ID: 1077432417

View in Genome Browser
Species Human (GRCh38)
Location 11:2522375-2522397
Sequence GTTTCCCGGCTCTGCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077432404_1077432417 28 Left 1077432404 11:2522324-2522346 CCCACTCCGAGTCCAAAACACGC 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1077432405_1077432417 27 Left 1077432405 11:2522325-2522347 CCACTCCGAGTCCAAAACACGCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1077432411_1077432417 -6 Left 1077432411 11:2522358-2522380 CCTCTCCCAGGGCCTTAGTTTCC 0: 1
1: 5
2: 35
3: 279
4: 982
Right 1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1077432408_1077432417 16 Left 1077432408 11:2522336-2522358 CCAAAACACGCATAGGATTCGTC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1077432407_1077432417 22 Left 1077432407 11:2522330-2522352 CCGAGTCCAAAACACGCATAGGA 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077432417 Original CRISPR GTTTCCCGGCTCTGCAGAGT GGG Intronic
900658242 1:3770698-3770720 GTTCCCTTCCTCTGCAGAGTGGG + Intronic
901416432 1:9119966-9119988 GTTTCCCTGCCCTTCAGAGCGGG + Intronic
903663166 1:24991053-24991075 GCTACCCAGCTCTGCAGAATAGG + Intergenic
904071495 1:27801736-27801758 ATTTCCAGGCTGTGCAGAGAAGG + Exonic
904474530 1:30756539-30756561 GCTTCCCAGCTCTGCAGCCTTGG - Intronic
907901301 1:58743859-58743881 GTTGCCCCACTCTGGAGAGTTGG - Intergenic
914247561 1:145897275-145897297 CATGCCCGGCTCTGCAGTGTGGG - Exonic
915504220 1:156342644-156342666 GTTTTCCAGCTCTACAGACTAGG + Intronic
917409013 1:174738465-174738487 GTTTCTAGGGTCTGCAGAGTGGG + Intronic
919172825 1:193977371-193977393 GCTACCCAGCTCTTCAGAGTTGG + Intergenic
920054755 1:203183860-203183882 GTTTCCAGGACCTGCAGAGCTGG + Intronic
920750648 1:208671712-208671734 TTTTTCCAGCTCTGCAGGGTTGG - Intergenic
920987257 1:210902186-210902208 TTTTGTCTGCTCTGCAGAGTTGG - Intronic
923126030 1:231035335-231035357 GTCTCCCACCTGTGCAGAGTGGG - Intronic
1063531842 10:6840583-6840605 GTTTTCTGGCACTGCAGACTGGG - Intergenic
1066044456 10:31583578-31583600 CTGTCCTGGCTCTGCAGGGTGGG + Intergenic
1068417570 10:56744160-56744182 ATTTCCAGGCTGTGCAGAGATGG + Intergenic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1070278368 10:75029739-75029761 GTTTCCATGTTCTGCAGAGATGG - Exonic
1073186109 10:101615854-101615876 GCTTCCTAGCTCTGCAGACTTGG - Intronic
1074147904 10:110732888-110732910 GTTTCCAGGTTCTGCAGCCTGGG - Intronic
1074460877 10:113635885-113635907 GTTTGCTCACTCTGCAGAGTAGG - Intronic
1077246466 11:1541682-1541704 TTCTCCAGGCTCTGCAGCGTAGG - Intergenic
1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG + Intronic
1078330016 11:10411395-10411417 GTTTCCAGGCAGTGCAGAGTTGG + Intronic
