ID: 1077433249

View in Genome Browser
Species Human (GRCh38)
Location 11:2526409-2526431
Sequence CAGTCCCAGCAGCGGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077433249 Original CRISPR CAGTCCCAGCAGCGGGACTA TGG Intronic
900510201 1:3055466-3055488 CATTCCCAACAGTGGGAATACGG + Intergenic
901027677 1:6287317-6287339 CAGGCCCAGCAGCTGGTCTCTGG - Intronic
901834074 1:11912365-11912387 CAGTCAGGGCTGCGGGACTATGG - Intergenic
904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG + Intergenic
904598156 1:31659484-31659506 CAGTCCCTGCTGCTGCACTAGGG + Intronic
907664767 1:56425121-56425143 CAGTCCAATCAGCGTAACTAAGG + Intergenic
909131068 1:71738178-71738200 AAGACCAAGCAGCCGGACTATGG + Intronic
912218442 1:107643924-107643946 CAGTCCCAGCAGCTAAACTGGGG - Intronic
918246257 1:182662243-182662265 CAGCACCAGAAGAGGGACTATGG - Intronic
1062889815 10:1049480-1049502 TAGTCCCAGCGGCGGAACTCGGG - Intergenic
1063360263 10:5448781-5448803 CAATCCTAGCAGTGGAACTATGG + Intronic
1063623057 10:7666872-7666894 CAGCCCCAGCAGCAGGAGCATGG + Exonic
1064287653 10:14005975-14005997 CAGTTCCATCAGCGGCTCTAAGG - Intronic
1069599601 10:69694968-69694990 GAGTCCCAGCAGCTGGAGGATGG - Intergenic
1069670224 10:70196096-70196118 CAGTCCCTTCAGAGGGAATACGG + Intergenic
1071275855 10:84054438-84054460 CAGGCCCAGCAGCAGGTCTGGGG - Intergenic
1073775193 10:106777385-106777407 AATTCCCAGCAGCTAGACTAAGG + Intronic
1075555270 10:123426443-123426465 CAGCCCCAGCAGGGTGTCTAAGG + Intergenic
1077113195 11:870888-870910 CAGGGCCAGCAGCGGGGCCAGGG - Intronic
1077433249 11:2526409-2526431 CAGTCCCAGCAGCGGGACTATGG + Intronic
1089058762 11:115608888-115608910 CAGTCCCATAAGGGGGACTTGGG - Intergenic
1092063296 12:5568259-5568281 TAGTCCCAGCTGAGGGACTGAGG - Intronic
1092736275 12:11585850-11585872 CAGTCCCAGCTGCGAGGCTGAGG + Intergenic
1093896961 12:24584415-24584437 CAGAGCCTGCAGCGGGAATATGG + Intergenic
1096070433 12:48772408-48772430 CCCTCCCTGCAGCTGGACTAAGG + Exonic
1096174338 12:49502574-49502596 TAGTCCCAGCTAGGGGACTAGGG - Intronic
1096320215 12:50605439-50605461 CCTCCCCAGTAGCGGGACTACGG - Intronic
1102007254 12:109596727-109596749 CAGTCCCAGCGGTGGGACCTAGG + Exonic
1102727163 12:115075780-115075802 CAGTCACAGCAGCCAGAATAAGG - Intergenic
1103993499 12:124814660-124814682 CAGTCCCAGAGGCGGGCCTGTGG + Intronic
1106077772 13:26475836-26475858 CAGACACAGCAGCGGGATCACGG - Intergenic
1106979546 13:35261387-35261409 CATCCCTAGCAGCTGGACTACGG - Intronic
1107814080 13:44228674-44228696 CAGTTCCAGAAGCAGGTCTAGGG - Intergenic
1108335892 13:49441979-49442001 CAGTCTCACCAGCAAGACTAAGG + Intronic
1113837213 13:113336273-113336295 CACACCCAGCAGTGGGAATAAGG + Intronic
