ID: 1077425173

View in Genome Browser
Species Human (GRCh38)
Location 11:2472722-2472744
Sequence AAGGAGCCTGACAATGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077425173_1077425179 -10 Left 1077425173 11:2472722-2472744 CCCTGCCCATTGTCAGGCTCCTT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1077425179 11:2472735-2472757 CAGGCTCCTTCCCTGTCTAGGGG 0: 1
1: 0
2: 2
3: 31
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077425173 Original CRISPR AAGGAGCCTGACAATGGGCA GGG (reversed) Intronic
900125207 1:1065966-1065988 AAGGAGCATGAAAGTGGACAAGG + Intergenic
900142462 1:1144455-1144477 AAGGAGCCAGCCCACGGGCAGGG + Intergenic
900810476 1:4797994-4798016 AATGAAACTGACAGTGGGCAGGG + Intergenic
901954630 1:12775286-12775308 GAGGAGCTGGACAATGGCCAAGG - Intronic
902059639 1:13631290-13631312 GAAGGGCCTGACAAAGGGCATGG + Intergenic
902613185 1:17609071-17609093 AAGGAGCTTGAGGCTGGGCATGG - Intronic
903134808 1:21302590-21302612 CTGGAGCCTGAAAAGGGGCATGG - Intronic
904009369 1:27381089-27381111 AAGGAGTCTGACAATATGAAGGG + Intronic
904245783 1:29187123-29187145 ATGGTGCCTGACAATAAGCATGG + Intergenic
904616496 1:31752917-31752939 ATGGAGCCTGATGATGGGGAGGG + Intronic
906501301 1:46343149-46343171 AGGGAGCCAGACAGTGGGCAGGG - Intronic
907316304 1:53574872-53574894 AAGGAGCCTGACTGTGGGCGAGG - Intronic
907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG + Intergenic
907803468 1:57794747-57794769 AAGGAGCCAGACATTGTGCCAGG - Intronic
909038240 1:70620079-70620101 ACGGAGCATGTCAATGGTCAGGG - Intergenic
909111876 1:71489363-71489385 AAGCAGCCTAAGAATGGGCAGGG - Intronic
909761144 1:79288932-79288954 AAGGAGTTTGAGAATAGGCAGGG + Intergenic
910450396 1:87337728-87337750 AGGTAGCCAGAGAATGGGCATGG - Intronic
910597324 1:88993288-88993310 AAGGTGCCTGAGAGAGGGCAGGG + Intergenic
912480846 1:109981182-109981204 AAACAGCCTGAGAATAGGCATGG - Intergenic
912530583 1:110318242-110318264 AAGGAGCATGAGCTTGGGCAAGG - Intergenic
914435230 1:147653697-147653719 AAGAAGACTAACAATGGGAAAGG - Intronic
915225527 1:154408411-154408433 AAGGAGCCTGAAAATGGTCATGG + Intronic
917758715 1:178131989-178132011 AAGATGCCTGACAATGAGGAAGG - Intronic
918278833 1:182982449-182982471 AAGGAAACTGAAAATGAGCAGGG - Intergenic
922547513 1:226469384-226469406 AAGGAGCAAGACAGAGGGCAAGG - Intergenic
922588815 1:226756922-226756944 ACGGAGCCTGAAGATGGGCCTGG + Intergenic
924269055 1:242313637-242313659 AAGGAGGCACACAATGGACATGG - Intronic
1063034094 10:2268125-2268147 AAGGAGCCTGAAAGACGGCATGG - Intergenic
1064392554 10:14954253-14954275 AATGAGCCTTGCACTGGGCAGGG - Intronic
1064440991 10:15353660-15353682 AAGAAGCCGGACAAAGGGCATGG + Intronic
1064706922 10:18082611-18082633 AAGGAGCCAGAAAATGGGGGAGG - Intergenic