1078352531 11:10606296-10606318 GCTTCCCGGCTCCGCTGAGCTGG + Intronic
1078626409 11:12962672-12962694 GTTTCCTTGCACTGCAGAGGAGG - Intergenic
1080254329 11:30272073-30272095 GTTTCCTGGCTATAGAGAGTAGG - Intergenic
1082955132 11:58863076-58863098 GGTTCCTGGGTCTGTAGAGTGGG + Intronic
1082962590 11:58933882-58933904 GTTTCCTGGGTCTGTAGAGTTGG + Intronic
1082972193 11:59035758-59035780 GGTTCCTGGGTCTGTAGAGTTGG + Intronic
1082976226 11:59075959-59075981 GGTTCCTGGGTCTGTAGAGTTGG + Intergenic
1083701076 11:64478009-64478031 TTTCCTCGGCTCTCCAGAGTGGG + Intergenic
1088091595 11:106046486-106046508 ATTTCCTGGCCCTGCAGATTTGG + Intergenic
1090161495 11:124500026-124500048 ATTTCCCGGCTCTCCAGAGCAGG - Intergenic
1091858449 12:3757486-3757508 GTTTGCTGGCTCTGTAGAGCTGG - Intronic
1098577808 12:72063607-72063629 GTCTCCTGGCTCTGCAGACTGGG - Intronic
1101789130 12:107911989-107912011 GTTTCCCGCCACTGAAGAGGAGG - Intergenic
1101906929 12:108833923-108833945 GGTTAGCGGCTGTGCAGAGTGGG - Intronic
1102180437 12:110908860-110908882 GCTTCCCTGCACTCCAGAGTTGG - Intergenic
1102569216 12:113817441-113817463 GTTCCTCCCCTCTGCAGAGTGGG + Exonic
1104764260 12:131316210-131316232 GTTTCCCTGCTTTACAGAGAAGG + Intergenic
1118843124 14:69527391-69527413 GTTTCCTGGCTCTACAGGGCCGG - Intronic
1120834571 14:89027919-89027941 GTGTCCCAGCTCTGCAAACTCGG + Intergenic
1121054219 14:90839726-90839748 GTTTCTGTGCTCTGCACAGTGGG - Intergenic
1122175400 14:99914312-99914334 GTTTGCCGGGCCTGCTGAGTGGG - Intronic
1122953445 14:105058952-105058974 GTTTCCGGGCCCTGCAGTGCAGG + Intronic
1124385876 15:29207852-29207874 GTTTCCCTGTTCTGCACAATGGG + Intronic
1127190788 15:56528554-56528576 GTGTCTCGGCTCTGGAGGGTGGG - Intergenic
1128254763 15:66188567-66188589 GTTTCCCCTCTCTGCAGATGGGG + Intronic
1131792702 15:95982233-95982255 GTATCCCCGTTCTGCAGAGAAGG - Intergenic
1131997740 15:98148019-98148041 GTTTTCCTAGTCTGCAGAGTGGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1136294066 16:29291797-29291819 GCTTCCAGGCTCAGCAGAGGTGG + Intergenic
1141815675 16:86407999-86408021 GGTGCCCAGCTCTGCAGGGTGGG + Intergenic
1142008473 16:87701590-87701612 GTTTCTGGGGTCGGCAGAGTGGG + Intronic
1143128191 17:4658073-4658095 ATTTCCTGGCTGTGCAGATTGGG - Intergenic
1150471707 17:65442995-65443017 GGTTTCCTCCTCTGCAGAGTGGG + Intergenic
1153758825 18:8310611-8310633 GTTTGCTAGCTCTTCAGAGTAGG + Intronic
1161838794 19:6665966-6665988 GTTTCCCTCCTCTGCAAAGCAGG - Intronic
1163267055 19:16227801-16227823 GCTGCCTGGCTCTGCAGAGATGG + Intronic
1163558872 19:18007573-18007595 TTCTCCCGGCTCTACAGAGGTGG + Intronic
1164754990 19:30682638-30682660 GCTTCCTGGATCTGCAGAGATGG + Intronic
925851201 2:8083863-8083885 GTTTCCCTATTGTGCAGAGTGGG + Intergenic
