ID: 1077424094

View in Genome Browser
Species Human (GRCh38)
Location 11:2466362-2466384
Sequence CCTACTTTGCAGGAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 442}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077424080_1077424094 1 Left 1077424080 11:2466338-2466360 CCCTCCCCAGGCTGGGGTTTGTC 0: 1
1: 0
2: 2
3: 32
4: 291
Right 1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 442
1077424074_1077424094 16 Left 1077424074 11:2466323-2466345 CCTGGCTGGGACTTCCCCTCCCC 0: 1
1: 0
2: 4
3: 51
4: 443
Right 1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 442
1077424079_1077424094 2 Left 1077424079 11:2466337-2466359 CCCCTCCCCAGGCTGGGGTTTGT 0: 1
1: 1
2: 1
3: 38
4: 280
Right 1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 442
1077424084_1077424094 -5 Left 1077424084 11:2466344-2466366 CCAGGCTGGGGTTTGTCCCCTAC 0: 1
1: 0
2: 1
3: 9
4: 207
Right 1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 442
1077424081_1077424094 0 Left 1077424081 11:2466339-2466361 CCTCCCCAGGCTGGGGTTTGTCC 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 442
1077424083_1077424094 -4 Left 1077424083 11:2466343-2466365 CCCAGGCTGGGGTTTGTCCCCTA 0: 1
1: 0
2: 0
3: 13
4: 176
Right 1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 442
1077424082_1077424094 -3 Left 1077424082 11:2466342-2466364 CCCCAGGCTGGGGTTTGTCCCCT 0: 1
1: 0
2: 4
3: 23
4: 273
Right 1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077424094 Original CRISPR CCTACTTTGCAGGAGGAGGG GGG Intronic
901268686 1:7933581-7933603 GCTACTTGGCAGGATGAGGCAGG + Intronic
901544707 1:9947297-9947319 CCTACTTGGGAGGCGGAGGTGGG - Intronic
902174965 1:14642286-14642308 CCTACTTGGCAGGCTGAGGCAGG + Intronic
902350803 1:15852966-15852988 GCTACTTTGCAGGCTGAGGTGGG - Intronic
902573671 1:17363228-17363250 GCTACTTTGGAGGCTGAGGGAGG - Intronic
902719152 1:18292533-18292555 CCTGTTTTCCAGGAGGCGGGTGG + Intronic
903686745 1:25137210-25137232 CTTCCTCTGCAGGAAGAGGGTGG - Intergenic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
905570171 1:38997602-38997624 GCTACTCTGCAGGGGGAGGCGGG - Intronic
905640848 1:39588850-39588872 CCTACTTGGGAGGAGGAGGTAGG - Intergenic
906469511 1:46116404-46116426 CCTACTTGGGAGGCTGAGGGAGG + Intronic
907149394 1:52269239-52269261 CCTACTTTGGAGGCTGAGGCAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908559145 1:65287713-65287735 CCTACTTGGGAGGATGAGGCAGG - Intronic
909831047 1:80190491-80190513 CCTATTCTGCTGGAGGAAGGTGG - Intergenic
910353021 1:86321329-86321351 CCTACTTGGCAGGCTGAGGCAGG - Intergenic
910449548 1:87331610-87331632 CCTCATTTGCTGGAGGCGGGCGG + Intronic
911245061 1:95507768-95507790 CCCACTTTACAGGAGTAGGAAGG - Intergenic
912719465 1:112007345-112007367 CATAATTTGCATGAGAAGGGAGG + Intergenic
915129823 1:153688522-153688544 CCTACAGGGCAGGAGGCGGGAGG - Intronic
915219206 1:154360513-154360535 CCTACTTAGGAGGATGAGGTGGG - Intergenic
916659938 1:166914001-166914023 CCTACTTGGGAGGCTGAGGGAGG + Exonic
918335765 1:183511048-183511070 GCTACTTTGCAGGCTGAGGCAGG + Intronic
918724105 1:187895543-187895565 GCTACTTGGCAGGATGAGGTAGG - Intergenic
918827575 1:189345613-189345635 CCTACTTTGGAGGCTGAGGCTGG - Intergenic
919684158 1:200466436-200466458 AGTACTTTGCAGGCGGATGGTGG + Intergenic
919781278 1:201222691-201222713 CCAACTGTGAGGGAGGAGGGAGG + Intronic
919996346 1:202754794-202754816 GCTACTTGGGAGGTGGAGGGAGG - Intronic
920050191 1:203159904-203159926 CAGACTTTGCAGGAGGAGTGAGG + Intronic
920449398 1:206047806-206047828 CCTAGGATGCAGAAGGAGGGAGG - Intronic
921491941 1:215787930-215787952 GCTACTTGGCAGGTTGAGGGAGG + Intronic
923475853 1:234330495-234330517 CCTACTCTGGAGGCTGAGGGAGG - Intergenic
923782953 1:237042281-237042303 CGCACTGTGCGGGAGGAGGGCGG - Exonic
924128496 1:240880908-240880930 TATTCTTTGCAGGAAGAGGGAGG + Intronic
924310274 1:242734194-242734216 GCTACTTTGGAGGCGGAGGTGGG + Intergenic
924664361 1:246055349-246055371 CCTACTCTGCAGGCTGAGGCAGG + Intronic
1062887836 10:1032510-1032532 GCTACTCAGCAGGAGGAAGGAGG - Intergenic
1063058914 10:2530607-2530629 CCTACTTGGGAGGCGGAGGCAGG - Intergenic
1063382821 10:5596983-5597005 ACCTCTTTGCAGGAGGCGGGTGG - Intergenic