1066715847 10:38285131-38285153 AAGGAGGCACACAATGGACATGG + Intergenic
1067661287 10:48237902-48237924 ACGGTGGCTGAAAATGGGCAGGG - Intronic
1069519231 10:69105157-69105179 AAGCAGCATGACCTTGGGCAAGG - Intergenic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071175586 10:82923150-82923172 TAGGAGTCATACAATGGGCATGG - Intronic
1071348154 10:84713027-84713049 AAGAAGCCTGACAGCTGGCAAGG - Intergenic
1071748975 10:88453316-88453338 AAGGAGCATGACTTTGGGTAAGG - Intronic
1073617538 10:105011846-105011868 AAGAAGCTTCACAATGGGAAGGG - Intronic
1075655068 10:124155945-124155967 AAAGAGCCAGACACTGGTCATGG - Intergenic
1076349949 10:129808806-129808828 AAGGAGCCCCACAGTGGGCCTGG - Intergenic
1076597026 10:131630112-131630134 CAGGTCCCTGAAAATGGGCAGGG + Intergenic
1077425173 11:2472722-2472744 AAGGAGCCTGACAATGGGCAGGG - Intronic
1078654462 11:13225506-13225528 AATGAGCCTTGCAATGGGCAGGG - Intergenic
1078924963 11:15866281-15866303 AGGGAGACTGACAGTGGGCTGGG - Intergenic
1080851095 11:36070867-36070889 AAGGACCTTGACAAAGGGCAAGG - Intronic
1081189495 11:40085724-40085746 AAGGAGGCTGAAAAGGGGCCAGG - Intergenic
1083610850 11:64003579-64003601 AAGAAGGCTGACAAAGGCCATGG - Intronic
1084345772 11:68547468-68547490 AAGGAACGTGAGAATGGCCACGG - Intronic
1084793786 11:71491043-71491065 AAGGAGCCTGAGTGTGGGCCAGG - Intronic
1088506135 11:110529357-110529379 AAGAAGACTTACAATGAGCAAGG - Intergenic
1088692772 11:112342031-112342053 AAGAAGCCTGATAATGGACTTGG - Intergenic
1090919234 11:131193526-131193548 AAAGAGCCTGAGAAAAGGCACGG - Intergenic
1091478017 12:796417-796439 AAGGAGCTTGATAATTGGAAAGG + Intronic
1091987727 12:4926245-4926267 AAGGAACATGACCTTGGGCAAGG + Intronic
1093728532 12:22543042-22543064 AATCACCATGACAATGGGCAGGG + Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1095996152 12:48086745-48086767 AAGGAGGCTGAGGCTGGGCATGG + Intronic
1102384289 12:112494305-112494327 AAGTAACATGACAATGGTCATGG - Intronic
1103293050 12:119862904-119862926 AAAGAGGCTGACATTGGGCCGGG + Intronic
1104744760 12:131203895-131203917 AAGGAGGGTGACACTGAGCAGGG - Intergenic
1105725274 13:23157154-23157176 CAGAAGCCAGAAAATGGGCAAGG + Intergenic
1105732064 13:23227777-23227799 AAGGAGCCTGCAGAGGGGCACGG + Intronic
1106533638 13:30618280-30618302 AAGGAGCGTGGAGATGGGCAGGG + Intronic
1110135041 13:72056650-72056672 GAGGAACCTGACAATAAGCAAGG - Intergenic
1110401008 13:75092085-75092107 AAGCTGCATGACAATGTGCAGGG - Intergenic
1113507451 13:110827010-110827032 AATGAGCTGGACACTGGGCATGG - Intergenic
1113541834 13:111115334-111115356 AAGGCGCCTGACAGCGGGCCGGG + Exonic
1113797545 13:113067070-113067092 AAGGTGCCTGACACAGGCCAGGG - Intronic
1114893366 14:26953855-26953877 AAGGTGCCTGGGAATGGGCCTGG + Intergenic
