813137 9:117879301-117879323 CAGGTGTGCTAGGGCTGGGGTGG + Intergenic
1059939123 9:119340501-119340523 TAGCTGGACTGGGGAAGAGGAGG - Intronic
1060215588 9:121736564-121736586 CCGGAGGGCTGGGGCTGGGGCGG + Intronic
1060546248 9:124462171-124462193 TTGAGGGGCTGGGGCTGAGGTGG - Intronic
1060668587 9:125448542-125448564 CTGGTGGGCTGCAGCTGAGGAGG - Intronic
1060829466 9:126704599-126704621 CAGGTGGGCTGGGTCTGGGAAGG - Intergenic
1060861252 9:126956575-126956597 TAGGTGGGGTGGGCCACAGGGGG + Intronic
1061289055 9:129640587-129640609 TGGCTGAGCTGGGGCTGACGCGG - Exonic
1061400525 9:130365830-130365852 TAGTGGGGGTGGGGCTGAGATGG - Intronic
1061824966 9:133252368-133252390 TTGGTGAGCTGGGGGTGTGGGGG - Intronic
1062104888 9:134749933-134749955 CAGGTTGGCTGGGCGTGAGGAGG + Intronic
1062213726 9:135378058-135378080 GAGGTGGGCAGGGGCCGTGGAGG - Intergenic
1062269425 9:135701886-135701908 GTGGTGGGCGGGGGCTCAGGGGG - Intergenic
1062327437 9:136018973-136018995 GAGCTGGGCAGGGGCTGGGGAGG - Intronic
1062378946 9:136277485-136277507 GGGGTGGGCAGGTGCTGAGGGGG + Intergenic
1062507122 9:136883355-136883377 GACTTGGGGTGGGGCTGAGGTGG + Intronic
1062542778 9:137048921-137048943 AAGGTGGGCTGGGGCGGGGCGGG - Exonic
1062714314 9:137998467-137998489 TGGGTGTGCTGGTGCTGAGGTGG + Intronic
1202794270 9_KI270719v1_random:106006-106028 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1203745548 Un_GL000218v1:39075-39097 TGTGTGAGCTGGGGCTGGGGAGG + Intergenic
1185499361 X:585214-585236 ACGGTGGGATGGGGGTGAGGGGG - Intergenic
1185589101 X:1262079-1262101 GAGGTGGGTTGGGGAGGAGGTGG - Intergenic
1185891105 X:3822681-3822703 CAGGTGGGCTTGGGGTGAGTGGG + Intronic
1185896208 X:3861097-3861119 CAGGTGGGCTTGGGGTGAGTGGG + Intergenic
1185901327 X:3899523-3899545 CAGGTGGGCTTGGGGTGAGTGGG + Intergenic
1185906436 X:3937956-3937978 CAGGTGGGCTTGGGGTGAGCGGG + Intergenic
1187161918 X:16773109-16773131 AAGGTGGGGTGGGGGTGGGGTGG + Intergenic
1187464373 X:19514860-19514882 TAGGTGAACTGGGACTGAGGTGG + Intronic
1188350322 X:29122453-29122475 TGGGTGGGGTGGGGGTGGGGGGG - Intronic
1188500262 X:30818094-30818116 TGGGTGGGTTGGGGGTGGGGTGG + Intergenic
1189283379 X:39834867-39834889 TAGGTGGTCTGGGGCTGGTGTGG + Intergenic
1189485896 X:41431463-41431485 GAGGGGACCTGGGGCTGAGGTGG - Intergenic
1189911136 X:45811521-45811543 TGGGTGGGCGGGGGCGGGGGGGG - Intergenic
1190753415 X:53381103-53381125 TAGGTGAGCTGACACTGAGGCGG + Intronic
1190792760 X:53715266-53715288 TGGGTGGTCTGGGGGTGAGTGGG + Intergenic
1190913825 X:54795101-54795123 TAGGTGGCCAGGAGCTGAGTAGG - Intronic
1191716696 X:64198632-64198654 TAGCAGGGCTGGGACAGAGGTGG - Intronic
1192157076 X:68754655-68754677 CAGTTCGGCTGGTGCTGAGGTGG + Intergenic
1192735266 X:73844641-73844663 TAGATGGGATGGGGCAGAGGAGG + Intergenic
1193052138 X:77112495-77112517 TAACTGGGCTGAGGCTGAGATGG + Intergenic
1193380361 X:80809884-80809906 GAGGTGGGCGGGGGCAAAGGGGG + Intergenic
1194504557 X:94716250-94716272 TTGGAGGTCCGGGGCTGAGGTGG - Intergenic
1195325734 X:103756828-103756850 GAGGAGGGCTGGAGCTGAGCAGG + Intergenic
1196919798 X:120574102-120574124 TTGGGAGGCTGGGGCAGAGGGGG - Intronic
1197728934 X:129794184-129794206 TAGGTGGTGTGGGGGTGAGGAGG - Exonic
1199845882 X:151692972-151692994 TGGAGGGGCTGGGGCTGAGAAGG - Intergenic
1200039024 X:153352792-153352814 TGGGTGGGGGAGGGCTGAGGAGG - Exonic
1200064721 X:153498820-153498842 TGGCTGTGTTGGGGCTGAGGAGG + Intronic
1200770753 Y:7123187-7123209 TAGGTGGGCTGTGGCTGCTGTGG - Intergenic
1201077633 Y:10199469-10199491 CAGGTGGGATGGGGCCGAGCCGG - Intergenic
1202378723 Y:24259200-24259222 AGGGAGGGCTGAGGCTGAGGTGG - Intergenic
1202492059 Y:25410921-25410943 AGGGAGGGCTGAGGCTGAGGTGG + Intergenic