ID: 1077424890

View in Genome Browser
Species Human (GRCh38)
Location 11:2470665-2470687
Sequence TGGGGTTCCCTCGGCCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 15, 3: 87, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077424877_1077424890 25 Left 1077424877 11:2470617-2470639 CCAACCGCACATCCATCATGGCC 0: 1
1: 0
2: 2
3: 7
4: 112
Right 1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG 0: 1
1: 0
2: 15
3: 87
4: 311
1077424879_1077424890 13 Left 1077424879 11:2470629-2470651 CCATCATGGCCCTGAACTCAGCT 0: 1
1: 1
2: 12
3: 67
4: 315
Right 1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG 0: 1
1: 0
2: 15
3: 87
4: 311
1077424878_1077424890 21 Left 1077424878 11:2470621-2470643 CCGCACATCCATCATGGCCCTGA 0: 1
1: 0
2: 1
3: 24
4: 203
Right 1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG 0: 1
1: 0
2: 15
3: 87
4: 311
1077424883_1077424890 3 Left 1077424883 11:2470639-2470661 CCTGAACTCAGCTTCCAGGGTTT 0: 1
1: 3
2: 2
3: 51
4: 320
Right 1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG 0: 1
1: 0
2: 15
3: 87
4: 311
1077424882_1077424890 4 Left 1077424882 11:2470638-2470660 CCCTGAACTCAGCTTCCAGGGTT 0: 2
1: 4
2: 11
3: 36
4: 369
Right 1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG 0: 1
1: 0
2: 15
3: 87
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077424890 Original CRISPR TGGGGTTCCCTCGGCCAAGT GGG Intronic
900134599 1:1110283-1110305 TGGGGTCCCCTTGACCAAGAGGG + Intronic
900142309 1:1143780-1143802 TGGGGTCCCCTCGGCCAGGCGGG + Intergenic
900436322 1:2632936-2632958 TGGGGTGAGCTGGGCCAAGTGGG + Exonic
900978172 1:6030258-6030280 TGGGGTTGCCTGGTCCAGGTGGG + Intronic
901428206 1:9196975-9196997 TGGGATTCCCTGGGACATGTGGG - Intergenic
901753006 1:11423255-11423277 TGGGGTTCCCTTGGCCAAGAGGG - Intergenic
902773833 1:18661725-18661747 CTGGGCTCCCTCGGCCAACTGGG + Intronic
904996902 1:34638435-34638457 TGAGGTTCCTTTGGCCAAGAGGG + Intergenic
905672472 1:39801034-39801056 TGGTGTCCCCTTGGCCAAGGGGG - Intergenic
906206488 1:43990188-43990210 TGGGGTCCCCTTGGCCAAAAGGG + Intronic
906872213 1:49495433-49495455 TTGGATTCCCTGGGCCATGTTGG - Intronic
908496546 1:64700320-64700342 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
909277575 1:73708217-73708239 TGGTGATCCCTTGGCCAAGAGGG - Intergenic
911014656 1:93319470-93319492 TTGGCTTCCCTGGGCCATGTTGG - Intergenic
911688832 1:100808343-100808365 TTGGCTTCCCTTGGCCATGTTGG + Intergenic
913163772 1:116167700-116167722 AGGGGTTCACCCGGCCCAGTGGG - Intergenic
914003892 1:143716328-143716350 TGGGGTTCCTGGGGCCAACTTGG + Intergenic
915818522 1:158996121-158996143 TGGGGTCCCCTTGGCCAAGAAGG + Intergenic
917064087 1:171072954-171072976 CGGGGTTCCCTTGGCCAAGAGGG - Intergenic
917151697 1:171952559-171952581 TGGGGTTCCCTTGGCCCAGAGGG + Intronic
917530967 1:175834678-175834700 TGGAGTTACCTTGGCCAAGAGGG - Intergenic
917737997 1:177937783-177937805 TGGGGTCCCCTTGGCCAAAAGGG - Intronic
919482348 1:198105839-198105861 TGGGGTTCCCTTGGCCAAAAGGG - Intergenic
920187456 1:204169329-204169351 TGGGGTCCCCTTAGCCAAGAGGG - Intergenic
920285679 1:204877605-204877627 GGGGGTCCCCTTGGCCAAGAGGG + Intronic
920362782 1:205430710-205430732 TGGGGGTCCCCCGGCTGAGTGGG - Intronic
920436456 1:205950080-205950102 TGGGATTCCCTGAGCAAAGTGGG + Intergenic
920918705 1:210279945-210279967 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
921497367 1:215857945-215857967 TGGTGTCCCCTTGGCCAAGTGGG + Intronic
921596389 1:217057895-217057917 TTGGCTTCCCTGGGCCACGTTGG - Intronic
923208239 1:231778851-231778873 TGGGGTCTCCTTGGCCAAGAGGG - Intronic
923317580 1:232796230-232796252 TGGGGTCCCCTTGGCCCATTGGG - Intergenic
923717136 1:236434621-236434643 TGGGCTTCCCTGGGCCACATTGG - Intronic
924278538 1:242412291-242412313 TGGGGTCCCCTTGGTCAAGAAGG + Intronic
1063254335 10:4309458-4309480 TGGAGTCCCCTTGGCCAAGAGGG + Intergenic
