ID: 1077423960

View in Genome Browser
Species Human (GRCh38)
Location 11:2465847-2465869
Sequence CAGGCTCCAAATGGCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077423960_1077423972 26 Left 1077423960 11:2465847-2465869 CCTGGAAGGCCATTTGGAGCCTG 0: 1
1: 0
2: 1
3: 32
4: 181
Right 1077423972 11:2465896-2465918 CAGGCGGGTCTAGATGTGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 107
1077423960_1077423967 7 Left 1077423960 11:2465847-2465869 CCTGGAAGGCCATTTGGAGCCTG 0: 1
1: 0
2: 1
3: 32
4: 181
Right 1077423967 11:2465877-2465899 GGCAGGAGCTGTGTGCTGCCAGG 0: 1
1: 0
2: 1
3: 57
4: 452
1077423960_1077423965 -10 Left 1077423960 11:2465847-2465869 CCTGGAAGGCCATTTGGAGCCTG 0: 1
1: 0
2: 1
3: 32
4: 181
Right 1077423965 11:2465860-2465882 TTGGAGCCTGGCTGGCAGGCAGG 0: 1
1: 0
2: 7
3: 53
4: 458
1077423960_1077423969 11 Left 1077423960 11:2465847-2465869 CCTGGAAGGCCATTTGGAGCCTG 0: 1
1: 0
2: 1
3: 32
4: 181
Right 1077423969 11:2465881-2465903 GGAGCTGTGTGCTGCCAGGCGGG 0: 1
1: 0
2: 8
3: 54
4: 530
1077423960_1077423970 22 Left 1077423960 11:2465847-2465869 CCTGGAAGGCCATTTGGAGCCTG 0: 1
1: 0
2: 1
3: 32
4: 181
Right 1077423970 11:2465892-2465914 CTGCCAGGCGGGTCTAGATGTGG 0: 1
1: 0
2: 0
3: 7
4: 64
1077423960_1077423968 10 Left 1077423960 11:2465847-2465869 CCTGGAAGGCCATTTGGAGCCTG 0: 1
1: 0
2: 1
3: 32
4: 181
Right 1077423968 11:2465880-2465902 AGGAGCTGTGTGCTGCCAGGCGG 0: 1
1: 0
2: 5
3: 34
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077423960 Original CRISPR CAGGCTCCAAATGGCCTTCC AGG (reversed) Intronic
900981280 1:6047630-6047652 CAGGCTCCAAAAGGCCAACCAGG - Intronic
900981631 1:6049205-6049227 CAGGCTCCAAAAGGCCAACCAGG - Intronic
900992778 1:6105647-6105669 GAGGCTCCAGAGGGGCTTCCTGG - Intronic
904375268 1:30077389-30077411 CAGTGGCCAAGTGGCCTTCCAGG + Intergenic
905975133 1:42168854-42168876 CTTGCTCCTAATAGCCTTCCAGG + Intergenic
906542647 1:46599648-46599670 GAGGCTCCAAATGCCCTGACTGG - Intronic
906706578 1:47899445-47899467 CAGTGTCCAAGTGGCCTTGCAGG - Intronic
907883635 1:58574093-58574115 CAGGCTCCAAACTTCCTTCCAGG - Intergenic
908463866 1:64372530-64372552 GATGCTCTAAATGGCCTCCCAGG + Intergenic
910413303 1:86969182-86969204 CAGGCTTAAAATTGCCTTTCAGG + Intronic
911247030 1:95529476-95529498 AAGGCCCCAAATTGCCTGCCTGG - Intergenic
915186983 1:154114404-154114426 CAGGATCCATATGTTCTTCCTGG + Intronic
915631367 1:157155793-157155815 CAGGCTCCAAATGGGCCCCTGGG + Intergenic
917504554 1:175616106-175616128 CAGGGGCCAAATAGGCTTCCAGG + Intronic
919747082 1:201015570-201015592 CAGCCTCCAATTGGCATGCCTGG + Intronic
919977168 1:202620199-202620221 CAGGGGCCAAGTGGCCATCCTGG - Intronic
920550240 1:206854630-206854652 CAGGCTCCAGGTAGCCTTCCTGG + Intergenic