1064261811 10:13792219-13792241 CCATCTTTGCAGGAGGATGCTGG + Intronic
1064654161 10:17540036-17540058 GCTACTTTGCAGGCTGAGGCGGG - Intergenic
1065654214 10:27930400-27930422 GCTACTTGGGAGGATGAGGGAGG + Intronic
1066055796 10:31678926-31678948 CCTACTTTTCTGGAGGAATGGGG - Intergenic
1066087556 10:31985790-31985812 GCTACTTGGGAGGAGGAGGTGGG - Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1066691007 10:38028154-38028176 GCTACTTGGGAGGATGAGGGAGG + Intronic
1067479815 10:46587416-46587438 CCTCCTGGGGAGGAGGAGGGAGG + Intronic
1067614922 10:47754381-47754403 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1069286010 10:66716391-66716413 CTTATTTTGCAGCAGGTGGGTGG - Intronic
1069864788 10:71495313-71495335 CCTCCTTCGCGGCAGGAGGGTGG + Intronic
1071137423 10:82468266-82468288 CCTCCCTTGCATGAGAAGGGTGG + Intronic
1071630327 10:87214345-87214367 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1072119777 10:92396114-92396136 CCTACTTGGGAGGCTGAGGGAGG + Intergenic
1073137135 10:101226311-101226333 CCGACTTGGCCAGAGGAGGGTGG - Exonic
1073464042 10:103683548-103683570 CCTACTTGGGAGGATGAGGTGGG + Intronic
1073793354 10:106962014-106962036 CCTGCTTTGCATCAGGAGGTTGG + Intronic
1074607873 10:114992189-114992211 CCTACTTTGCAGGATTTTGGAGG - Intergenic
1075106061 10:119540906-119540928 CCCACTTTGCAGGTGGAGAAAGG + Intronic
1075171741 10:120121789-120121811 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1076518152 10:131061718-131061740 CCAGCTCTGCAGGAGGAGGATGG - Intergenic
1077306128 11:1869428-1869450 GCTGCCTTGAAGGAGGAGGGAGG + Intronic
1077412170 11:2408696-2408718 CCTGCGGGGCAGGAGGAGGGAGG + Intronic
1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG + Intronic
1077528793 11:3085517-3085539 GCAACTTTGCAGGAGGTGGAAGG - Intergenic
1077635016 11:3836442-3836464 CCTACATTGCAGCAGCAGGTAGG + Intronic
1079219807 11:18550232-18550254 CCTACTTGGCAGGCTGAGGCTGG - Intronic
1079323663 11:19473336-19473358 CATACTCTGCAGGAGGGGGTGGG + Intronic
1080202936 11:29694463-29694485 CCATTTTTGCAGGAGTAGGGTGG + Intergenic
1080480825 11:32648046-32648068 CCTACTTTGCAGAAGATTGGAGG - Intronic
1081587955 11:44400304-44400326 CCTCCTTTGGGGGAGGAGGGAGG + Intergenic
1082971624 11:59028655-59028677 GCTACTTTGGAGGCTGAGGGAGG + Intronic
1083022365 11:59520047-59520069 CCTACTTGAGGGGAGGAGGGTGG + Intergenic
1083022833 11:59524797-59524819 GCTACTTGGCAGGCGGAGGCAGG - Intergenic
1083323318 11:61860794-61860816 CCTACTTTGGAGGCTGAGGTAGG + Intronic
1084672100 11:70613313-70613335 CCTACTTGGGAGGCGGAGGCAGG - Intronic
1085818984 11:79771697-79771719 CTTACATGGCAGCAGGAGGGAGG - Intergenic
1087283134 11:96234367-96234389 GCTACTTGGGAGGAGGAGGCAGG + Intronic
1088032375 11:105266979-105267001 GCTACTTGGGAGGCGGAGGGAGG - Intergenic
1089512291 11:119007293-119007315 CCTACTTAGCAGGCTGAGGCAGG - Intronic
1090159642 11:124479056-124479078 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1090169140 11:124582819-124582841 CCACCTTACCAGGAGGAGGGTGG - Intergenic
1090482002 11:127077213-127077235 GCTACTTGGGAGGATGAGGGAGG + Intergenic
1092104816 12:5913871-5913893 CCTCCTTTTCAGGAAGAGGTCGG - Intronic
1092528706 12:9326773-9326795 CCTCCTCAGCGGGAGGAGGGGGG + Intergenic
1092533332 12:9363425-9363447 CCTGCTGTGGAGGAGGAGGGTGG - Intergenic
1092872172 12:12815037-12815059 CCAACTTTACAGGATTAGGGTGG + Intronic
1093030976 12:14288260-14288282 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
1094117880 12:26937718-26937740 CCCACTTTGCTGGAGGGTGGGGG + Intronic
1095605549 12:44063087-44063109 CACATTCTGCAGGAGGAGGGAGG - Intronic
1096312705 12:50535476-50535498 GCTACTTGGCAGGCTGAGGGAGG - Intronic
1096536343 12:52277540-52277562 CCAGCTCTGCAGGAGGAGGGTGG + Intronic
1097879183 12:64671646-64671668 CTTCCTTGGCAGGAGGAGGAAGG + Intronic
1098069004 12:66651751-66651773 CCTAACTTTGAGGAGGAGGGAGG + Intronic
1099181412 12:79475338-79475360 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1099444345 12:82734458-82734480 GCTAGTTTGAAGGTGGAGGGAGG - Intronic
1100190948 12:92190961-92190983 CCTACTTGGGAGGCTGAGGGAGG + Intergenic
1101103495 12:101418373-101418395 GCTACTTGGGAGGAGGAGGCAGG - Intergenic
1102027214 12:109720340-109720362 CCTCCCTTGGAGGAGGAGGGAGG + Intronic