926000295 2:9325810-9325832 GGGTCCTGGCTCTGCAGAGCTGG + Intronic
926500162 2:13643522-13643544 GTTTCACGGATCTGTAGAGCAGG - Intergenic
926731177 2:16036889-16036911 CCTTCAAGGCTCTGCAGAGTTGG - Intergenic
927509665 2:23636539-23636561 GTATCCCGGGTGTGCAGAGGCGG - Intronic
931494429 2:62786811-62786833 TTTGGCCAGCTCTGCAGAGTGGG + Intronic
932309738 2:70729995-70730017 GTTTCTCAACTCTGCAAAGTAGG + Intronic
935246538 2:101223761-101223783 GTCTCCCTGCTCTGGGGAGTGGG + Intronic
935542341 2:104363220-104363242 GTTTCTAGCCTCTGCAAAGTTGG - Intergenic
937255597 2:120553141-120553163 GTTGCCTCCCTCTGCAGAGTGGG - Intergenic
937261694 2:120590745-120590767 GTTCTCTGGCTCTGCAGTGTGGG + Intergenic
942517431 2:176768612-176768634 GTTTCCCAGCTGTGCAAACTCGG + Intergenic
945194749 2:207227601-207227623 CTTTCCCCACTCTGCAGTGTTGG + Intergenic
947695898 2:232188203-232188225 GTTTCCCCTCTGTGCAGAGAAGG + Intronic
948464244 2:238144680-238144702 AGTTCCAGGCTCTGCGGAGTGGG + Intronic
1169028845 20:2392583-2392605 AGTTCCCCGCTCTGCAGAATGGG - Intronic
1172694849 20:36815494-36815516 CCTCCCTGGCTCTGCAGAGTCGG + Exonic
1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG + Intronic
1175229009 20:57461745-57461767 GGTTCCGGGCTCTGCAGCCTGGG - Intergenic
1181089853 22:20465098-20465120 GTTTGCGGGCTCTGCAGGCTGGG + Exonic
1182520775 22:30883436-30883458 GTCTCCAGGCTCTGCTGAGCTGG - Intronic
1183341878 22:37286071-37286093 TTTCCCCAGCTCTGCAAAGTTGG + Intronic
1184755255 22:46512212-46512234 GTGTCCCGGATTTGCAGAGGAGG + Intronic
1185158588 22:49208923-49208945 GCTTCGCGGCTCTGCAGCGGGGG - Intergenic
949829884 3:8202643-8202665 GTTTCCCAGCTCTATAGACTTGG - Intergenic
950957147 3:17066093-17066115 GTCTCCCGGATGTGAAGAGTGGG + Intronic
951538743 3:23762783-23762805 GTTACCCAGCTCTGCAGAAATGG - Intergenic
954950507 3:54468581-54468603 GTTTCCCCCCTCTGGAAAGTGGG + Intronic
960283685 3:115803321-115803343 GTTTCCAGTCACTGAAGAGTAGG - Exonic
965676673 3:171204951-171204973 GTTTCCTCCATCTGCAGAGTAGG + Intronic
968668154 4:1832937-1832959 GTTTCCCGGATCTGCGGAAGTGG + Exonic
970542573 4:17094596-17094618 GAGTCCCAGCTCTGCAGAGCTGG + Intergenic
971221689 4:24713711-24713733 GTTTCCAGGGTCTGGAGATTGGG - Intergenic
971332614 4:25694723-25694745 GCTTCCCAGGTCTGCAGAGCAGG + Intergenic
971538942 4:27791109-27791131 GTTTCCTGACTCTGCTGAGACGG + Intergenic
972851377 4:43054961-43054983 GTTTCTTGGCTCTGGAGGGTGGG - Intergenic
978061638 4:104345985-104346007 TTTTCCCAGCTGTGCATAGTGGG + Intergenic
982122147 4:152153505-152153527 GTTTTCCATCTCTGCAGTGTTGG + Intergenic
992088078 5:73296027-73296049 GTTTCCCTCTGCTGCAGAGTCGG + Intergenic
993762551 5:91814242-91814264 GTTTGCTGGCCCTGCTGAGTTGG + Intergenic