1063278884 10:4602612-4602634 TGGGGTCTCCTTGGCCAAGAGGG - Intergenic
1063405282 10:5788512-5788534 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1064160705 10:12943303-12943325 CGGGGTTCCCTTGGCCAAGATGG - Intronic
1064694057 10:17948153-17948175 TTGGGTCCCCTTGGCCAAGAGGG - Intergenic
1065609782 10:27461661-27461683 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1065674989 10:28164744-28164766 TTGGGTTCCCTGGGCCACATTGG - Intronic
1065696533 10:28385733-28385755 TGGGGTCCGTTTGGCCAAGTTGG + Intergenic
1065838901 10:29683814-29683836 AGGGGTTCTCTGGGGCAAGTTGG - Intronic
1065908580 10:30281523-30281545 TGGGGTCCTCTTGGCCAAGAAGG + Intergenic
1066302272 10:34107566-34107588 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1066661452 10:37741240-37741262 TGGGGTACCCTTGGCCAAGAGGG + Intergenic
1067474519 10:46556909-46556931 TGGGGTTGCGTCGGGGAAGTGGG - Intergenic
1068988013 10:63124656-63124678 TGGGGTCTCCTTGGCCAAGAGGG + Intergenic
1069575736 10:69527213-69527235 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1069775051 10:70921948-70921970 TAGGGTTCCCTCTGCCAGGAGGG + Intergenic
1070048022 10:72858618-72858640 TGGGGTCCCCTTGGCCAAGAGGG + Intronic
1071828811 10:89351970-89351992 TGGGGTCCCCGTGGCCAAGAGGG - Intronic
1071834239 10:89404056-89404078 TGGGGTCTCCTTGGCCAAGAGGG - Intronic
1072395495 10:95035693-95035715 TGAGGTTCCCTTGTCCAAGCAGG - Intergenic
1073128064 10:101164644-101164666 TGGGGTCCCCTTGGCCAACAGGG + Intergenic
1074522309 10:114236899-114236921 TGGGGTCCCCTTGGACAAGAGGG + Intergenic
1075737222 10:124671352-124671374 TGGGGTCCCCTAGCCCAAGGTGG + Intronic
1075741772 10:124700368-124700390 AGGGGTTCCCTCGGCCTGGTGGG - Intronic
1075931122 10:126296927-126296949 TGGGATTCCTTCAGCCAAGCTGG + Intronic
1076050792 10:127331606-127331628 TGGGGTCCCTTTGGCCAAGAAGG + Intronic
1076459782 10:130633968-130633990 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1076796047 10:132798990-132799012 TGGGGTTGCCTCTTCCAAGGAGG - Intergenic
1076823013 10:132951035-132951057 TGGGGTCCCCTTGGCCCAGAGGG + Intergenic
1076997574 11:306216-306238 TGGAGCTCCCTTGGCCAAGGGGG - Intergenic
1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG + Intronic
1079420941 11:20287350-20287372 TTGGGTCCCCTTGGCCAAGAAGG + Intergenic
1080915654 11:36656126-36656148 CAGGGCTCCCACGGCCAAGTTGG - Intronic
1081274640 11:41133512-41133534 TGGGATCCCCTTGGCCAAGAGGG - Intronic
1083069393 11:59961262-59961284 TGGGGTCCTCTTGGCCAAGATGG - Intergenic
1083349216 11:62015316-62015338 TGGGGTCACCTTGGCCAAGAGGG + Intergenic
1083359120 11:62093159-62093181 TGGGGTCCTCTTGGCCAAGAGGG + Intergenic
1083360330 11:62102861-62102883 TGGGGTCCTCTTGGCCAAGAGGG - Intergenic
1083720329 11:64600640-64600662 TGGGTCTCCCTGGGCCAAGCGGG + Intronic
1084877814 11:72146523-72146545 TGGGGTCTCCTTGGCCAAGAGGG - Intergenic
1084883114 11:72186179-72186201 TGGGGTCTCCTTGGCCAAGATGG - Intergenic
1085496013 11:76970227-76970249 TGGGGTCCCCTTGGCCAAGAGGG + Intronic
1088561739 11:111122211-111122233 TGGGATTCCTTTGGCCAAGAGGG - Intergenic
1088757512 11:112898275-112898297 TGGTGTCCCCTGGGCCAAGTCGG - Intergenic
1090103139 11:123823029-123823051 TGGGGTCTCCTTGGCCAAGAGGG + Intergenic
1090215423 11:124958422-124958444 TTGGCTTCCCTGGGCCATGTTGG - Intronic
1090825099 11:130379630-130379652 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1092128518 12:6092171-6092193 TGGGGTCCCTTTGGCCAAGGGGG - Intronic
1093368831 12:18340206-18340228 TTGGCTTCCCTGGGCCATGTTGG + Intronic
1093396472 12:18689518-18689540 TTGGCTTCCCTGGGCCACGTTGG - Intronic
1093574486 12:20710988-20711010 TTGGGTTCCCTGGGCCACATTGG + Intronic
1094285147 12:28784178-28784200 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1094446213 12:30533390-30533412 TGGGGTCCTCTTGGCCAAGAGGG - Intergenic
1095482440 12:42650202-42650224 TGGGGTTCCCTCAGCCAAGAGGG - Intergenic
1098606885 12:72402186-72402208 TTGGCTTCCCTGGGCCATGTTGG + Intronic