1102835401 12:116053616-116053638 CCTACTTTGAAGCAGAAGGGAGG + Intronic
1103247928 12:119474144-119474166 CGTTCTTTGCAGGAGTAAGGTGG - Intronic
1103596288 12:122026153-122026175 CCTACTTGGGAGGATGAGGCAGG + Intronic
1103687937 12:122746990-122747012 CCTACTTTGGAGGCTGAGGCTGG + Intergenic
1104303233 12:127585472-127585494 GCTACTTGGCAGGCTGAGGGAGG + Intergenic
1104360977 12:128132888-128132910 CCCAATTTGAAGGAGGAAGGAGG + Intergenic
1104559817 12:129833511-129833533 GCTACTTGGGAGGAGGAGGTGGG + Intronic
1104952050 12:132445553-132445575 CCTTCCTTGCAGGGGGAGTGGGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106471768 13:30062357-30062379 CCTACTTGGGAGGATGAGGCAGG - Intergenic
1109064893 13:57674436-57674458 CCTACTTTGAAGGCTGAGGTAGG - Intronic
1109235708 13:59815977-59815999 CCTACTTTGGAGTAGGGTGGAGG + Intronic
1109734978 13:66471210-66471232 CCTTTTTTCAAGGAGGAGGGAGG + Intronic
1110053930 13:70940830-70940852 GCTACTTTGAAGGCTGAGGGTGG + Intergenic
1110736514 13:78943367-78943389 GCTACTTTGGAGGCTGAGGGGGG - Intergenic
1112288912 13:98127906-98127928 GCTACTTGGGAGGCGGAGGGAGG - Intergenic
1112330885 13:98476244-98476266 CCCACTCTGCAGGGGGCGGGGGG - Intronic
1112345373 13:98584865-98584887 AGTACTCAGCAGGAGGAGGGAGG + Intergenic
1115163157 14:30418473-30418495 CCTAATTTTCTGGAGGAGGGAGG + Intergenic
1115574630 14:34698680-34698702 CCTACTTGGAAGGCTGAGGGAGG + Intergenic
1116144830 14:41051947-41051969 CCTACTTGGCAGGCTGAGGCAGG - Intergenic
1116689888 14:48091952-48091974 CCTACTCTGGAGGATGAGGTGGG + Intergenic
1117150958 14:52887399-52887421 ACTACTTGGGAGGCGGAGGGAGG + Intronic
1117619326 14:57568331-57568353 GCTACTTTGCAGCAGCAAGGTGG + Intronic
1117645791 14:57850982-57851004 GCTTTTTTGCAGGAAGAGGGTGG - Intronic
1118448715 14:65877161-65877183 TCTACTTTGCTGGTTGAGGGTGG + Intergenic
1118743318 14:68756804-68756826 CCAACTCTCCTGGAGGAGGGTGG - Intergenic
1119033016 14:71207164-71207186 CCTCTTTTGCACGAGGAGGTAGG - Intergenic
1119235829 14:73018317-73018339 CCTACTTGGGAGGCGGAGGAAGG + Intronic
1119882982 14:78116221-78116243 CCTAATTTGAAGGTGGAGGGAGG - Intergenic
1120164864 14:81186836-81186858 CCTACTCAGGAGGATGAGGGTGG + Intronic
1120736729 14:88061299-88061321 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1121125860 14:91406390-91406412 CTCACAGTGCAGGAGGAGGGAGG + Intronic
1121257974 14:92545219-92545241 CCTACTTTGGAGGCTGAGGCAGG - Intronic
1121262220 14:92574724-92574746 CCTGCTCTGCTGGAGGAGAGGGG + Intronic
1122619809 14:103049286-103049308 CCTGCTTGGCTGAAGGAGGGTGG + Intronic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1123219115 14:106840264-106840286 GCTACGTTGAAGGAGGATGGTGG - Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1123652991 15:22491530-22491552 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1124369578 15:29096257-29096279 CCTCCTTGGCAGAAGAAGGGAGG - Intronic
1124805444 15:32877173-32877195 GCTACTTTGCAGGCTGAGGCAGG + Intronic
1124988799 15:34650267-34650289 CCTTCTTTGAGGGAGGAGGGAGG - Intergenic
1125093911 15:35828758-35828780 GCCAATTTGCAGGAGGAGAGAGG + Intergenic
1125587473 15:40831020-40831042 CTTCCTGAGCAGGAGGAGGGGGG + Intergenic
1125759171 15:42085266-42085288 GATGCTTTGCAGGAGGAGAGGGG + Intronic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1126732664 15:51699949-51699971 CCTCCTTTCAAGGAGGAGGGTGG + Intronic
1127285863 15:57533187-57533209 CCCACTCTCCATGAGGAGGGTGG - Intronic
1128473005 15:67972185-67972207 GCTACTTAGGAGGAGGAGGTAGG - Intergenic
1129229932 15:74191431-74191453 CCTCCTTTGCAGGAAGAAGCTGG - Exonic
1131368933 15:91863634-91863656 CCTACATTTCAGGAGGAGGTTGG - Intronic
1131373298 15:91902556-91902578 CCTACATGGGAGTAGGAGGGAGG + Intronic
1132120787 15:99173472-99173494 CCTACTTCGCAGGCTGAGGCAGG + Intronic
1132596970 16:756818-756840 TCTACTTGGGAGGAGGAGGTGGG - Intronic
1133940711 16:10306878-10306900 GCTACTTTGGAGGATGAGGTAGG + Intergenic
1134209563 16:12264668-12264690 CCTACTTGGGAGGCTGAGGGAGG + Intronic
1134528215 16:14961178-14961200 GCTACTTTGGAGGCGGAGGTGGG - Intergenic
1135597741 16:23756292-23756314 CCCACCTTGGAGGAGGGGGGAGG - Intronic
1135871825 16:26158281-26158303 CCTACTTTTCAAGAGGAGCCGGG - Intergenic