1116050068 14:39791289-39791311 AGTGAGCATGACCATGGGCAAGG + Intergenic
1116617031 14:47153276-47153298 AATAAGGGTGACAATGGGCATGG + Intronic
1117149031 14:52866545-52866567 AAGCAGCCTGAGTATAGGCAAGG - Intronic
1121553140 14:94817534-94817556 ATGGAACCTCACAAAGGGCAGGG + Intergenic
1124631314 15:31339103-31339125 GAGGACCCTGACCATGAGCAGGG - Intronic
1125016423 15:34940624-34940646 AGGGAGACGGACAATAGGCAGGG + Intronic
1128797029 15:70473560-70473582 AAGCAGCCTCTCAATGGGGAGGG - Intergenic
1130758926 15:86797150-86797172 TATGTGCCTGACACTGGGCAAGG - Intronic
1132319814 15:100918024-100918046 AAGGAGCCTGGGAATAGGCTAGG - Intergenic
1136567808 16:31080495-31080517 AGGGAGCCAGCCAATGGCCAGGG + Exonic
1138130637 16:54476802-54476824 AAGGACTGTGACACTGGGCATGG - Intergenic
1138613072 16:58142666-58142688 ATGGAGACAGACAATGGGCCAGG - Intergenic
1139662486 16:68430523-68430545 AAGGAGCCAGACCAGGGGAAAGG - Intronic
1139908155 16:70380776-70380798 AAGGAGGCTGGCTATGGGCCCGG - Exonic
1142706925 17:1701173-1701195 AAGGTGCCTGACATGGGGAAGGG + Intergenic
1142768067 17:2076765-2076787 AAGGAGGCTGACAGGAGGCAGGG + Intronic
1142800775 17:2344123-2344145 AAGGAGCCTGAGCGTGGGCTAGG + Intronic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1143856826 17:9857532-9857554 AAGAGGCCTGACAATGAGAATGG + Exonic
1144262880 17:13540247-13540269 CAGCAGCTTGACACTGGGCAGGG + Intronic
1144997488 17:19280247-19280269 CAGGAGCCTTACAATGTGCCAGG - Intronic
1146891932 17:36511887-36511909 CAGAAGCCTGACAGTGGGAAAGG - Intronic
1148751893 17:49950075-49950097 GAGGAGCCAGAGAATGGGCAAGG - Intergenic
1149397836 17:56262907-56262929 ATGGTGCTTGACAATGGGAAAGG - Intronic
1150235176 17:63587114-63587136 CAGGAGCCTTATAATGGACAAGG + Intronic
1151010871 17:70494543-70494565 AAGAAACCTGAAAATGGGCCAGG + Intergenic
1151314808 17:73315230-73315252 AAGGAGCCTGAATTTGGGTAAGG - Intergenic
1151619438 17:75236944-75236966 AGGAAGCCTGGCAAGGGGCAGGG + Exonic
1152528913 17:80905661-80905683 AAGGACCCTGGCAATGTGCAGGG - Intronic
1153905994 18:9661707-9661729 TGGGAGCCTAACCATGGGCAAGG + Intergenic
1153910790 18:9705013-9705035 AAGGAGCCTGTCTGTGGGAAAGG - Intergenic
1158285174 18:55872888-55872910 GATGTGCCTGACAAAGGGCAGGG - Intergenic
1159292846 18:66444740-66444762 AAGGAGCATGACCTTGGACATGG + Intergenic
1160484358 18:79275262-79275284 AAGGAGGCAGGCAAGGGGCAAGG - Intronic
1161912928 19:7207990-7208012 AAGGAGCTTGGCCTTGGGCATGG + Intronic
1163091287 19:15021954-15021976 AAGGAGCCTTACCATTGGCGGGG - Intronic
1164004972 19:21140308-21140330 AAAGCACCTGGCAATGGGCATGG - Intergenic
1164122774 19:22283419-22283441 AAAGCACCTGGCAATGGGCATGG - Intergenic
1164720362 19:30427489-30427511 AAAAAGCCTGGCATTGGGCATGG + Intronic