921948170 1:220902766-220902788 TAAGCTCCCAATGTCCTTCCAGG - Intergenic
922726552 1:227925552-227925574 CAGGCTCCAGCAGGGCTTCCTGG - Intronic
923746764 1:236708262-236708284 AAGGCCTCAAATGGACTTCCAGG + Intronic
924941093 1:248812825-248812847 CATGTTCCAAATGACCTTGCAGG - Intronic
1065751351 10:28890665-28890687 CAGGCTCCACAAGGGCTGCCTGG - Intergenic
1067273366 10:44811870-44811892 CAGACTTCAAATGGGTTTCCAGG - Intergenic
1069598207 10:69686499-69686521 CAGGTTCCATATGGCCCTCCCGG + Intronic
1069635594 10:69922937-69922959 CTGGGTCCAAATGGCCTTTTTGG - Intronic
1070764682 10:79049457-79049479 CAGGCCCCAAATGGACTTCCAGG + Intergenic
1072740661 10:97907197-97907219 CAGGCTCCACATTGCCATCATGG - Intronic
1072758925 10:98039984-98040006 CAGGCACCAGCTGGCTTTCCTGG - Intergenic
1072801213 10:98393578-98393600 CAGCCTCCAAAGGGCTTTCAAGG + Intronic
1073307332 10:102513698-102513720 CAGGCTGCAGATGGCATCCCAGG - Intronic
1074291816 10:112143377-112143399 CAGTCCCTAACTGGCCTTCCTGG - Intergenic
1076117494 10:127910358-127910380 CAGTCTCCACAAAGCCTTCCTGG + Intronic
1076199504 10:128547076-128547098 CAGGCTCCAAATGCACTTCTTGG - Intergenic
1076474067 10:130740268-130740290 TGGGCTCCACAGGGCCTTCCGGG - Intergenic
1076521162 10:131082279-131082301 CAGGCTCCAGCTGGCCACCCTGG - Intergenic
1076642578 10:131928817-131928839 AGGCCTCCAAATGGCCGTCCAGG + Intronic
1077423960 11:2465847-2465869 CAGGCTCCAAATGGCCTTCCAGG - Intronic
1078040583 11:7858888-7858910 CAGGCTCCAAATTGCTTCCCTGG + Intergenic
1078343874 11:10525883-10525905 AAAGCTCAAAATGGCCTTCTGGG - Intronic
1080217880 11:29866533-29866555 CAGACTCACAATGGCATTCCAGG + Intergenic
1081937709 11:46916911-46916933 GAGGCTACAAATAACCTTCCAGG + Intronic
1082890393 11:58132889-58132911 CAGTCTTCTAATTGCCTTCCTGG + Intronic
1084537117 11:69763793-69763815 GAGGCTCCATTTGCCCTTCCCGG - Intergenic
1084650176 11:70484961-70484983 GAGGCTCTAAACGGCCTTCTAGG + Intronic
1084859396 11:72008358-72008380 CGGTCTCCAATGGGCCTTCCTGG + Intronic
1089535965 11:119161007-119161029 CAAGCTCTACATGGACTTCCTGG + Exonic
1093907757 12:24712877-24712899 CAGGCTCCCAAAGGACTCCCAGG - Intergenic
1094740739 12:33285428-33285450 CAGGCTCAAAATATCCCTCCTGG + Intergenic
1102133755 12:110554795-110554817 AAGGCTTTAAATGGCCTTTCTGG + Intronic
1105210298 13:18253375-18253397 CAGGCTCCAGGTGGCCTCCCTGG - Intergenic
1105292734 13:19062867-19062889 CAGGCTGCAGATGCCTTTCCAGG - Intergenic
1105727853 13:23183501-23183523 CAGGATACAAATAGCCCTCCTGG + Intronic
1108210719 13:48137491-48137513 CACCCTTTAAATGGCCTTCCTGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113174368 13:107545552-107545574 CAGGCTCCAACTGTCCTTCAGGG - Intronic
1114736916 14:25051152-25051174 CAGGCTCAAAAGTGCCTTCCGGG - Intergenic
1117753305 14:58946065-58946087 AAGGCTGCAAAAGGCATTCCTGG - Intergenic