1099905619 12:88766241-88766263 TGGTGTTCTCTTGGCCAAGAGGG - Intergenic
1100727377 12:97423063-97423085 TGAGGTCCCCTTGGCCAAGAGGG - Intergenic
1101913168 12:108876045-108876067 TGGGGTTCCCTTTGCCAAGAAGG - Intronic
1101920957 12:108932606-108932628 TGGGGTCCCCTTGGCCAAGAAGG - Intronic
1106141703 13:27017321-27017343 TGGGGTCCCCTTGGCTAAGACGG + Intergenic
1107155803 13:37165935-37165957 TGGAGTGCCCTTGGCCAAGAGGG - Intergenic
1108199928 13:48032763-48032785 TGGCATTCCCTTGGCCAAGTTGG + Intergenic
1110133608 13:72037882-72037904 TTGGCTTCCCTGGGCCATGTTGG + Intergenic
1110335928 13:74329759-74329781 TTGGCTTCCCTGGGCCACGTTGG - Intergenic
1111559642 13:89928720-89928742 TGGGGTCCTCTAGGCCAAGAGGG - Intergenic
1113158464 13:107352318-107352340 TGGGGTCCCCTTGGCCAGGAGGG + Intronic
1113481975 13:110627912-110627934 TGGGGTTCCCTCAGCCTCCTGGG + Intronic
1113509009 13:110837164-110837186 TGGGGTTCCATTGGCCAAAAAGG + Intergenic
1113742443 13:112720942-112720964 TGGGGTTCCTTTGGCCAAGAGGG + Intronic
1113742900 13:112723711-112723733 TGGGGTTCCCTTGACCAAGAAGG + Intronic
1115995197 14:39188745-39188767 TGGGGTCCCCTTGGCTAAGAGGG + Intergenic
1116993903 14:51303002-51303024 TGTGGTCCCCTTGGCCAAGAGGG + Intergenic
1117769368 14:59117644-59117666 TGGGGTTCCCTTGGACAACAGGG - Intergenic
1117979777 14:61330872-61330894 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1118977713 14:70691914-70691936 TAGGGTTCCCTTGGCCAAGAGGG + Intergenic
1119569521 14:75658075-75658097 TGGGGTCCCCTAGGCCAAGAGGG - Intronic
1120223800 14:81767252-81767274 TAGGGTCCCCTTGGCCAAGAGGG - Intergenic
1120541884 14:85761194-85761216 TTGGGTTCCCTGGGCCACATTGG - Intergenic
1121155549 14:91680819-91680841 TGGGGTTCCCTTGGCCAAGGGGG - Intronic
1121823768 14:96993558-96993580 TGAGGTTCCCTCTACCATGTCGG + Intergenic
1121960653 14:98256367-98256389 TGGGATTCCCTTGGCCAAGAGGG - Intergenic
1122657122 14:103269594-103269616 TGGGGTCCCCTTGGCCAAGAAGG - Intergenic
1123974099 15:25536215-25536237 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1124100676 15:26689930-26689952 TAGGGTGCCCTCGGCCAAGAGGG + Intronic
1124392590 15:29273089-29273111 CGGGGTCCCCTTGGCCAAGAGGG + Intronic
1125809417 15:42524855-42524877 TGGAGTTTCCTCCACCAAGTTGG - Intronic
1127571735 15:60250253-60250275 TAGGGTTCCCTAAGCTAAGTGGG - Intergenic
1128172499 15:65525369-65525391 TGGTGTCCCCTTGGCCAAGAAGG + Intergenic
1128211817 15:65908676-65908698 TGGGGTTCTCTGGGCCCTGTTGG - Intronic
1128315311 15:66655988-66656010 TGGGGTTCCCTTCGTGAAGTGGG + Intronic
1131410079 15:92200288-92200310 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1131453680 15:92566523-92566545 TGGGGTCCCCTTGGCCAACAGGG - Intergenic
1131515614 15:93074339-93074361 TGGGGTTCCGGCTGCCAGGTCGG + Intronic
1132493171 16:245584-245606 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1132596516 16:753425-753447 TGGGGTCCCCTTGGCCAAATGGG - Intronic
1133872912 16:9706211-9706233 TGGAGTCCCCTTGGCCAAGATGG - Intergenic
1134360750 16:13529020-13529042 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1135680880 16:24455701-24455723 GGGGGTTTCTTTGGCCAAGTGGG + Intergenic
1136048379 16:27633179-27633201 TGGGGTCCCCTTGGCCAAGAAGG + Intronic
1136653643 16:31695405-31695427 TTGGCTTCCCTGGGCCATGTTGG + Intergenic
1137494795 16:48961449-48961471 TGGGGTCCCCTTGGCCAAGAAGG + Intergenic
1137618859 16:49862810-49862832 TGGGGATCCTCCCGCCAAGTTGG - Intergenic
1139043910 16:63033348-63033370 TGAGGTTCCCTTGGCCAAGAGGG - Intergenic
1139581915 16:67878851-67878873 TGGGGTACCCTGGGCAGAGTTGG + Intronic
1141914745 16:87087576-87087598 TGGGGTCCTCTTGGCCAAGAGGG - Intronic
1142412305 16:89923031-89923053 CGGGGTTCCCAGGGCCAAGAGGG + Intronic
1143448107 17:7020407-7020429 GGGGTGTCCCTTGGCCAAGTGGG - Intergenic
1143995394 17:11002365-11002387 TGGGGTCTCCTTGGCCAAGAGGG - Intergenic