1119115205 14:72013934-72013956 CAGACCCAGCAGCTGCAATAAGG - Intronic
1122994018 14:105252984-105253006 CAGTCCCAGCAAGGGGGCTGAGG - Intronic
1202930414 14_KI270725v1_random:29232-29254 CAGGACCAGCAACGGGGCTAGGG - Intergenic
1129791461 15:78343442-78343464 GAGTCTCAGCAGCGGGAGCAGGG - Intronic
1129794216 15:78363702-78363724 CAGGCCCAACAGTGGGACTCCGG + Intergenic
1130109185 15:80950603-80950625 GAGGCCCAGCAGAGGGAGTAGGG + Exonic
1131107582 15:89745280-89745302 AGGTCCCACCAGCGGGACGAGGG + Intergenic
1131510098 15:93045016-93045038 CAGGGCCAGGAGCGGGACGAGGG + Exonic
1132816092 16:1827254-1827276 CACTCCCAGAAGCGGGACAATGG - Exonic
1132858226 16:2057030-2057052 CGGGGCCAGCAGCGGGACTGGGG + Intronic
1133350743 16:5098611-5098633 CAGGCCCAGCAGCGAGGCCACGG + Intergenic
1134810898 16:17166258-17166280 CAGAACCAGCATCTGGACTATGG + Intronic
1136245558 16:28974043-28974065 GACTCCCAGCTGCAGGACTAGGG - Intergenic
1136718114 16:32301225-32301247 CAGGACCAGCAACGGGGCTAGGG + Intergenic
1136836489 16:33507495-33507517 CAGGACCAGCAACGGGGCTAGGG + Intergenic
1136862905 16:33713506-33713528 CAGGACCAGCAACGGGGCTAGGG - Intergenic
1138194888 16:55044717-55044739 CAGTCCCTGCAGCTGGAATCTGG - Intergenic
1139660770 16:68419275-68419297 CAGTCCCTGCAGTGGGACCCTGG - Intronic
1203008314 16_KI270728v1_random:216540-216562 CAGGACCAGCAACGGGGCTAGGG - Intergenic
1148156662 17:45428546-45428568 AACACCCAGCAGCGGGCCTACGG + Intronic
1148561188 17:48607379-48607401 CCTTCCCAGCAGCGGCACCAAGG - Exonic
1148588054 17:48794889-48794911 CAGTCACAGCTGCGGGACCTGGG + Intronic
1150388386 17:64777340-64777362 AACACCCAGCAGCGGGCCTACGG + Intergenic
1151998262 17:77626683-77626705 CATTCCCAGCAGCAGGACACAGG + Intergenic
1153155389 18:2143848-2143870 CATTCCCAGCATCTGGAATAGGG - Intergenic
1154415082 18:14172027-14172049 CAGGACCAGCAACAGGACTAGGG + Intergenic
1156481444 18:37439047-37439069 CAGTTCCAGCATCAGGACTGAGG - Intronic
1161352381 19:3801255-3801277 CAGTCCCAGAAGCTAAACTAGGG + Intronic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1166666604 19:44684003-44684025 CAGTCCCAGCAAGGTGACCACGG + Exonic
1168164229 19:54535717-54535739 CATTCCCAGCAGCTTGACCAGGG + Exonic
1168347629 19:55658754-55658776 CAGCCCCACCATCAGGACTAGGG - Intronic
925292280 2:2755869-2755891 CAGTCCCACCAGCAGGGGTAGGG - Intergenic
927813603 2:26194663-26194685 CAGTCCCAGCAGCAGGGCCAGGG - Intronic
928143638 2:28752084-28752106 CCTTCCCAGCAGCGGGAACAAGG - Exonic
930297292 2:49570586-49570608 CAGTCCCCTCAACAGGACTATGG - Intergenic
934323033 2:91984103-91984125 CAGGACCAGCAACGGGGCTAGGG - Intergenic
934606047 2:95696089-95696111 CAGACGCAGCAGCAGGACTGGGG - Intergenic