1118821578 14:69349438-69349460 CAGGCTCCCGATGGCATTCTGGG + Intronic
1119418848 14:74494047-74494069 CAGGCTCCTCACGGCCTCCCTGG + Exonic
1120981017 14:90289131-90289153 CAGGCACCAAATGACCTACAGGG + Exonic
1123063499 14:105605045-105605067 CAGGCACCAAATGGACGACCCGG - Intergenic
1123087559 14:105723831-105723853 CAGGCACCAAATGGACGACCCGG - Intergenic
1124492831 15:30168583-30168605 CAGGGGCCAAGTGGCCATCCTGG - Intergenic
1124750703 15:32369742-32369764 CAGGGGCCAAGTGGCCATCCTGG + Intergenic
1124802995 15:32853005-32853027 CAGGCTACAAAGGGCATTCCAGG - Intronic
1125396619 15:39255650-39255672 AATGGTCCAAATGGCATTCCTGG - Intergenic
1131700061 15:94925507-94925529 CAAACTCCAACTGGTCTTCCGGG - Intergenic
1132361379 15:101219001-101219023 CAGGCTCCAGTCGGCCTGCCTGG + Intronic
1132582409 16:691049-691071 CAGCCTCCCAACGGCTTTCCTGG + Intronic
1133553551 16:6882776-6882798 CAGGATGCAAGTGGCATTCCTGG + Intronic
1134134062 16:11668366-11668388 CGGGCTCCCATTGGCCTTTCTGG + Intergenic
1137424456 16:48365901-48365923 GAGGCTCCAAATGGCTCTCCCGG - Exonic
1140477702 16:75247234-75247256 CAAGCCCCCAAAGGCCTTCCTGG - Intronic
1141014523 16:80436283-80436305 CAGCCTGTAAATGGCCTTGCTGG - Intergenic
1141264668 16:82486150-82486172 CAGGGTCCAAATGGCTTTTATGG + Intergenic
1141733246 16:85836092-85836114 CAGGCTCCCCCTGGCCTTTCTGG + Intergenic
1145067324 17:19770621-19770643 CAGCCTCTAAAGGGCTTTCCTGG + Intergenic
1148157463 17:45432124-45432146 CAGGGTGCAAATGACCTCCCCGG - Intronic
1148688876 17:49515419-49515441 CTGGCTCCAGATGGCCTAGCAGG + Intergenic
1151759531 17:76092788-76092810 CAGGCTCCCAATTGCCTCCAGGG + Intronic
1151819684 17:76490796-76490818 CAGGCTCCACCTTGCCTGCCTGG + Intronic
1152887119 17:82859031-82859053 CAGGCTCCCCATGGCCTCTCGGG - Intronic
1156729208 18:40170003-40170025 CTTGCTCCATATGACCTTCCGGG + Intergenic
1157574852 18:48736739-48736761 TAGGCCCCACATGGCCCTCCTGG + Intronic
1158636035 18:59158933-59158955 CAGGCCCTAAATAGCCTGCCTGG - Intergenic
1163397161 19:17070349-17070371 CAGCCTCCAACTGCCCTTCAGGG + Intronic
1164429052 19:28170670-28170692 CAGGCTCCAAATGTAATTTCTGG - Intergenic
1164653653 19:29903932-29903954 CAGGGTCCAAATGGCTTCTCTGG - Intergenic
1165221923 19:34323553-34323575 CAGCCTCCAATTAGCATTCCAGG - Intronic
1167537249 19:50062044-50062066 AAGACTCCAAGTGGGCTTCCTGG + Intergenic
1168219391 19:54949693-54949715 CAGGCTCCAAGTGGCCTCCAGGG + Intronic
925797865 2:7566320-7566342 TAGGCTCCAGAAGGGCTTCCTGG + Intergenic
927501139 2:23584152-23584174 CAGGCTCCAGCCGGCCTCCCAGG + Intronic
928649786 2:33391985-33392007 CAGGCTCCAAAAGCCCTTGCTGG - Intronic
929051155 2:37838190-37838212 CAGACTCCACATGGCCAGCCTGG + Intergenic
933315901 2:80714748-80714770 GAGATTCCAAATGGCCTTCTTGG + Intergenic