1144407264 17:14964218-14964240 TGGGGTCACCTTGGCCAAGAGGG + Intergenic
1144496227 17:15747313-15747335 TGGTGTTCCCTAGGCCACGAGGG + Intronic
1145285275 17:21501082-21501104 TGGGATTCCCTTGGCCAAGAGGG - Intergenic
1145286503 17:21510084-21510106 TGAGGTCCCCTTGGCCAAGAGGG + Intergenic
1145391110 17:22456234-22456256 TGAGGTCCCCTTGGCCAAGAGGG - Intergenic
1146103158 17:30005610-30005632 TGGGGTTCCCTTGGATAAGAGGG - Intronic
1150807355 17:68329730-68329752 TTGGCTTCCCTGGGCCATGTTGG + Intronic
1151648967 17:75453913-75453935 TAGGCTTCCCTGGGCCATGTTGG - Intronic
1151776757 17:76209567-76209589 TTGGGTTCCCTGGGCCACATTGG - Intronic
1152427301 17:80225279-80225301 TGGGGAATCCTCGGCAAAGTAGG - Intronic
1152621862 17:81368826-81368848 TGGGGGTCCCTCGGCCGACTTGG + Intergenic
1153444261 18:5154589-5154611 TGGGGTCCCCTTGGCCAAGAAGG - Intronic
1153787990 18:8551919-8551941 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1153993482 18:10420144-10420166 TGGGGTCCTCTTGGCCAAGTGGG + Intergenic
1155217361 18:23655192-23655214 TGGGATCCCCTGGGCCAAGAGGG - Intronic
1155669340 18:28349904-28349926 TGAGGTCCCCTTGGCCAAGAGGG + Intergenic
1155844125 18:30684341-30684363 TGGGATTCACTTGGCCAAGCGGG - Intergenic
1155940319 18:31796010-31796032 TGGGGTCCCCTTGGGCAAGTGGG + Intergenic
1158092947 18:53736812-53736834 TGGGGTCCTCTTGGCCAAGAGGG - Intergenic
1158726791 18:59980879-59980901 TGGGGTCTCCTTGGCCAAGAGGG + Intergenic
1158726798 18:59980899-59980921 GGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1158726807 18:59980919-59980941 GGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1158866266 18:61640298-61640320 TGGAGTCCCCTTGGCCAAGAGGG + Intergenic
1159601605 18:70433382-70433404 TGGGGTCCCCTGGACCAAGAGGG + Intergenic
1159920777 18:74225695-74225717 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1160160825 18:76468764-76468786 TTGGCTTCCCTCGGCCACATTGG - Intronic
1161742629 19:6032623-6032645 GGGGGCTCCCCCTGCCAAGTGGG - Intronic
1161826218 19:6567726-6567748 GGGGCTTCCCTTGGCCAAGGAGG - Intergenic
1162699335 19:12501964-12501986 TGGGGTTCCCTTGGCCAAGAAGG + Intronic
1164561436 19:29295015-29295037 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1164625843 19:29727365-29727387 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1165370027 19:35399215-35399237 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1165691709 19:37868716-37868738 TGGGGTTCCCTTGGCCAAGATGG + Intergenic
1167718745 19:51162699-51162721 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1168273404 19:55262568-55262590 TGGGGTTCCCACGGAGAAGGGGG + Exonic
1168377202 19:55890367-55890389 TTGGTTTCCCTGGGCCACGTTGG + Intergenic
924976764 2:184447-184469 TGGAGTTCTCTTGGCCAAGAGGG - Intergenic
925203301 2:1986424-1986446 TGGGATTCCCTGGCCCAAGAAGG + Intronic
925207811 2:2022081-2022103 TGCACTTCCCTCGGGCAAGTGGG + Intronic
926690203 2:15727847-15727869 TTGGTTTCCCTGGGCCACGTTGG + Intronic
927950377 2:27164240-27164262 TGGGGTCCCCTTGGCCAATAGGG - Intergenic
928816235 2:35297840-35297862 TGGGATCCCCTTGGCCAAGAAGG + Intergenic
931393582 2:61865818-61865840 TTGGCTTCCCTGGGCCACGTTGG - Intergenic
931664497 2:64600477-64600499 TGGGGGTCCTTGGGCCATGTTGG - Intergenic
932283234 2:70512673-70512695 TGGGGTTCCCTAGGCCCTGCTGG - Intronic
932743995 2:74316401-74316423 TGGGATCCCCTTGGCCAAGAGGG - Intronic
933582533 2:84143663-84143685 TGGGGTCCCCTTGGCCAAGAAGG - Intergenic
934025337 2:87997596-87997618 TGGGGTCCCCTTGGCCAAGATGG + Intergenic
935619147 2:105113449-105113471 TGGGGCCCCCTTGGCCAAGAGGG - Intergenic
935665483 2:105508449-105508471 TGGGGTCCCTTTGGCCAAGAGGG + Intergenic
939325274 2:140680033-140680055 TTGGGTTCCCTGGGCCACATTGG - Intronic
942080513 2:172395751-172395773 TGTGGTTCTCTGGGCCAAATAGG - Intergenic
942625348 2:177894490-177894512 TTGGGTCCCCTTGGCCAAGAGGG - Intronic
943576543 2:189637633-189637655 TTGGGTCCCCTGGGCCAAGTTGG - Intergenic