1136498997 16:30660244-30660266 CCTTCTGTGGAGGAGGAGGTGGG - Exonic
1136638114 16:31538621-31538643 CCTACTCTGGAGGGGGAGGTGGG + Intergenic
1138070741 16:53990777-53990799 GCTACTTTGGAGGCGGAGGCAGG - Intronic
1139061398 16:63257244-63257266 CCTACTTTGAGTGGGGAGGGTGG - Intergenic
1139134053 16:64179871-64179893 CCTTTCTTGCAGGAGGAAGGTGG - Intergenic
1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG + Intergenic
1139940112 16:70599466-70599488 GCTACTTTGGAGGATGAGGCAGG - Intronic
1140465620 16:75179678-75179700 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1141769416 16:86080319-86080341 CTGACTTTGCAGGTGGAGGGAGG + Intergenic
1141815961 16:86409401-86409423 CCCACTTTGGAAGAGGGGGGAGG - Intergenic
1142716340 17:1748901-1748923 CCTACCTGGCAGGAGGACTGAGG + Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143435510 17:6921725-6921747 CCGCCTTTTCAGGAGGAGGAAGG + Intronic
1143589719 17:7875081-7875103 GCTACTTGGGAGGATGAGGGAGG + Intronic
1144362993 17:14513941-14513963 GCTACTTTGCAGGCTGAGGTGGG - Intergenic
1147473728 17:40689356-40689378 CCAACTTGGGAGGAGGTGGGTGG - Intergenic
1147558665 17:41495893-41495915 CAAACTCTGCAGGAGGATGGAGG + Intergenic
1147733764 17:42620863-42620885 GCTACTTGGCAGGCGGAGGCAGG - Intergenic
1148289907 17:46436116-46436138 GCTACTTGGCAGGTGGAGGTGGG - Intergenic
1148312075 17:46653688-46653710 GCTACTTGGCAGGTGGAGGTGGG - Intronic
1149038469 17:52159334-52159356 CCCCCTTTTCGGGAGGAGGGAGG - Intronic
1149573693 17:57696215-57696237 CCAACATGGCGGGAGGAGGGAGG - Intergenic
1150017514 17:61573241-61573263 GCTACTTGGGAGGATGAGGGAGG - Intergenic
1150111096 17:62500179-62500201 CCTACTTGGCAGGCTGAGGCGGG - Intronic
1150564725 17:66328684-66328706 GCTACTTGGCAGGATGAGGCAGG + Intronic
1150700459 17:67442741-67442763 GCTACTTTGGAGGATGAGGCAGG + Intronic
1151290695 17:73147873-73147895 CCTGCTTGGCAAGAGGAGAGAGG - Intergenic
1151629766 17:75302471-75302493 CCTACTATGGAAGAAGAGGGGGG + Intergenic
1152216872 17:79038375-79038397 CCCCCTTTACAGGAGGAGGGAGG - Intronic
1152330329 17:79669019-79669041 CGGACCTTGCAGGATGAGGGTGG + Intergenic
1152437183 17:80283597-80283619 CCTGCCTTGCAGGAGGGGAGTGG - Intronic
1152695409 17:81741507-81741529 CCCCTTTTGCAGGAGGATGGGGG + Intergenic
1153106929 18:1538203-1538225 CCTACTTTGCAGGAAAGAGGAGG - Intergenic
1153284743 18:3447864-3447886 CAAACTTTCCAGGAGAAGGGGGG - Intronic
1153361242 18:4199202-4199224 CCTTCTGTCCTGGAGGAGGGTGG + Intronic
1153952708 18:10070534-10070556 CCTGCTTCGCAGGTGGATGGAGG - Intergenic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1154108753 18:11548110-11548132 GCTACATTGAAGGAGGATGGCGG - Intergenic
1154211924 18:12386837-12386859 GCTACTTTGGAGGATGAGGTGGG - Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1155290962 18:24341105-24341127 GCTACTTGGGAGGCGGAGGGAGG - Intronic
1155926638 18:31662727-31662749 CCTACTTGGGAGGTGGAGGCAGG + Intronic
1155969114 18:32064628-32064650 CCTACTTGGCAGGCTGAGGCAGG - Intronic
1156235823 18:35203856-35203878 CATACTTAGCAGAAGGAGTGGGG - Intergenic
1156462759 18:37330835-37330857 GCCACTTTGCTGGAGGAGGGAGG - Intronic
1156503104 18:37572202-37572224 CCTCCTTTGTAGGAGGTGGGAGG - Intergenic
1158461844 18:57653394-57653416 GCTACTTGGCAGGATGAGGTGGG - Intronic
1160162320 18:76483164-76483186 CCTGCTTTGCTGGAGAAGGCAGG + Intronic
1160841366 19:1148242-1148264 CTTTCTATGCAGGAGGAGAGTGG - Intronic
1162112508 19:8407487-8407509 CCTACTTAGGAGGAGGAGATGGG + Intronic
1162124496 19:8492041-8492063 CCTACTTGGGAGGTTGAGGGAGG - Intronic
1162212668 19:9105080-9105102 GCTACTTTGGAGGACGAGGCAGG - Intergenic
1162338335 19:10075567-10075589 GCTACTTTGCAGGCTGAGGTGGG + Intergenic
1163277408 19:16294035-16294057 CCTACTTAGGAGGCTGAGGGTGG - Intergenic
1163372115 19:16907107-16907129 CCCACCCTGCAGGAGGAGAGAGG - Exonic
1164931067 19:32176643-32176665 CCTACCTTGCAGGAGCAGAGAGG - Intergenic
1165303188 19:34985693-34985715 CCTGCTTGCCAGGAGGAGGTGGG - Intergenic
1167093831 19:47362880-47362902 GCTACTTGGCAGGTGGAGGTAGG - Intronic
1167490551 19:49790508-49790530 CCTACTTGGCAGGCTGAGGTGGG - Intronic
1167844811 19:52153547-52153569 GCTACTTTGGAGGCTGAGGGAGG - Intergenic
1168076470 19:53982994-53983016 CCTGCTTCGGAGGGGGAGGGGGG - Exonic