933403162 2:81824389-81824411 CAGGCTCTGAAATGCCTTCCTGG + Intergenic
938491530 2:131763706-131763728 CAGGCTCCAAATGTACACCCAGG + Intronic
938577640 2:132619341-132619363 CAGGCTCCATATGTCCTGGCTGG + Intronic
942387153 2:175454518-175454540 CAGCCTACAAATGGCATTTCAGG - Intergenic
942946632 2:181680761-181680783 CATGCGCCATATGGTCTTCCCGG + Exonic
943528818 2:189052783-189052805 CAGGGTCCTAATGGTGTTCCTGG - Exonic
946818801 2:223609206-223609228 CTTGCTCCACATAGCCTTCCAGG - Intergenic
946864910 2:224034284-224034306 CAGGCTCAAAAAGGCCTTGCTGG - Intronic
1170448426 20:16455741-16455763 CAGGCTACAAACTGCCTGCCAGG + Intronic
1170529187 20:17272800-17272822 CAGTCTTCAAATAGCCTCCCTGG - Intronic
1170570845 20:17631691-17631713 CAGGCCCCAAGAGGCCGTCCGGG + Intronic
1171291442 20:23985065-23985087 CAGGCTCCAGGTGGCCTCCCTGG - Exonic
1172044619 20:32071545-32071567 CTGGCTCCCACTGGCCTTCCCGG - Intronic
1173401257 20:42728038-42728060 CTGGCTCCAGACGACCTTCCAGG + Intronic
1173726064 20:45298557-45298579 CAAGGTCCACGTGGCCTTCCCGG + Exonic
1175304985 20:57969655-57969677 CTGACTTCAAATGGCCTTCATGG + Intergenic
1175466775 20:59194674-59194696 GAGGGTCCCAATGGCCCTCCTGG + Exonic
1176149271 20:63581122-63581144 CAGGATCTAAAAGGCCTCCCAGG + Intergenic
1176654689 21:9578034-9578056 CAGGCTCCAAGTGGACTACATGG - Intergenic
1177132723 21:17277666-17277688 CAGACTCCCACTGTCCTTCCTGG - Intergenic
1178719215 21:34993039-34993061 AAGGCCCCAGATGCCCTTCCTGG - Intronic
1180260224 21:46663318-46663340 CAGTCTCCACATGGCCCTCGGGG - Intronic
1180765957 22:18346028-18346050 CAGGCTCCAGGTGGCCTCCCTGG + Intergenic
1180780356 22:18516350-18516372 CAGGCTCCAGGTGGCCTCCCTGG - Exonic
1180813072 22:18773671-18773693 CAGGCTCCAGGTGGCCTCCCTGG - Intergenic
1180920494 22:19519232-19519254 GAGGCTCCAGGTGGCCTTCGAGG - Intronic
1180940835 22:19658737-19658759 CAGGCTCCACATGGACACCCAGG + Intergenic
1181174978 22:21030190-21030212 CGGGCTCCTCACGGCCTTCCTGG - Exonic
1181199249 22:21207987-21208009 CAGGCTCCAGGTGGCCTCCCTGG - Exonic
1181521843 22:23452746-23452768 CCTGCTCCCACTGGCCTTCCTGG - Intergenic
1181702496 22:24628968-24628990 CAGGCTCCAGGTGGCCTCCCTGG + Exonic
1181913381 22:26258379-26258401 CAGAATCCAAAAGGGCTTCCTGG + Intronic
1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG + Intergenic
1182834038 22:33326948-33326970 CAGTCTCCAAAGGACCCTCCAGG - Intronic
1184831534 22:46991936-46991958 CACCCTCCAAGTGGTCTTCCAGG + Intronic
1185358984 22:50393740-50393762 CATGCTGCAGATGGACTTCCAGG + Intronic
1203227576 22_KI270731v1_random:86919-86941 CAGGCTCCAGGTGGCCTCCCTGG + Intergenic
952505631 3:34004628-34004650 CAAGCTCCACAAGGCCTTCTTGG - Intergenic
954110121 3:48429061-48429083 CAGTCTCCCAATCGCGTTCCAGG + Intronic
954135764 3:48581464-48581486 CAGGGTCCCATTGGCCTTACTGG - Exonic