944006886 2:194920467-194920489 TGGGGTTCTCTTGGCCAAGGGGG - Intergenic
944192700 2:197020424-197020446 TTGGCTTCCCTGGGCCACGTTGG + Intronic
945925549 2:215799766-215799788 TGTGGTCCCCTTGGCCAAGAGGG - Intergenic
945968414 2:216212583-216212605 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
946119536 2:217497590-217497612 TGGGGTCCCCTTGGCCAAGAGGG + Intronic
946189678 2:218001806-218001828 TGGGCTTGCCTGGGCCAAGAGGG + Intronic
948433066 2:237932765-237932787 TTGGCTTCCCTGGGCCAATTTGG - Intergenic
948681577 2:239638686-239638708 TGGGGTCCCCTTGGCCAAGATGG - Intergenic
948851126 2:240706527-240706549 TTGGGTCCCCTTGGCCAAGAAGG + Intergenic
949031923 2:241801471-241801493 TGGGGTCCCCTTGGCCAAGATGG + Intronic
949039611 2:241841857-241841879 AGGGGGTCCCTCAGCCAAGGCGG - Intergenic
1169407045 20:5330488-5330510 TGGGGTTCCCTTGGCCAAAAGGG + Intergenic
1169410412 20:5364499-5364521 TTGGGTCCCCTTGGCCAAGAGGG + Intergenic
1170027965 20:11911486-11911508 TTGGCTTCCCTGGGCCATGTTGG + Intronic
1170445093 20:16418340-16418362 TGGGGTCCCCATGGCCAAGAGGG - Intronic
1170716660 20:18837578-18837600 TGGGGTCCCCTTAGCCAAGAGGG - Intergenic
1171398395 20:24855508-24855530 TGGTGTTCCATTGGCCAAGAGGG + Intergenic
1171475260 20:25403712-25403734 TGGGGTCCCCTTGGCCCAGAAGG - Intergenic
1173370720 20:42432445-42432467 TGGGGTCCCCTTGGCCAAGAAGG - Intronic
1174093370 20:48067587-48067609 TTGGCTTCCCTGGGCCATGTTGG + Intergenic
1174521576 20:51135034-51135056 TGAGGTTCTCTTGGCCAAGAGGG + Intergenic
1174925043 20:54750243-54750265 TGGGGTCCCTTTGGCCAAGAGGG - Intergenic
1175808317 20:61843897-61843919 GGGGGTTCCCTCAGGGAAGTTGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176251673 20:64124820-64124842 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1178638415 21:34325986-34326008 TGGGCTTCCCTGGGCCACATTGG - Intergenic
1178977076 21:37229214-37229236 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1179173242 21:38989362-38989384 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1179184434 21:39073959-39073981 GGGTGTTCCCAAGGCCAAGTTGG - Intergenic
1179424729 21:41266747-41266769 TGGGGTTCCCACGACCAGGAGGG - Intronic
1179448931 21:41454478-41454500 TGGGGTCCACTTGGCCAAGAGGG + Intronic
1180190936 21:46162124-46162146 GAGGGTGCCCTCGGCCACGTGGG + Intronic
1181097447 22:20515381-20515403 TTGGCTTCCCTGGGCCATGTAGG + Intronic
1181610838 22:24010847-24010869 TTGGTTTCCCTGGGCCACGTTGG - Intergenic
1182364656 22:29770278-29770300 TTGGCTTCCCTGGGCCATGTTGG + Exonic
1182470453 22:30544971-30544993 TGGGGTTCCCGGGGCAAAGAAGG - Intronic
1183409291 22:37645512-37645534 TGGGGTCCCCTGGGGCAGGTGGG + Intronic
1183647274 22:39134020-39134042 AGGGGGCCCCTCGGCCAGGTCGG + Exonic
1183675650 22:39297535-39297557 TGGGGCTGCCTTGGGCAAGTGGG - Intergenic
1183701363 22:39453108-39453130 TGGGGTTCCCTTGGCCAAGACGG + Intergenic
1184886009 22:47344907-47344929 TGGGGGGCCCAAGGCCAAGTTGG + Intergenic
1184895895 22:47406260-47406282 TGGGGTCCCCTTGGTCAAGAGGG - Intergenic
1185177131 22:49334370-49334392 TGGGGTTTCCTCGGCCGGGGAGG - Intergenic
949095094 3:76446-76468 TGGGGTCTCCTCAGCCAAGAAGG - Intergenic
949821935 3:8125159-8125181 TGTGGTCCCCTTGGCCAAGAGGG + Intergenic
950666676 3:14499807-14499829 TTGGTTTCCCTGGGCCATGTGGG + Intronic
952149907 3:30578148-30578170 TGGAGTTGCCTTGGCCAAGAGGG - Intergenic
952704902 3:36367576-36367598 TGTTGTTCCCTTGGCCAAGAGGG - Intergenic
953380567 3:42468715-42468737 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
954401709 3:50322658-50322680 TGGGAGTCCGTCGGCCCAGTAGG + Exonic
955126112 3:56114519-56114541 TGGGGTTCCTTTAGCCAAGAGGG + Intronic
955146668 3:56326714-56326736 TGAGGTTCCCTCAGCAGAGTTGG + Intronic
955405841 3:58625168-58625190 TGGGGTCTCCTTGGCCAAGAGGG - Intronic
955922607 3:63973581-63973603 TGGGCCTCCCTCGGCCACGCTGG + Intronic
956044135 3:65177223-65177245 TGGGGCTTCCTCAGCCATGTGGG - Intergenic
