ID: 1077429695

View in Genome Browser
Species Human (GRCh38)
Location 11:2510011-2510033
Sequence TGTCAATCCAGTACACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2519
Summary {0: 1, 1: 0, 2: 2, 3: 89, 4: 2427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077429685_1077429695 23 Left 1077429685 11:2509965-2509987 CCTGGTGTTTAAAGGCTAATTGG 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1077429695 11:2510011-2510033 TGTCAATCCAGTACACTGGGAGG 0: 1
1: 0
2: 2
3: 89
4: 2427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077429695 Original CRISPR TGTCAATCCAGTACACTGGG AGG Intronic
Too many off-targets to display for this crispr