1165957702 19:39511990-39512012 AAAGAGCCTGAGACTGGGCGTGG - Intergenic
1166099109 19:40560462-40560484 AAGGGGGCTGTCAATGGGCTGGG - Intronic
1166220496 19:41361263-41361285 AAGGAGCCTGACGCAGGGCCTGG - Intronic
1166763768 19:45240441-45240463 AAGGAGACTGACAATAGGACTGG + Intronic
926845855 2:17138472-17138494 AAAGTGCATGACAATGGGAATGG + Intergenic
927949080 2:27155272-27155294 AAGGGGCCTGGCAGGGGGCAGGG + Exonic
929301106 2:40304581-40304603 AAGGAGGCTGACAATGGGAAAGG - Intronic
930415965 2:51092070-51092092 AAGGAACCTGACGATGTTCATGG - Intergenic
931051979 2:58426094-58426116 AATAAACCTGACAATGGACAGGG + Intergenic
931235345 2:60407950-60407972 AAAGAGCATGCCAAAGGGCATGG + Intergenic
932564765 2:72898921-72898943 AAGGAGTCTTTCAATGGGCTGGG - Intergenic
933100391 2:78248251-78248273 CAGTGGCCTGACAATGGTCATGG + Intergenic
935728388 2:106044009-106044031 AAGGAGTCTATCAATGGTCAAGG - Intergenic
935834063 2:107031168-107031190 AATGAGCTTGTGAATGGGCAGGG + Intergenic
937112797 2:119379565-119379587 AAGGAGCCACACAATGGCCCAGG + Intergenic
938684407 2:133723155-133723177 ATTGAGCCTGACAACGTGCAAGG - Intergenic
941854695 2:170219165-170219187 AAGGAGCCTCAATGTGGGCAAGG - Intronic
942047163 2:172106466-172106488 AAGGAGAGTGAAAATGGGCCTGG - Intergenic
943687808 2:190837542-190837564 ATTCACCCTGACAATGGGCAGGG - Intergenic
946787539 2:223263472-223263494 AAGGAGCCTGGCGATGGACATGG - Intergenic
946880302 2:224170819-224170841 AGGGAGCTGGACCATGGGCAGGG - Intergenic
948211908 2:236200433-236200455 AAGGAAACTGACAAGGGTCAGGG + Intronic
1169265719 20:4166337-4166359 AAGAAGTCAGACAAAGGGCAGGG - Intronic
1172546884 20:35769107-35769129 AAGGAGACTGACACTGATCAGGG - Intergenic
1173596957 20:44264614-44264636 AAAGAGGCTGAGACTGGGCAGGG - Intronic
1174864961 20:54126891-54126913 AAGCAGCCTGGAAATGGTCATGG + Intergenic
1175162212 20:57017348-57017370 AATGAGCCAGACAATGAGCTGGG + Intergenic
1179048571 21:37869181-37869203 AAGGTGCCTCATGATGGGCATGG - Intronic
1179984971 21:44915312-44915334 AGGAAGCCTGAGACTGGGCACGG - Intronic
1181571371 22:23769366-23769388 AAGGAGCAGGTCAAGGGGCAAGG + Intronic
1181687112 22:24537007-24537029 AAGGAGTCTGAGAAGGTGCAGGG + Intergenic
1181913756 22:26262548-26262570 AAGAAGCCTGAGAATGGGAATGG - Intronic
1184850999 22:47120563-47120585 AAGCAGCCTGGCAGAGGGCAGGG + Intronic
1184946751 22:47809214-47809236 AGGCAGCCGGACAGTGGGCAGGG - Intergenic
950361180 3:12450515-12450537 CAGGAGCCTGACCATGGTCCAGG + Intergenic
950974513 3:17226535-17226557 AAGGGGCATGACCTTGGGCAAGG - Intronic
953174331 3:40535726-40535748 AAGAAGTCTGAAAATGGGGAAGG + Exonic
954697325 3:52434806-52434828 GGAGAGCCTGACAATGGGGAGGG + Exonic
956621631 3:71226803-71226825 AGGGAGCCTGAGAACGAGCAAGG - Intronic