956523549 3:70132002-70132024 TAGGGTCCCCTTGGCCAAGAGGG - Intergenic
957288205 3:78244115-78244137 TAGGGTCCCCTTGGCCAAGAGGG - Intergenic
957483904 3:80832963-80832985 TGGGATCCCCTTGGCCAAGATGG - Intergenic
957639810 3:82837689-82837711 TTGGCTTCCCTGGGCCATGTTGG + Intergenic
957970811 3:87379713-87379735 TTGGCTTCCCTGGGCCATGTTGG + Intergenic
958819192 3:98952869-98952891 GGGGCTTCCCTGGGCCAAGCTGG + Intergenic
959157623 3:102685802-102685824 TGGGGTCCCCGTGGCCAAGAGGG - Intergenic
960298661 3:115974914-115974936 TGGGGTCCCCTTGGCCAAGAGGG + Intronic
960425990 3:117508517-117508539 TGGGATCCCCTTGGCCAAGATGG + Intergenic
960845339 3:121999699-121999721 TGGGGTCCCCTTGGCCAAGAGGG - Intronic
962049231 3:131795356-131795378 TGAGGTCCCCTTGGCCAAGAGGG - Intronic
963762340 3:149296417-149296439 TGGGGTCCCCTTGGCCAAGGTGG - Intergenic
963842172 3:150119000-150119022 TGGGACTCCCTTGGCCAAGAAGG - Intergenic
963877242 3:150490281-150490303 TGGGGTCCCCTTGGCCAAAAGGG - Intergenic
964575966 3:158168911-158168933 TGGGGTCCCCTTGGCCAAAAGGG - Intronic
964917391 3:161854000-161854022 TTGGGCTTCCTGGGCCAAGTAGG - Intergenic
966394408 3:179487423-179487445 CGGGGTTCCCTTCGCCAAGAGGG - Intergenic
966900497 3:184480707-184480729 TGGGGTCCTCTTGGCCAAGAGGG + Intronic
967648897 3:191961457-191961479 TGGGGTCCCCTTGGCCAAAATGG - Intergenic
970053329 4:11941400-11941422 TGGGTTCCCCTTGGCCAAGATGG - Intergenic
970276235 4:14404138-14404160 TGGGATCCCCTTGGCCAAGAAGG + Intergenic
970857628 4:20667201-20667223 TGGGGTCCCGCAGGCCAAGTGGG + Intergenic
972302639 4:37799410-37799432 TGGAGTTTCCTTGGCCAAGAGGG - Intergenic
972673301 4:41234841-41234863 TAGGGTTCCCATGGCCAAGAGGG + Intergenic
973975275 4:56256820-56256842 TGGAATGCCCTTGGCCAAGTAGG - Intronic
974027286 4:56744844-56744866 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
975207647 4:71663135-71663157 TGGGGTCCTCTTGGCCAAGAGGG + Intergenic
976106247 4:81621363-81621385 AGGACTTCCCTCGGCCAAATAGG + Intronic
976885431 4:89978018-89978040 TGGGGTCTCCTTGGCCAAGAGGG - Intergenic
977987368 4:103398988-103399010 TGGGATTCCCTTGGCCAAGAGGG + Intergenic
978200770 4:106021720-106021742 TGGGGTCCCCTTGGCCAAGTGGG - Intergenic
978597475 4:110393762-110393784 TGGGGTCCCCTTGACCAAGAGGG - Intronic
979077348 4:116289574-116289596 TGGGTTCCCCTTGGCCAAGATGG - Intergenic
979086867 4:116424090-116424112 TGAGGTTCCCTTGGCCAAGAGGG - Intergenic
979631575 4:122908086-122908108 TGGGGTCCCCTTGGTCAAGAGGG - Intronic
979835165 4:125358041-125358063 TGGAGTTCCCCCGCCCAAGCTGG - Intronic
981610174 4:146585186-146585208 TTGGCTTCCCTGGGCCATGTTGG + Intergenic
983411369 4:167402783-167402805 TGGGGTCCCCTTGGCCAAAAGGG - Intergenic
983794979 4:171850795-171850817 TGGGGTTCCCTTGGCCAAGAGGG + Intronic
983847972 4:172542689-172542711 TGGGGTCCCCTTGGCCAAGGTGG + Intronic
985103809 4:186482854-186482876 TGGAGTTCCCTTGGCCAAGAGGG - Intronic
985627445 5:996843-996865 TGGAGTCCCCTTGGCCAAGAAGG - Intergenic
986691851 5:10319773-10319795 TGGGGTCCCCTTGGCCAGGAGGG + Intergenic
987144897 5:14982539-14982561 TGGGATCCCCTTGGCCAAGAGGG + Intergenic
989542043 5:42628904-42628926 TGGAGTCCCCTTGGCCAAGAAGG + Intronic
992114821 5:73529925-73529947 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
992722075 5:79570567-79570589 TGGGGTCCCCTTGGACAAGAGGG + Intergenic
993353335 5:86876660-86876682 TGGAGTCCCCTTGGCCAAGAGGG + Intergenic
995281433 5:110340012-110340034 TTGGGTCCCCTTGGCCAAGCAGG + Intronic
996820546 5:127621562-127621584 TGGGGTCTCCTTGGCCAAGGGGG + Intergenic
997158543 5:131583185-131583207 TGGGGTGCCCCTGGCCAAGAGGG - Intronic
997425077 5:133797620-133797642 TGGGGTCCTCTTGGCCAAGAGGG + Intergenic
998949806 5:147381882-147381904 TTGGCTTCCCTGGGCCACGTTGG + Intronic
999516780 5:152309896-152309918 TGGGGTCCCCTCGGCCAAGAGGG + Intergenic
999830363 5:155313148-155313170 TGGGGTTCCTTTGGCCAAGAAGG + Intergenic