1168534435 19:57157441-57157463 GCTACTTGGCAGGCTGAGGGAGG - Intronic
925812188 2:7711636-7711658 CCTGGTTTGCAGGTGGAGGGTGG - Intergenic
926810918 2:16754835-16754857 CCCACTTTGAAGGATGAGGGGGG - Intergenic
927792034 2:26017884-26017906 CCTGCTCTGCAGGAATAGGGGGG + Intergenic
928679104 2:33680755-33680777 CCTCCACTGCAGGTGGAGGGTGG + Intergenic
929300821 2:40301972-40301994 GCTACTTTGCAGGCTGAGGCAGG - Intronic
929534151 2:42770089-42770111 CCTATTTTGGAAGGGGAGGGAGG + Intronic
929820042 2:45265947-45265969 GCTACTTTGGAGGCGGAGGCAGG - Intergenic
931876986 2:66524448-66524470 GCTACTTGGGAGGAGGTGGGAGG + Intronic
932154171 2:69400515-69400537 CCAACTGTGCAGGAAGATGGAGG - Exonic
932352829 2:71045900-71045922 CCTACTATCCAGAGGGAGGGAGG - Intergenic
932601675 2:73131453-73131475 CCTACTTGGGAGGTGGAGGCAGG + Intronic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934507509 2:94905638-94905660 TCTACTATGCAGGGGGTGGGGGG + Intergenic
934740873 2:96721610-96721632 GCTACTTTGCAGGCTGAGGCAGG - Intronic
936398817 2:112150468-112150490 CCTAAATTGCAGGAGGACTGAGG - Intronic
936525188 2:113236563-113236585 CCTCCCTGGCAGGTGGAGGGCGG - Intronic
936633523 2:114230358-114230380 CCATCTTTGCAGGAGTAAGGAGG + Intergenic
937986995 2:127642461-127642483 TCTGGTTTGGAGGAGGAGGGGGG - Intronic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
938711319 2:133978281-133978303 CCTACTGGGAAGCAGGAGGGAGG + Intergenic
939104626 2:137934893-137934915 CCTACTTAGCAGAGGGAGTGAGG + Intergenic
940039454 2:149344934-149344956 CCTACTTGGCAGGCTGAGGCAGG + Intronic
940046585 2:149416466-149416488 CCTAATTGGCAGGAAGAGGCAGG - Intronic
941718302 2:168786837-168786859 GCTACTCTGGAGGAGGGGGGAGG - Intronic
944072547 2:195689308-195689330 CCTACTTAGGAGGCGGAGGCAGG + Intronic
944128419 2:196319430-196319452 TCTTCCTTGGAGGAGGAGGGAGG - Exonic
944313844 2:198264512-198264534 GCTACTTTGCAGGCTGAGGCAGG + Intronic
945681132 2:212915977-212915999 CCTACATTCAAGGAGCAGGGTGG - Intergenic
946431551 2:219629296-219629318 CCTCCCATCCAGGAGGAGGGGGG + Exonic
947160079 2:227206183-227206205 GCTACTTGGCAGGCTGAGGGAGG - Intronic
948385430 2:237577831-237577853 CCCACTGTGGAGGAGGATGGGGG + Intronic
949026364 2:241768174-241768196 CCTCCTTTGCAGGGCGAGGTGGG + Exonic
949038496 2:241832933-241832955 AATACTTTGCAGGCGGAGGCAGG + Intergenic
1169279216 20:4252899-4252921 GCTACTTGGCAGGCGGAGGCAGG + Intergenic
1169599882 20:7246020-7246042 CCTACTTTGGAGGCTGAGGCAGG - Intergenic
1170729672 20:18962448-18962470 CTTACATTGCAGGAGGGAGGAGG - Intergenic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1171564748 20:26171163-26171185 CCTAATTCGGAGCAGGAGGGAGG + Intergenic
1171875745 20:30574043-30574065 CCTACTTTGGAGGCTGAGGTGGG + Intergenic
1175434484 20:58933614-58933636 CCTACTTGGGAGGATGAGGCAGG + Intergenic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1177219859 21:18178697-18178719 CCTACTCAGCATGAAGAGGGTGG - Intronic
1177557000 21:22703703-22703725 CTTACATGGCAGCAGGAGGGTGG - Intergenic
1178613719 21:34111327-34111349 CCTCCTTGGCAGGAAGCGGGTGG - Intronic
1179115241 21:38485569-38485591 GCTACTTGGGAGGCGGAGGGAGG - Intronic
1179220338 21:39401159-39401181 CCTACTTAGCAGGCTGAGGCAGG - Intronic
1179809199 21:43859447-43859469 CCCACTTTGCAGGAGGAGATGGG + Intergenic
1179822073 21:43942796-43942818 CTCACTTGGCGGGAGGAGGGTGG + Intronic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180921926 22:19525460-19525482 CCATCCTTGCTGGAGGAGGGAGG + Intronic
1180955290 22:19738677-19738699 CCTGCTTTGGAGGAGGGGGTGGG - Intergenic
1181155097 22:20915278-20915300 CCTACTTGGCAGGCTGAGGCAGG + Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181300431 22:21876290-21876312 CCTACTTTGGAGGCTGAGGCTGG - Intergenic
1182614450 22:31577517-31577539 CCTACTTCGTAGGCTGAGGGGGG - Intronic
1182775788 22:32830067-32830089 CCGACATTTCAGGAGGAGGAAGG + Intronic
1183116005 22:35693293-35693315 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183116951 22:35699667-35699689 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949201399 3:1384013-1384035 CTTACTTTGAGGGAGGAGGCAGG - Intronic
949514132 3:4792078-4792100 GCTGCTTTGAAGGTGGAGGGAGG - Intronic
950458320 3:13105728-13105750 GCTACTCTTCACGAGGAGGGAGG - Intergenic