956727594 3:72169188-72169210 AAGGAGCTTGAAATTGGCCATGG + Intergenic
956961171 3:74402909-74402931 AAGGGCCCTAACACTGGGCATGG + Intronic
959612642 3:108312574-108312596 AATCAGCCTGTCATTGGGCATGG - Intronic
959913366 3:111790030-111790052 GAGGAGCCTGACTGGGGGCAGGG + Intronic
960539646 3:118849091-118849113 AAGGAGCCTGACAATAAGGCAGG - Intergenic
960960065 3:123064547-123064569 AAGGAGCTTGGCAGTGGGGAGGG + Intergenic
964540635 3:157775438-157775460 AAGGAGCCTGACAGGAGTCAGGG + Intergenic
969291271 4:6241574-6241596 AAGGAGCCTGTCAGGGGACAGGG + Intergenic
969483050 4:7456998-7457020 GCCGAGCCTGACACTGGGCATGG + Intronic
970652332 4:18192603-18192625 AAATAGCCTGACATGGGGCAGGG + Intergenic
971385748 4:26139298-26139320 AAGGAGCTCAACAATGGGCTGGG - Intergenic
973004254 4:44989458-44989480 TATAAGCCTGACAAAGGGCAGGG - Intergenic
973767562 4:54177111-54177133 ACAGGGACTGACAATGGGCAGGG + Intronic
974063224 4:57054171-57054193 TAGGGGCCTGAGAGTGGGCAGGG - Intronic
975557163 4:75676127-75676149 AAGGGGCCTGAACCTGGGCAGGG - Intronic
976114613 4:81713559-81713581 AAGAAGACTGGCACTGGGCATGG + Intronic
978062121 4:104351519-104351541 TACGAGCCTGACACTGGGAAAGG - Intergenic
978609108 4:110517233-110517255 AAAGATGCTTACAATGGGCAGGG - Intronic
981102132 4:140840722-140840744 AAGGAGACTGACAGAAGGCATGG + Intergenic
983426109 4:167584935-167584957 AGGGAACCTGGCATTGGGCATGG - Intergenic
983520275 4:168701315-168701337 AAGGAGCCTGACAAGAAGCAGGG + Intronic
983996481 4:174188741-174188763 AAGGCACCTGACAATGAGGATGG + Intergenic
986736663 5:10673529-10673551 AGGCAGCCTGAGAAAGGGCAGGG - Intergenic
987325416 5:16807816-16807838 AAGGAGCGTCACAATGAGGAGGG - Intronic
987736267 5:21847429-21847451 AAGGAGGCCAACAAGGGGCAGGG + Intronic
990977032 5:61569395-61569417 AAGGCGCCTGGCTCTGGGCAGGG - Intergenic
992638862 5:78751430-78751452 GAGGAGCCTCAGAATGGGAAGGG + Intronic
992863367 5:80934336-80934358 GAGGAGCCTGACTTTGGACATGG - Intergenic
993352457 5:86867109-86867131 AATTAGCCAGGCAATGGGCAAGG + Intergenic
995505533 5:112856331-112856353 AAGGAGGATGAAAATGGACATGG - Intronic
997406969 5:133656854-133656876 AAGGAGACTGACAATAGTCTAGG + Intergenic
1000846555 5:166289000-166289022 AATGTGCCTGGGAATGGGCAAGG - Intergenic
1001281448 5:170389167-170389189 AAGCAGCCTGCCACGGGGCAGGG - Intronic
1002135877 5:177107273-177107295 AAGGAGCTTGGCAGTGGTCAGGG - Intergenic
1002348927 5:178568694-178568716 AAGGAACCAGACAAAGGGCAAGG - Intronic
1002968214 6:1989053-1989075 AATGATCCTGACAATGGGAACGG + Intronic
1003408924 6:5846438-5846460 AAGGGGCATGAAAATGGGAAAGG - Intergenic
1012593283 6:101009714-101009736 AAGGAGCATGAAAATGATCAAGG + Intergenic
1017055568 6:150432750-150432772 AAGGAGCCTGTGAATGCTCAGGG - Intergenic