954569563 3:51629343-51629365 CAGGCTCCAATTGATCCTCCCGG - Exonic
956297502 3:67730151-67730173 CAGGCTCTTACTGGCCTCCCTGG - Intergenic
960843126 3:121980309-121980331 CAGGTTTCAAATGGACTTCCTGG - Intergenic
961001701 3:123378581-123378603 CGGGCTCCAGATGGCCTCGCTGG + Intronic
962041052 3:131707857-131707879 AAGGCTCCAAATAGTCTCCCTGG + Intronic
966705794 3:182912037-182912059 CAGGCTGTAAAGGGCCTTCAAGG + Intronic
968439110 4:612656-612678 CAGGCTCCTGCTGGTCTTCCTGG - Intergenic
969746468 4:9076634-9076656 CAGGATCAGAATGGCCTCCCAGG - Intergenic
971268553 4:25115670-25115692 CAGGCTCCCAAAGGTCTTTCAGG - Intergenic
971425153 4:26508668-26508690 CATGCTTCATATGGCCTTGCTGG - Intergenic
972678707 4:41285184-41285206 CAGGCCCCAAATGCTCTACCTGG + Intergenic
976262335 4:83157695-83157717 CAAGCTACAAATGCCCTTCCAGG - Intergenic
979274401 4:118799092-118799114 CAGCCTCCACATGGTCTCCCTGG - Intronic
980866129 4:138555327-138555349 CATGCTCAAAATGGACTCCCCGG + Intergenic
983519172 4:168688682-168688704 GAGGATCCAAATGGCAATCCTGG + Intronic
985707497 5:1409960-1409982 CAGGGGCCACATGGCCGTCCAGG + Intronic
989016948 5:36947502-36947524 CAGGCTCCAATTGACTTTTCTGG + Intronic
991361203 5:65822393-65822415 AAGGCTACAAATAGCCTTCTGGG - Intronic
992831897 5:80601604-80601626 CAGGATGCAACTGGCCTTCTGGG + Intergenic
994014204 5:94946207-94946229 CAGGATGCTAATGGCCTGCCAGG + Intronic
997412250 5:133699264-133699286 CCAGCTCCAAATGGCCTGACTGG - Intergenic
998487103 5:142512448-142512470 CGGCCTCCAAATGGGCTGCCTGG + Intergenic
1000343909 5:160298391-160298413 CAGCCCGCAAATTGCCTTCCTGG - Intronic
1000948608 5:167452591-167452613 CTTTCTCAAAATGGCCTTCCTGG + Intronic
1001855085 5:175003897-175003919 AAGGCTGAAACTGGCCTTCCAGG + Intergenic
1001888987 5:175323260-175323282 CATGCTCCAAATGGAACTCCTGG - Intergenic
1001982054 5:176044480-176044502 CAGGCTCCAAGTGGATGTCCAGG - Intergenic
1002235408 5:177799577-177799599 CAGGCTCCAAGTGGATGTCCAGG + Intergenic
1003096767 6:3148368-3148390 AAGGCTCCCACTGGCCTGCCTGG - Intronic
1003381186 6:5625827-5625849 CAGGCTCCAGATGGTCTCTCCGG + Intronic
1003793646 6:9575652-9575674 CAGGCTCCAAATGGTTTTGATGG + Intergenic
1004808932 6:19238575-19238597 AAAGCTCCAAATAGCCCTCCTGG + Intergenic
1005023133 6:21436672-21436694 CAAGCTCCAAACTGGCTTCCTGG - Intergenic
1007309101 6:40930976-40930998 CAGACTCAATATGGTCTTCCAGG - Intergenic
1007392136 6:41555581-41555603 CAGGCTCCAGATGGCCATTCAGG + Intronic
1007782244 6:44261107-44261129 CTGGCTCCATGAGGCCTTCCCGG + Intronic
1012371750 6:98515529-98515551 GAGGCTGAAAATGGGCTTCCAGG + Intergenic
1017727998 6:157288861-157288883 CAGGCTCAGAGTGGCCTTCCAGG - Intergenic
1019568211 7:1695199-1695221 CAGGGTCCTGGTGGCCTTCCTGG - Intronic
1019589496 7:1823740-1823762 CCTGCTCCCACTGGCCTTCCTGG + Intronic