935363001 2:102263581-102263603 CAGTCCCAGGACTGGGGCTATGG - Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
937875628 2:126823265-126823287 CAGTACCATCAGGGTGACTAAGG - Intergenic
943680943 2:190766920-190766942 CAGTCTCAGAAGAGGAACTAAGG + Intergenic
946500377 2:220240875-220240897 ATGGGCCAGCAGCGGGACTAAGG - Intergenic
946997523 2:225412076-225412098 TAGTCCCAGCTGAGGGACTGAGG - Intronic
947361277 2:229347867-229347889 CAGACACAGCAGAGGGCCTAAGG - Intergenic
1170705830 20:18744201-18744223 CAGTGCCAGCAGCGGGGCTGAGG + Exonic
1170904829 20:20504366-20504388 CAGTGCTAGCAAGGGGACTAAGG - Intronic
1173106105 20:40135879-40135901 TAGTCCCAGCGGCGGGAAAATGG - Intergenic
1173869493 20:46332568-46332590 CAGAGGCAGCAGCGGGACTCAGG + Intergenic
1175846395 20:62061240-62061262 CCGTCCCAACAGCGCGATTAAGG + Intronic
1176035023 20:63031965-63031987 CAGCCCCATCAGAGGGAGTAGGG - Intergenic
1176239271 20:64068419-64068441 CAGACCCAGCAGGGGGCCTTGGG - Intronic
1176592427 21:8657828-8657850 CAGGACCAGCAACGGGGCTAGGG - Intergenic
1179890329 21:44331877-44331899 CAGTCTCAGCAGCGGAGCTGAGG + Exonic
1180179223 21:46110619-46110641 GTGTCCAAGCACCGGGACTAGGG - Intronic
1180275286 22:10634975-10634997 CAGGACCAGCAACGGGGCTAGGG - Intergenic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1181376947 22:22466356-22466378 GAGTCCCAGCAGAAGGACGAGGG + Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182779580 22:32857169-32857191 CATACCCAGCAGTGGGATTAGGG + Intronic
1182879999 22:33725044-33725066 CATTCCCAGAAGCGGGGCCAGGG + Intronic
1183387347 22:37522522-37522544 CAGTCCCAGCAGAGGCAACAGGG - Intergenic
1184663177 22:45974907-45974929 CAGCCCCAGGAGCCGGGCTAGGG + Intronic
1184723920 22:46332130-46332152 GAGCCCCAGCAGCGGGATTGGGG - Intronic
953139435 3:40213821-40213843 CACTCCCAGGAGCGGGAGTGAGG + Intronic
955328156 3:58025493-58025515 CTCTCCCAGCAGCGGCAGTAAGG + Intronic
955745871 3:62139979-62140001 CAGTCCCAGCAGGTGGAATACGG - Intronic
956472428 3:69581657-69581679 GAGTCCCAGCTGATGGACTATGG - Intergenic
960963863 3:123091096-123091118 CAGTCCCAGCAGTAGAACAATGG + Intronic
967739513 3:192989608-192989630 TAGTCCCAGCTGAGGGACTGAGG - Intergenic
968832114 4:2937870-2937892 CTGTTCCAGCAGAGGGACTGTGG + Intergenic
968916457 4:3499022-3499044 CACTCCCTGCAGCAGGGCTAGGG - Intronic
973749691 4:54001710-54001732 CAGTTCCTGCAGCTGGACCAAGG + Intronic
976648597 4:87411191-87411213 CAGTCCCAGCATTTGGACCAGGG - Intergenic
981316419 4:143344171-143344193 GAGTTCCAGCAGCAGGACCAGGG + Intronic
982291200 4:153784502-153784524 CTTTCCCAACACCGGGACTATGG + Intronic
985656014 5:1131657-1131679 CAGTCCCAGCAGCCGTTCCAGGG - Intergenic
986208587 5:5648845-5648867 AAGTCCCATCAGCGGGACTTGGG - Intergenic