994197052 5:96933571-96933593 TTATCACGTCTCTGCAGAGTTGG + Intronic
998339517 5:141404688-141404710 GTAGCCAGGCTCTGCAGAGCGGG - Exonic
998638087 5:143979451-143979473 GCTTCCAGGCACAGCAGAGTGGG + Intergenic
1001434380 5:171687819-171687841 GTTTCCCAGCTATCAAGAGTAGG + Intergenic
1003425617 6:5996466-5996488 GTTTCCCTTCTCTCCACAGTCGG + Intergenic
1006425619 6:33961116-33961138 GTTATCAGGCTCTGCAGATTCGG + Intergenic
1007843172 6:44733320-44733342 GTTGCCCAGGTCAGCAGAGTTGG + Intergenic
1019771553 7:2886654-2886676 CTTTCCCTGCTCTGCAGAGAAGG - Intergenic
1020119420 7:5494854-5494876 TTTTCCACGCTCTGCAGACTTGG - Intronic
1020176003 7:5882650-5882672 GGTACCCGGCACTGCTGAGTGGG + Intronic
1020462267 7:8439263-8439285 GGTTCCTTGCTCTGAAGAGTGGG + Intronic
1020637292 7:10712527-10712549 CTCTCCCGACTCTGGAGAGTTGG + Intergenic
1024768937 7:52695084-52695106 TTTCCCCAGCTATGCAGAGTTGG - Intergenic
1028498822 7:91494626-91494648 GTTGCCAGGGTCTGCAGAGAGGG - Intergenic
1028871221 7:95772980-95773002 GTCTCTCGGCTCTGCCGAGAGGG - Intronic
1032009669 7:128336498-128336520 GTTTCCAGGCTGTGCATAATAGG - Intronic
1032932978 7:136695236-136695258 GGTTCCCGCATCTGCAGGGTTGG - Intergenic
1034159476 7:148982651-148982673 CTTTCCAGGCTCTGCAGTGGGGG - Intergenic
1034418039 7:150975378-150975400 ATTTCCCTGCTCTCCAGACTGGG + Intronic
1035782584 8:2240116-2240138 CTTACCAGGCTCTGCAGAGAAGG - Intergenic
1035809537 8:2479473-2479495 CTTACCAGGCTCTGCAGAGAAGG + Intergenic
1036513466 8:9421895-9421917 GTTACCTGACTCTTCAGAGTGGG - Intergenic
1038080863 8:24134564-24134586 GTTTCCCTGTTCTGCAGGATGGG - Intergenic
1040040587 8:42912909-42912931 GTTTCCCGGGTTTGGAGAGAGGG - Intronic
1044081640 8:87892615-87892637 GTTTCCAGACTCTGGAGATTTGG - Intergenic
1045329379 8:101142375-101142397 TTTAACTGGCTCTGCAGAGTGGG - Intergenic
1046693834 8:117316264-117316286 GTTTCCCAGCTCTGCTAAGTTGG + Intergenic
1049414496 8:142489092-142489114 GCTTCCTGGCCCTGCAGAGGTGG + Exonic
1051856577 9:21574252-21574274 CTATCCAGGCTCTGCAGAGGAGG - Intergenic
1052878587 9:33585928-33585950 GTTTCCCAGATCTCCAGAGCAGG - Intergenic
1053200677 9:36149640-36149662 GTTTCCCATCTCTACAGAGAGGG + Intronic
1055392105 9:75833989-75834011 GTTTCCTGGCACTGCACAATGGG - Intergenic
1062166250 9:135108974-135108996 GTTTTCCTGCTCTGCATAGTGGG - Intronic
1188704653 X:33312306-33312328 GTGTGCGGGTTCTGCAGAGTTGG + Intronic
1189320972 X:40087085-40087107 GTTTCCATGCTCAGCAAAGTGGG + Intronic
1190319182 X:49169950-49169972 GTTTCCTGGTTCTGAAGAGAGGG - Intergenic
1196554181 X:117067530-117067552 GATTCCCAGCTCAGCAGTGTTGG + Intergenic
1198455329 X:136811984-136812006 GATTCCAGGTTTTGCAGAGTGGG - Intergenic
1200801277 Y:7389104-7389126 CTTTCCCAACTCTGAAGAGTTGG + Intergenic