1002869610 6:1155169-1155191 TGGGGTCCCCTTGGCCAAGCGGG - Intergenic
1003798062 6:9628565-9628587 TGTGGTCCCCTTGGCCAAGAAGG + Intronic
1004609166 6:17222707-17222729 TTGGGTTCCCTGGGCCATGTTGG + Intergenic
1004928246 6:20436367-20436389 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1005981764 6:30842011-30842033 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1006420861 6:33933073-33933095 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1006617325 6:35339387-35339409 TGGGGTCTCCTTGGCCAAGAGGG + Intergenic
1008977875 6:57448998-57449020 TGGGGTCCTCTTGGCCAAGGGGG + Intronic
1009166021 6:60341945-60341967 TGGGGTCCTCTTGGCCAAGGGGG + Intergenic
1010304356 6:74301563-74301585 TGGGGTCCCTTTGGCCAAGAGGG - Intergenic
1010826442 6:80482525-80482547 TTGGCTTCCCTCGGCCACATTGG - Intergenic
1011623137 6:89261415-89261437 TGGGGTCCCCTTGACCAAGAGGG - Intronic
1011630793 6:89321997-89322019 TGGGGTCACCTTGGCCAAGAGGG + Intergenic
1013157541 6:107507687-107507709 TGGGCTTCCCTGGGCCACATTGG - Intronic
1014574774 6:123056662-123056684 GGGGGTGCCTTAGGCCAAGTAGG + Intronic
1015041100 6:128719764-128719786 TTGGCTTCCCTGGGCCAAATTGG - Intergenic
1015078748 6:129196906-129196928 TGGGATTCCCTTGGCCAAGAAGG - Intronic
1015127585 6:129771643-129771665 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1015466946 6:133558422-133558444 TAGGGTCCCCTCGACCAAGCTGG - Intergenic
1015515633 6:134080198-134080220 TGGGGTCCCCTTGGCCAAGAAGG - Intergenic
1016666336 6:146646120-146646142 TGAGGTTCCCTTGGTCAAGGAGG + Intronic
1017063649 6:150508775-150508797 TGGGGTCCCCTTGGCAAAGAGGG - Intergenic
1018751583 6:166811235-166811257 TCAGGTGCCCTCAGCCAAGTGGG + Intronic
1019019608 6:168907069-168907091 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1019873416 7:3788583-3788605 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1020451031 7:8320583-8320605 TGGGGTCCCCTTTGCCAAGAGGG + Intergenic
1023719532 7:43078483-43078505 TGGGGTACTCTTGGCCAAGAGGG + Intergenic
1023802943 7:43850689-43850711 TGGGGTCTCCTTGGCCAAGAGGG + Intergenic
1024035082 7:45501103-45501125 TGGGGTCCCCTTGGCCAAAAGGG - Intergenic
1024393840 7:48844144-48844166 TGGTCTTCCCACAGCCAAGTGGG + Intergenic
1024401407 7:48928271-48928293 TGGTCTTCCCACAGCCAAGTGGG - Intergenic
1026563031 7:71466218-71466240 TGGGATACCCTTGGCCAAGAGGG - Intronic
1027153994 7:75753501-75753523 TGGGGTTTCCTGGGCCAACAGGG - Intergenic
1027566019 7:79795628-79795650 TGGGGACCCCTTGGCCAAGATGG + Intergenic
1027993777 7:85397337-85397359 TGGGGTCTCCTTGGCCAAGAGGG + Intergenic
1028071937 7:86461121-86461143 TGGGGTCCCCTTGGCCAAGAGGG - Intergenic
1028493237 7:91437393-91437415 TGGGGTTCACTCAGCACAGTGGG + Intergenic
1032301157 7:130688543-130688565 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1032568158 7:132969852-132969874 TGAGGTCCCCTTGGCCAAGAGGG - Intronic
1032778097 7:135136551-135136573 TGGGATGCCCTCTGCCAGGTAGG + Intronic
1033625216 7:143104449-143104471 TGGGGTTCCCTTGGCCAATGGGG - Intergenic
1033801994 7:144912567-144912589 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1034542839 7:151769962-151769984 TGGGGTCCCCGTGGCCAAGAGGG - Intronic
1034659082 7:152753547-152753569 TGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1036802135 8:11800876-11800898 TGGGGTTCCCTTGGCCGAGGTGG + Intronic
1037367561 8:18139382-18139404 TGGTGTTCCCTTGGCCAGGAAGG - Intergenic
1037379854 8:18273990-18274012 TGGGGTTCCCTTGGCCCAGAGGG - Intergenic
1037500993 8:19485428-19485450 TGGGGATCCCTTGGCCAAGACGG - Intronic
1038231041 8:25700551-25700573 TGGAGTCCCCTTGGCCAAGAGGG - Intergenic
1039184564 8:34902292-34902314 TGGGGTTCCCTTGGCCAAGGGGG - Intergenic
1039959775 8:42237519-42237541 TAGGGTTCCCTTGGTCAAGAGGG + Intergenic
1040618383 8:49062746-49062768 TGGTGTTCCCAGGGCCAAGACGG + Intronic
1041033325 8:53760715-53760737 TGGGGTCCCCTTGGCCCAGAAGG - Intronic