1023843478 7:44109012-44109034 CAGGCCCCAGGTGGCCTTCAGGG - Intronic
1024588379 7:50860297-50860319 CAGACTCCAAAAGGGGTTCCTGG - Intergenic
1025035079 7:55588859-55588881 CAGGGTCCCAATGGATTTCCTGG + Intergenic
1025281309 7:57627892-57627914 CAGGCTCCAAATGGACAGCATGG - Intergenic
1025303420 7:57837615-57837637 CAGGCTCCAAATGGACAGCATGG + Intergenic
1025848228 7:65219107-65219129 CAGACTTCAAGTGGGCTTCCTGG + Intergenic
1025898463 7:65724973-65724995 CAGACTTCAAGTGGGCTTCCTGG + Intergenic
1027454544 7:78373120-78373142 CATGATCAAAATGGCATTCCTGG - Intronic
1029144479 7:98436086-98436108 CAGACTTCAAATGGGCTGCCCGG + Intergenic
1029449838 7:100634661-100634683 CAGGCCCTAAAGGGCCTTACTGG - Intronic
1030042409 7:105464070-105464092 CAGTCTACAAATGGCCATCCTGG + Intronic
1036808031 8:11848417-11848439 CAGGCTACGAGTGCCCTTCCGGG + Intronic
1037927497 8:22855518-22855540 CAGCCTCCAAAAGGCCTGCAGGG - Intronic
1039278460 8:35956790-35956812 CAAGGTCCAAATGTCCTGCCCGG + Intergenic
1039858108 8:41433856-41433878 CAGGTCACAAATGGCCTTCATGG + Intergenic
1040017093 8:42708568-42708590 CATGCTCCAAGTTGCCTTTCAGG + Intronic
1040738391 8:50539720-50539742 CAGGCTCCAATTTCCCTGCCAGG - Intronic
1042567419 8:70126654-70126676 CAGGCCCCAACTGTCCTCCCAGG + Intronic
1042742738 8:72068987-72069009 CCGGCTCCAAAGGGCCTGACCGG - Intronic
1043322532 8:79007534-79007556 CAGTCTCCAGAGTGCCTTCCTGG - Intergenic
1043364978 8:79522081-79522103 CAGACTCTAATTGGCCATCCTGG + Intergenic
1043478436 8:80627959-80627981 CAGGCTCCCAGAGGCCCTCCAGG - Intergenic
1045544674 8:103117969-103117991 CTGGATCCATATGGCCTTGCTGG - Intergenic
1047917035 8:129593593-129593615 GAGGCTCCAACTGGCTTTCTGGG - Intergenic
1048012488 8:130469458-130469480 CAGGCTGCTAACTGCCTTCCAGG + Intergenic
1049308075 8:141918032-141918054 CAGGCTGCATGTGCCCTTCCGGG - Intergenic
1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG + Intronic
1053147092 9:35719120-35719142 CAGGCAGCAAAGGGCCTTGCGGG - Exonic
1057780264 9:98044203-98044225 CAGCTTCCATATGCCCTTCCTGG + Intergenic
1060281368 9:122217973-122217995 CAGGCTCCAGAGGGACTTGCTGG - Intronic
1060560655 9:124540032-124540054 CAGGCTCCACACTGTCTTCCAGG - Exonic
1060775261 9:126368386-126368408 CAGGCTCCAAAGCCCCTTCCTGG - Intronic
1060890494 9:127184936-127184958 CAGCATCCAAGTGGCCTGCCTGG - Intronic
1061327875 9:129875113-129875135 AAGGCTCCAAGCTGCCTTCCTGG - Intronic
1062111447 9:134784353-134784375 GAGTCTCTAAATGCCCTTCCCGG - Intronic
1203632409 Un_KI270750v1:81492-81514 CAGGCTCCAAGTGGACTACATGG - Intergenic
1195791051 X:108586717-108586739 CAGGGTCCACCTGGCCTTCCTGG + Exonic
1201866312 Y:18659241-18659263 CAGTGTGCATATGGCCTTCCAGG - Intergenic
1202029482 Y:20556867-20556889 AAGGCTTGAAAAGGCCTTCCAGG - Intergenic