951854875 3:27185176-27185198 TCTACTTTGGAGGAGCAGGCTGG - Intronic
952581072 3:34834180-34834202 GCTACTTGGGAGGATGAGGGAGG + Intergenic
953545186 3:43859269-43859291 CCTTCTTTAAGGGAGGAGGGAGG - Intergenic
953988609 3:47465655-47465677 CCTACTTAGCAGGCTGAGGTGGG + Intronic
954538482 3:51378738-51378760 CAGACTTTTCAGGAGGAGAGAGG - Intronic
955218918 3:57007841-57007863 CCTGTTATGCAGGAGGAGAGGGG - Intronic
955525000 3:59810709-59810731 TGTACTTTGGAGGGGGAGGGTGG - Intronic
955695526 3:61632194-61632216 GCTACTTTGCAGGCTGAGGCAGG + Intronic
956310282 3:67871037-67871059 GCTACTTGGGAGGTGGAGGGAGG + Intergenic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
956742942 3:72289225-72289247 CCCAGTTTGCAGGAGGTGGGAGG - Intergenic
956826436 3:73001460-73001482 GCTACTTGGGAGGAGGAGGTAGG + Intronic
956879033 3:73491705-73491727 GCTACTCTGTAGGAGGTGGGAGG - Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
957422014 3:79982564-79982586 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
957905690 3:86552432-86552454 GCTACTTGGCAGGATGAGGCAGG - Intergenic
959982214 3:112528946-112528968 CCTAATATCCAGGAGGAGAGAGG + Intergenic
960249843 3:115439640-115439662 CCTACATAGTGGGAGGAGGGAGG + Intergenic
960736810 3:120790257-120790279 CCTACCTTTCAGGTAGAGGGTGG - Intergenic
960884731 3:122382981-122383003 GCTGCTCTGTAGGAGGAGGGAGG - Intronic
960979175 3:123205574-123205596 GCTACTTGGCAGGATGAGGCAGG + Intronic
962154006 3:132924887-132924909 GCTCCTTTGCGGGGGGAGGGGGG - Intergenic
962198924 3:133385519-133385541 CCTCCTTTGGAGGCTGAGGGAGG - Intronic
962607446 3:137044529-137044551 TATACTTGGCAGAAGGAGGGTGG - Intergenic
964604938 3:158550370-158550392 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
966362731 3:179148154-179148176 CCTCTTCTGCCGGAGGAGGGGGG + Intronic
967311149 3:188107487-188107509 CCTACCTTACAGCAGGAGTGGGG - Intergenic
968092890 3:195909326-195909348 CCGGCGGTGCAGGAGGAGGGCGG - Intronic
968822416 4:2864719-2864741 TCTACTCTCCAGGAGGTGGGGGG + Intronic
968834614 4:2954526-2954548 CCCACTTTGGAGGAGGCGGTGGG - Exonic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
970824284 4:20253602-20253624 CCTGCTCTGCCAGAGGAGGGTGG + Exonic
972623288 4:40770096-40770118 CCTACTTGGGAGGATGAGGCAGG + Intronic
975326257 4:73062166-73062188 GCTACTTGGGAGGAGGAGGCGGG - Intronic
976750842 4:88450144-88450166 TCTACTTTCCTGGAGGATGGAGG - Intergenic
977386772 4:96350045-96350067 CCTACTTGGGAGGATGAGGCAGG + Intergenic
977615136 4:99080190-99080212 TTTTCTTTGCAGCAGGAGGGAGG + Intronic
979127756 4:116997975-116997997 CCTACTTTGGAGGTTGAGGCAGG + Intergenic
979704390 4:123704641-123704663 GCTACTTAGCAGGATGAGGCAGG + Intergenic
980001315 4:127492129-127492151 CCTACATTGAAAGAGGAGGAAGG + Intergenic
980352999 4:131706556-131706578 CCTACTTGGTAGGCTGAGGGAGG - Intergenic
981533579 4:145776347-145776369 GCTACTTGGGAGGAGGAGGTGGG + Intronic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
983819633 4:172176675-172176697 GCTACTGTGCAGGCTGAGGGAGG + Intronic
984409797 4:179382284-179382306 ACTAATTTGGAGCAGGAGGGTGG - Intergenic
985021796 4:185699396-185699418 GCTACTCTGCAGGATGAGGCAGG - Intronic
985812447 5:2099646-2099668 CTTTCTATGCAGGAGGAGTGGGG - Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
987435481 5:17887839-17887861 CATACATTGGAGGAAGAGGGTGG + Intergenic
987538464 5:19219016-19219038 GCTACTTTGCAGGCTGAGGCAGG + Intergenic
988175927 5:27724807-27724829 CTTACATGGCAGCAGGAGGGCGG - Intergenic
989009511 5:36854574-36854596 TCCACTTTCCAGGAGTAGGGGGG + Intergenic
990052781 5:51528890-51528912 CATCCTTTGCAGCAGGAGGTGGG + Intergenic
991520525 5:67492470-67492492 CCTACTTTACAACAGGAGGCAGG + Intergenic
992255829 5:74920086-74920108 GCTACTTTGGAGGATGAGGCAGG + Intergenic
994106228 5:95952296-95952318 CCTACTTTGAGGGTGGAGGGTGG + Intronic
994510502 5:100697447-100697469 CCTACTTGGAAGGCTGAGGGAGG - Intergenic
994863713 5:105235098-105235120 CATACTTTGAAGGAGGTGGGAGG - Intergenic
995088169 5:108140155-108140177 ACTACTTGGCAGGATGAGGCAGG - Intronic
995658991 5:114460352-114460374 CCTACTTGGGAGGCTGAGGGAGG - Intronic
995909961 5:117174996-117175018 CCTACTTGGGAGGATGAGGCAGG + Intergenic