987112715 5:14702076-14702098 CAGTCCCAGCAGCTCGGCTCAGG - Intergenic
991995486 5:72382373-72382395 AAGCCCCAGCACCTGGACTAAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
998007387 5:138666008-138666030 CAGGCCCAGCAGTGGGGCTGAGG + Intronic
998416056 5:141946677-141946699 CTGTCCCAGGAGAGGGACTGGGG + Intronic
1003026283 6:2558403-2558425 GACTCCCAGGGGCGGGACTAAGG + Intergenic
1018796740 6:167191734-167191756 CTATCCCAGCAGAGTGACTAAGG + Intronic
1018819582 6:167363379-167363401 CTATCCCAGCAGAGCGACTAAGG - Intronic
1018910221 6:168097457-168097479 CTGTCCCGTCAGCGGGGCTAGGG - Intergenic
1019258099 7:64433-64455 CTGCCCCAGCAGAGGGACAAAGG + Intergenic
1022255991 7:28658524-28658546 CAGTCCCTGCAGCTGCACTGGGG + Intronic
1023039286 7:36158189-36158211 CAGTCCCAGCTGAGTCACTAAGG - Intronic
1024007887 7:45241018-45241040 CAGCCCCAGCAGCAGGGCTGGGG + Intergenic
1026166124 7:67911325-67911347 CAGTGCCAGCAGAGGCACCAAGG - Intergenic
1028522974 7:91752720-91752742 CAGTCCCAGCAGGGGAAAAATGG - Intronic
1029680272 7:102103553-102103575 CAGTCCCAGCTTAGGGACTTGGG - Intronic
1033060058 7:138097526-138097548 CTGTCCCAGCAGGGGGAGCAGGG + Intronic
1040605087 8:48923690-48923712 GAGTCCCAGCAGCTGGCCTTTGG - Intergenic
1041021756 8:53645155-53645177 CTGGCCCATCACCGGGACTATGG - Intergenic
1043578457 8:81685865-81685887 CTGTCCCAGCACCGCGACTGCGG + Exonic
1045024533 8:98074012-98074034 TAGTCCCAGCTGCTGGGCTAAGG - Intronic
1045402613 8:101834278-101834300 CAGCCCCAGCAGGGGGACACCGG - Intronic
1049326675 8:142025110-142025132 CATTCCCAGCAGTGGCACAATGG + Intergenic
1052061082 9:23962200-23962222 CATTCCCAGCGGTGGGTCTATGG + Intergenic
1052820562 9:33135208-33135230 CAGCGCCAGCAGCTGGACTATGG - Exonic
1054350786 9:64015805-64015827 CAGTCCCTGCACTGGGACCAGGG - Intergenic
1057016587 9:91657682-91657704 CAGTCCCAGCAGAGGGGATGGGG - Intronic
1061088786 9:128414828-128414850 CAATCCAGGCAGCGGGACCAAGG + Intronic
1062263478 9:135675409-135675431 CATTCCCAGCAGCAGCACTCAGG + Intergenic
1062294838 9:135818928-135818950 CAGTGCCAGCAACGGGACCGGGG + Intronic
1203435025 Un_GL000195v1:130222-130244 CCGTGCCTGCAGAGGGACTAGGG - Intergenic
1203622480 Un_KI270749v1:136661-136683 CAGGACCAGCAACGGGGCTAGGG - Intergenic
1195243860 X:102979087-102979109 AAGTCCCAGCTGTGGGACTGAGG + Intergenic
1195758885 X:108225215-108225237 CAGTCCCAGGGGCGGGCCCAGGG - Intronic
1200291538 X:154879893-154879915 CAGTCCCAGCAGCAGGTAAAGGG - Intronic
1202379278 Y:24261568-24261590 CATTCCCAGCAGGGGGAGAAAGG - Intergenic
1202491504 Y:25408553-25408575 CATTCCCAGCAGGGGGAGAAAGG + Intergenic
1202583139 Y:26402789-26402811 CAGGACCAGCAACGGGGCTAGGG + Intergenic