1017155651 6:151320522-151320544 AAGGACCCTGGGAATGGACAGGG - Intronic
1017235459 6:152113291-152113313 ATGGTGCCTGACAAAGGTCAGGG - Intronic
1018166792 6:161105445-161105467 TAGGTGTTTGACAATGGGCAAGG - Intronic
1018972849 6:168540537-168540559 AAGGTGCCTGGCCAGGGGCACGG + Intronic
1019064839 6:169288181-169288203 AAGGAGCCTGAGAAGTGGGAAGG - Intergenic
1019071107 6:169345923-169345945 AAGGAACCTGAGACTGGGCTTGG + Intergenic
1019485804 7:1288730-1288752 AAGGGGCCTGAGAAAGGGCCTGG - Intergenic
1023480787 7:40631753-40631775 CAGGAGCCTGTCCATGGTCAAGG - Intronic
1025801731 7:64793308-64793330 AATGCACCTGGCAATGGGCATGG - Intergenic
1025848343 7:65220154-65220176 AAAGCACCTGGCAATGGGCATGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028864234 7:95689208-95689230 AAGGAGCCTGTCTAAGGACAGGG + Intergenic
1029375488 7:100174657-100174679 AGGGTGCCTGAGTATGGGCAGGG - Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1033844099 7:145411566-145411588 CAGGAGCATGACAGTGAGCATGG + Intergenic
1036220387 8:6916558-6916580 AAGGGGCCTGACAATATCCAGGG + Intergenic
1036400227 8:8401275-8401297 AAAGAGGCAGAAAATGGGCAAGG + Intergenic
1037861497 8:22408679-22408701 CAGGAGTCTGACAATGTGCTAGG - Intronic
1038167547 8:25100461-25100483 ATGGAGCCCAAGAATGGGCAGGG - Intergenic
1043328801 8:79087140-79087162 AAGGAGCATGAGAACTGGCAAGG - Intergenic
1043699084 8:83261407-83261429 CAGGAACCTGGCAATGGGCTGGG + Intergenic
1046621115 8:116530674-116530696 AAGGAGACAGATAATGGACACGG + Intergenic
1050668988 9:7974986-7975008 GAGGTGTCTGAAAATGGGCATGG - Intergenic
1051311533 9:15779094-15779116 AAGGAGCTTGACAAAGCCCAGGG + Exonic
1055192408 9:73541373-73541395 AAGTAGCCTGAGATTGGCCAAGG - Intergenic
1056732524 9:89178276-89178298 AAGGCGCCCGACGATGGGCCCGG - Exonic
1058525881 9:105857328-105857350 AAGGTCCCTGCCAATGGACAGGG - Intergenic
1059599376 9:115759906-115759928 AAGGATCCTGACACTTGGCTGGG + Intergenic
1059796710 9:117705452-117705474 AAGGAGGAGGACTATGGGCAGGG - Intronic
1059812106 9:117866862-117866884 AAGAAACTTGACAATGTGCAGGG + Intergenic
1060116938 9:120949168-120949190 AAGGAGACTGGTAATGGTCAGGG - Intergenic
1061516440 9:131093042-131093064 AAGGACCCTTTCACTGGGCAGGG + Exonic
1186186175 X:7021976-7021998 AAGGATGCTGACAATGGCAAGGG - Intergenic
1187590690 X:20714002-20714024 AAGGAGCATGAACTTGGGCAAGG + Intergenic
1188939081 X:36215407-36215429 AAGGAGCCTGAAACTGAGCATGG + Intergenic
1196480134 X:116138847-116138869 AAGAAACCTGAGAATGGACAAGG - Intergenic
1201794596 Y:17881470-17881492 ATGGAGTCTGAAAAGGGGCAAGG - Intergenic
1201806959 Y:18024515-18024537 ATGGAGTCTGAAAAGGGGCAAGG + Intergenic
1202355970 Y:24049250-24049272 ATGGAGTCTGAAAAGGGGCAAGG - Intergenic
1202514808 Y:25620859-25620881 ATGGAGTCTGAAAAGGGGCAAGG + Intergenic