996092980 5:119369163-119369185 CCTACTTGGGAGGCTGAGGGAGG - Intronic
997341154 5:133145624-133145646 CCTGCTGTTCAGGAGGATGGTGG - Intergenic
997422632 5:133781189-133781211 CGTAGTTTGCAGGAGGTGGGAGG - Intergenic
997603687 5:135157366-135157388 CCCACCTGGCATGAGGAGGGAGG + Intronic
998974379 5:147628131-147628153 GCTACTTTGGAGGCTGAGGGAGG - Intronic
999254362 5:150201855-150201877 CCTACTTCATGGGAGGAGGGTGG - Intronic
999968229 5:156832585-156832607 GCTACTTTGGAGGATGAGGTGGG + Intergenic
1000806328 5:165797737-165797759 CCTACTTTGGAGGCTGAGGCAGG - Intergenic
1001473646 5:172033841-172033863 CCTACTGTCCAGGAGGGGTGTGG + Intergenic
1001653242 5:173329730-173329752 CCTGTTCTCCAGGAGGAGGGTGG - Intergenic
1002694598 5:181076510-181076532 CCTACTTGGGAGGATGAGGCAGG - Intergenic
1003193780 6:3897060-3897082 CCTACTTTGGAGGCTGAGGCAGG - Intergenic
1003531565 6:6941398-6941420 GCTACTTGGCAGGCTGAGGGAGG + Intergenic
1003788640 6:9516652-9516674 CTTCCTTGGCAGGAGGAGGAAGG + Intergenic
1004079523 6:12377988-12378010 GCTACTTTGCAGGCTGAGGCAGG - Intergenic
1004733334 6:18380387-18380409 ACTATTTTGCGGGAAGAGGGAGG + Intergenic
1005305401 6:24508807-24508829 CCAACCTTGCAGGAGTAAGGTGG + Intronic
1005787121 6:29255436-29255458 GCTACTTTGGAGGCGGAGGCAGG + Intergenic
1005822490 6:29609046-29609068 GCTACTTTGGAGTAGGAGTGGGG + Intronic
1005836642 6:29714438-29714460 CCTAATCTCCAGGAGGAGGTTGG + Intergenic
1006514142 6:34536700-34536722 ACTCCCTTGTAGGAGGAGGGTGG - Intergenic
1007362380 6:41368198-41368220 CCTACTTAGAAGGATGAGGTGGG + Intergenic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1007996919 6:46317571-46317593 CCTACTTGGGAGGATGAGGCAGG - Intronic
1009333819 6:62459874-62459896 CCTACTCTGGAGGCTGAGGGAGG - Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1009363066 6:62837728-62837750 CCTAATATCCAGGAGGGGGGAGG + Intergenic
1010126701 6:72440819-72440841 CCTACTTTGTGGGGGGTGGGGGG - Intergenic
1010743347 6:79533331-79533353 TGTTCGTTGCAGGAGGAGGGGGG + Intronic
1011683732 6:89807196-89807218 GCTACTTGGCAGGATGAGGCAGG - Intronic
1015343221 6:132126405-132126427 CCTACATGGCAGGAGGGGAGAGG + Intergenic
1017014054 6:150085487-150085509 CCTACTTGGGAGGATGAGGTGGG + Intergenic
1017852695 6:158318835-158318857 CCTACTTGGCAGGCTGAGGTGGG - Intronic
1019306811 7:339504-339526 CCTACTTGGGAGGCTGAGGGCGG - Intergenic
1019961186 7:4461325-4461347 CTTTCTCTGGAGGAGGAGGGGGG - Intergenic
1021208694 7:17816547-17816569 GCTACTTGGGAGGATGAGGGAGG + Intronic
1022088711 7:27094039-27094061 CCTACTTTCAAGGACAAGGGAGG + Exonic
1022105611 7:27194484-27194506 CCTATTTTTCAGGAGGTGGCTGG + Intronic
1022427722 7:30284724-30284746 CCTCCTTCGCAGGGGGAGCGAGG + Exonic
1022893339 7:34723475-34723497 CTTTCTGTGCAGGAGGAAGGGGG + Intronic
1022910773 7:34898164-34898186 GCTACTTGGCAGGATGAGGTGGG - Intergenic
1023162159 7:37307999-37308021 GCTACTTGGCAGGATGAGGCAGG + Intronic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1025196833 7:56940530-56940552 CCGACTCTGCAGGAGGGGCGAGG - Intergenic
1025273037 7:57543369-57543391 CCTAATTCGGAGCAGGAGGGAGG - Intergenic
1025615275 7:63112684-63112706 CCTACAGTACAGGAGGAGGCTGG - Intergenic
1025675115 7:63636407-63636429 CCGACTCTGCAGGAGGGGCGAGG + Intergenic
1025925861 7:65959852-65959874 CCTACTTGGGAGGATGAGGCAGG + Intergenic
1026545712 7:71320346-71320368 CCTACTTGGGAGGCTGAGGGAGG - Intronic
1026602074 7:71785344-71785366 GCCACTGTGCAGGAGTAGGGAGG - Exonic
1026641048 7:72125912-72125934 CCTACTTGGGAGGCTGAGGGAGG - Intronic
1027134750 7:75616379-75616401 CCTACTTGGGAGGTGGAGGTGGG - Intronic
1027575576 7:79926561-79926583 CCTACTCAGCAGGCTGAGGGGGG - Intergenic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1029570953 7:101368786-101368808 ACTACTTTGAAGTAGGAGGCGGG - Intronic
1029989886 7:104953368-104953390 GCTACTTGGGAGGAGGTGGGAGG - Intergenic
1030019372 7:105257993-105258015 CCTACTCTGGAGGGGGAGGCAGG + Intronic
1030246743 7:107391086-107391108 TCTACTTGGTGGGAGGAGGGGGG + Intronic
1031063123 7:117074277-117074299 CCTACTTTGGAGGTTGAGGCAGG + Intronic
1031192436 7:118570986-118571008 CTTACTTGGCAGGAGGAGAAAGG + Intergenic
1032040294 7:128554088-128554110 CCTACTTGGCAGGCTGAGGCGGG - Intergenic
1032331407 7:130984099-130984121 CCTATTTTGCAGGAGGAAAATGG - Intergenic