1041324994 8:56654193-56654215 TGGGGTCCCCTTGGCTAAGAGGG - Intergenic
1041366976 8:57116834-57116856 TTGGGTCCCCTTGGCCAAGAGGG + Intergenic
1041720343 8:60969591-60969613 TGGGATCCCCTTGGCCAAGAGGG + Intergenic
1041917893 8:63154197-63154219 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1041946580 8:63450411-63450433 TGGGGTTCCCTCAGCTAAGCTGG - Intergenic
1042863587 8:73337303-73337325 AGGGAGTCCCTGGGCCAAGTGGG + Intergenic
1042927715 8:73983521-73983543 TTGGCTTCCCTGGGCCACGTTGG - Intergenic
1043222873 8:77688593-77688615 TGGGATCCCCTTGGCCAAGAGGG - Intergenic
1043924538 8:86022033-86022055 TGGGGTACCCTTGGCCAAGAAGG + Intronic
1044461386 8:92448678-92448700 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1044607416 8:94059268-94059290 TGGGGTTCCCTTGGCCAAGAGGG - Intergenic
1045099779 8:98832680-98832702 TGGGGTCCCCTTGGCCAAGGGGG + Intronic
1048103527 8:131381655-131381677 TGGGGTCCCCTTGGTCAAATGGG - Intergenic
1048556629 8:135484212-135484234 TGGGGTCCCGTTGGCCAAGAGGG - Intronic
1048860601 8:138722081-138722103 AGGGGGTCCCTGGGCCAAGAGGG + Exonic
1049168747 8:141144421-141144443 TGGGGTCCCCTTGGCCAAAAGGG - Intronic
1049175415 8:141189643-141189665 TGGGGCTGCCTGGACCAAGTGGG - Intronic
1050388124 9:5111590-5111612 TGGAGTTCCCTGGGCCAGGTGGG + Intronic
1050780473 9:9327822-9327844 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1050830654 9:10008143-10008165 TGAGGTTCCCTGGGCCAACAGGG - Intronic
1052223874 9:26060448-26060470 GGGGGTCCCCTTGGCCAAGAGGG + Intergenic
1053082236 9:35185995-35186017 TGGGTTTCCCTTGGCCAAGGGGG - Intronic
1053562149 9:39207912-39207934 TGGGATTCCGTCTTCCAAGTTGG + Intronic
1053827955 9:42045913-42045935 TGGGATTCCGTCTTCCAAGTTGG + Intronic
1054134969 9:61411046-61411068 TGGGATTCCGTCTTCCAAGTTGG - Intergenic
1054602603 9:67141533-67141555 TGGGATTCCGTCTTCCAAGTTGG - Intergenic
1056735223 9:89203756-89203778 TGGGGTTACCAGGGGCAAGTGGG + Intergenic
1056802676 9:89703927-89703949 TGGGGTCTCCTTGGCCAAGAGGG + Intergenic
1056867013 9:90236894-90236916 TGGGGTCCCCTTGGCCAACCGGG - Intergenic
1057097835 9:92328070-92328092 TGGGGTCCCCTTGACCAAGAGGG + Intronic
1057468980 9:95341025-95341047 TGGGGTGCCTTTGGCCAAGAGGG - Intergenic
1059353478 9:113682600-113682622 TGTGGTTCTCTCTGCCTAGTGGG + Intergenic
1059702971 9:116793978-116794000 TTGGCTTCCCTGGGCCATGTTGG + Intronic
1060126652 9:121054043-121054065 TGGGGTCTCTTTGGCCAAGTGGG - Intergenic
1060340992 9:122777037-122777059 TGGGATCCCCTTGGCCAAGAAGG + Intergenic
1060542646 9:124441151-124441173 TGGGGTCCCCTCCTCCGAGTCGG - Intergenic
1061187590 9:129063695-129063717 AGGGGTTCCCTCTGGCAGGTGGG - Intronic
1061966757 9:134019006-134019028 TGGGGTCCCCTTAGCCAAGAAGG + Intergenic
1061967238 9:134022366-134022388 TGAGGTCCCCTTGGCCAAGAGGG + Intergenic
1062371765 9:136242930-136242952 TGGGGTCTCCTTGGCCAAGAGGG - Intronic
1185955242 X:4482172-4482194 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1186689471 X:11959789-11959811 TGGGGTCCACTTGGCCAAGAGGG + Intergenic
1187101551 X:16198044-16198066 TGGGGTCTCCTTGGCCAAGAGGG - Intergenic
1187349255 X:18496939-18496961 TGGGGTGCCCTTGGCCAAGAAGG + Intronic
1187387213 X:18859921-18859943 TGGGGTGCCCTTGGCCAAGAGGG - Intergenic
1188820620 X:34770487-34770509 TGGGGTTTCCTATTCCAAGTAGG + Intergenic
1189150450 X:38701059-38701081 TGAGGTCCCCTTGGCCAAGAGGG - Intergenic
1189318727 X:40074385-40074407 CAGGGTTCCCTCTGCCAAGGCGG - Exonic
1190363200 X:49668116-49668138 TGGGGCTTCCTGGGGCAAGTTGG - Intergenic
1192864365 X:75115714-75115736 TGGGGTCCCCTTGGCCAGGAGGG - Intronic
1193694892 X:84696405-84696427 TGGGGTCCCCTTGGCCCAGAGGG + Intergenic
1193999090 X:88404816-88404838 TGGGGTTGCCTTGGCCATTTGGG + Intergenic
1194497126 X:94630466-94630488 TGAGGTTCCCTTGGCCCAGAGGG - Intergenic
1195981660 X:110584987-110585009 TGGGGTCCCCTTGACCAAGAAGG - Intergenic
1199137644 X:144271994-144272016 TGGGGATCCATGGCCCAAGTAGG + Intergenic