1032912735 7:136452290-136452312 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
1033657327 7:143382394-143382416 CCTCCTCCGGAGGAGGAGGGAGG + Exonic
1033756662 7:144402217-144402239 CCTGCTTTGCAGGGAGGGGGAGG - Intronic
1034457464 7:151178819-151178841 CCTAGCTTGGAGGAGGAGTGAGG - Intronic
1035229519 7:157456145-157456167 CCTACTTAGGAGGCTGAGGGAGG - Intergenic
1035666300 8:1382628-1382650 GCTACTTTGCAGGCTGAGGTGGG + Intergenic
1035832721 8:2714999-2715021 CCTACTTTCCAGGAGAAGACTGG - Intergenic
1035963597 8:4165513-4165535 CCTACTTGGCAGGCTGAGGTGGG - Intronic
1036143927 8:6235337-6235359 GCTACTTGGCAGGATGAGGCAGG - Intergenic
1036607061 8:10316883-10316905 CCTACTTTCCAGCAGAAGGTAGG + Intronic
1037192319 8:16141603-16141625 TATACTCTGCATGAGGAGGGAGG + Intronic
1037876175 8:22549730-22549752 ACAGCTTTGCAGGAGGAGGCGGG - Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1038555279 8:28508001-28508023 CCTACTTTGGAGGCTGAGGTAGG - Intronic
1040559141 8:48508562-48508584 CCGACATTGCAGGTGGAGAGAGG - Intergenic
1043474478 8:80592931-80592953 GCTACTTGGGAGGATGAGGGAGG - Intergenic
1043633760 8:82366850-82366872 CCTACTCTCCAGGAGGGGAGAGG + Intergenic
1043634907 8:82374056-82374078 CGTACTTTCCAGGAAGAGAGAGG + Intergenic
1044570865 8:93717093-93717115 GCTACTTGGCAGGCTGAGGGAGG - Intronic
1045388072 8:101690069-101690091 CCTGATGTGCTGGAGGAGGGAGG + Intronic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1046032326 8:108797882-108797904 GGGACTTTGGAGGAGGAGGGAGG + Intergenic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1046571891 8:115976509-115976531 CTTTAATTGCAGGAGGAGGGTGG + Intergenic
1047654569 8:126962996-126963018 CATACTTTGCTGGAGGAAAGGGG - Intergenic
1049308771 8:141922333-141922355 CATACTTCGCAGGAGGAGCATGG + Intergenic
1049558342 8:143294978-143295000 CCTACTTGGGAGGCGGAGGGAGG + Intronic
1049635773 8:143688367-143688389 CCTGCTGTGCTGGAGGTGGGAGG + Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050206725 9:3204368-3204390 CCTGCTTTGGAGGAGAAGTGGGG - Intergenic
1050553891 9:6772471-6772493 CCTACTTGGGAGGATGAGGCAGG - Intronic
1051099772 9:13507478-13507500 CCTACTTTTCATGGGGTGGGTGG - Intergenic
1051200066 9:14607533-14607555 GCTACTTTTGGGGAGGAGGGTGG + Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1057406293 9:94773875-94773897 CCTACTTGGCAGGATGAGGTGGG - Intronic
1058216073 9:102235340-102235362 ACTACTTGGCAGGATGAGGTAGG + Intergenic
1058521236 9:105815772-105815794 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058522037 9:105821077-105821099 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1058995180 9:110292381-110292403 CCTCCTTTGCAGGACGAGGTGGG - Intergenic
1060184252 9:121554204-121554226 CCAACTTTGCAGGAGGAGGCAGG + Intergenic
1060195659 9:121621756-121621778 CCTACTTGGGAGGCGGAGGCAGG - Intronic
1060428261 9:123524877-123524899 GCTACCTTGCAGGAGGAGATGGG + Intronic
1060675443 9:125510242-125510264 TGTAGTTTGCAGGAGGAAGGAGG - Intronic
1060676577 9:125520744-125520766 TCTACTTTGGAGGAAGAGGTAGG - Intronic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062199303 9:135293075-135293097 TCTACTTTTCCAGAGGAGGGAGG - Intergenic
1062508245 9:136889393-136889415 CCTACTCTGGAGGATGAGGCAGG - Intronic
1187263187 X:17706078-17706100 CCTACTTAGGAGGTGGAGGTGGG + Intronic
1190243127 X:48673129-48673151 GCTACTTGGCAGGCTGAGGGAGG + Intergenic
1190742342 X:53297774-53297796 CCTAGATTGCAGCAGGAAGGTGG - Intronic
1190815359 X:53924560-53924582 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
1190975106 X:55391514-55391536 CCATTTTTGCAGGAGTAGGGTGG - Intergenic
1191220553 X:57984204-57984226 GCTACTTTGGAGGCTGAGGGAGG - Intergenic
1192243781 X:69357001-69357023 CCTTCTATGCATGAGGAGAGGGG + Intergenic
1193189553 X:78553373-78553395 CCATCCTTGCAGGAGGAAGGTGG - Intergenic
1193873688 X:86833909-86833931 CCTATGTTGTTGGAGGAGGGAGG - Intergenic
1195278190 X:103302949-103302971 GCTACTTTGGAGGATGAGGCTGG + Intergenic
1196176713 X:112646339-112646361 CCTGGTTTGCGGGGGGAGGGGGG + Intronic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic
1196303005 X:114068109-114068131 CCTACTCTGGAGGATGAGGTAGG - Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic