ID: 1077433746

View in Genome Browser
Species Human (GRCh38)
Location 11:2528411-2528433
Sequence GCTGCTGCTGGGACACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 385}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077433746_1077433753 0 Left 1077433746 11:2528411-2528433 CCTGCTGGTGTCCCAGCAGCAGC 0: 1
1: 0
2: 2
3: 56
4: 385
Right 1077433753 11:2528434-2528456 CCCCACCCCAGGCACCTGGATGG 0: 1
1: 0
2: 6
3: 52
4: 512
1077433746_1077433759 13 Left 1077433746 11:2528411-2528433 CCTGCTGGTGTCCCAGCAGCAGC 0: 1
1: 0
2: 2
3: 56
4: 385
Right 1077433759 11:2528447-2528469 ACCTGGATGGTCCCTTCCATTGG 0: 1
1: 0
2: 0
3: 7
4: 126
1077433746_1077433761 22 Left 1077433746 11:2528411-2528433 CCTGCTGGTGTCCCAGCAGCAGC 0: 1
1: 0
2: 2
3: 56
4: 385
Right 1077433761 11:2528456-2528478 GTCCCTTCCATTGGCCTGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 146
1077433746_1077433750 -4 Left 1077433746 11:2528411-2528433 CCTGCTGGTGTCCCAGCAGCAGC 0: 1
1: 0
2: 2
3: 56
4: 385
Right 1077433750 11:2528430-2528452 CAGCCCCCACCCCAGGCACCTGG 0: 1
1: 1
2: 15
3: 146
4: 1006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077433746 Original CRISPR GCTGCTGCTGGGACACCAGC AGG (reversed) Intronic
900177770 1:1298375-1298397 GCTTCTTCTGGTAGACCAGCTGG + Exonic
900188460 1:1343567-1343589 GCTGCTCCTGAGACGCCAGGAGG - Intronic
900437057 1:2635769-2635791 CCGGCTGCTGGGACGACAGCCGG + Intergenic
901000289 1:6145643-6145665 GCTGCTGCTGGGGCACTGGGGGG + Intronic
901144210 1:7054151-7054173 TTTCCTGCTGGGAGACCAGCAGG + Intronic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901459799 1:9384633-9384655 TCTGCTGAGGGGGCACCAGCAGG + Intergenic
901501885 1:9657572-9657594 TCTGCTCCTGGGACCCCAGGAGG - Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901930873 1:12595605-12595627 TCTGCTCCCGGGACACCACCTGG - Intronic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902519982 1:17010832-17010854 GCCGCTGCCAGGTCACCAGCAGG - Intronic
903267334 1:22165700-22165722 GCAGGTGCTGAGAGACCAGCTGG + Intergenic
904972250 1:34428067-34428089 GCTGCTGCTGGTCAACCAGGAGG - Intergenic
905959651 1:42033007-42033029 GCTCCTGCTTGGACACCTCCAGG - Intronic
910519515 1:88103502-88103524 GCTGATGTTTGGACAACAGCTGG - Intergenic
911084244 1:93963328-93963350 GCCACTGCTGGGACACCATCAGG - Intergenic
912419245 1:109532215-109532237 CCTCCTTCTGGGACACCAGTCGG + Intergenic
912953164 1:114134572-114134594 GCAGCTGCTGTGAGACCAGGAGG + Intronic
913570066 1:120110854-120110876 GCTGCTGGGGAGACATCAGCCGG + Intergenic
913983444 1:143544255-143544277 GGTGCTGCTGGGAAAGCAGTGGG - Intergenic
913985853 1:143565423-143565445 ACTGCAGCTGCGACAGCAGCTGG + Intergenic
914290875 1:146271820-146271842 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914551919 1:148722603-148722625 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914806426 1:150995377-150995399 GCTGAACCTGGGAGACCAGCTGG + Exonic
915549191 1:156622811-156622833 GCTGGTGCTGGGATTACAGCAGG - Intronic
917494430 1:175527181-175527203 GTTGCTTCTAGGATACCAGCTGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
921482027 1:215674674-215674696 GCTGCAGGTGGGAAACCAGCAGG + Exonic
922996915 1:229971477-229971499 GCTGTTCCTGGAACGCCAGCCGG - Intergenic
923227277 1:231949684-231949706 AGAGCTGCTGGGACACTAGCAGG - Intronic
923462582 1:234219945-234219967 GGTGGCGCTGGGAGACCAGCAGG + Intronic
923685495 1:236150656-236150678 GCTGCTGCCGGGTCACCATCAGG + Intronic
923730262 1:236543397-236543419 GCTGCTGCAGGGGACCCAGCTGG + Intronic
924200881 1:241657296-241657318 GCTGCTGCTAGGAGGCCAGATGG - Intronic
924352177 1:243126546-243126568 GCTGCGGCTGAAACAGCAGCAGG + Exonic
1064582708 10:16810447-16810469 GCTGCTGGGGGAACAGCAGCAGG - Intronic
1064966482 10:21020010-21020032 GTTCCTGCTGGGTCACCAGCCGG - Intronic
1067055325 10:43046510-43046532 GCTGCTGCTGGGCCCTCAGGTGG - Intergenic
1067299729 10:44997473-44997495 ATTTCTGCAGGGACACCAGCTGG + Intergenic
1067972713 10:50991296-50991318 GCGGCGGCTGGGACGGCAGCCGG - Intergenic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1068982164 10:63073079-63073101 GCTGCTGTGGGGACACGGGCTGG + Intergenic
1069108384 10:64411456-64411478 CCTGCTGCTGGTACATTAGCGGG - Intergenic
1069621961 10:69842867-69842889 GCTGCTGCTGGGTCACTGCCGGG - Intronic
1069679979 10:70277537-70277559 TGTGCTGGAGGGACACCAGCTGG + Intronic
1070806262 10:79272878-79272900 GCTGGGGCTGGGACAGCAGCAGG - Intronic
1074536079 10:114329448-114329470 GCTGCTGGTGGGTCCCCACCTGG - Intronic
1075483414 10:122800469-122800491 GCTGCTGCTGGGACCCAGGTGGG - Intergenic
1075815827 10:125264231-125264253 GCAGCTGCTGGGACGCAGGCTGG + Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076518475 10:131063259-131063281 GCTACTGCTAGGATACCAGCTGG - Intergenic
1076546522 10:131249091-131249113 CCTGATGCTGGGAATCCAGCAGG + Intronic
1076976962 11:180269-180291 GCTGCTTCTGGCACTTCAGCGGG + Intronic
1077366437 11:2163175-2163197 GGGGGTGCTGGGACACCAGCTGG - Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1078198154 11:9153917-9153939 GCAGTTGCTGGGTGACCAGCTGG - Intronic
1080857615 11:36125955-36125977 GCTTATGCTGGGACCCCACCAGG + Intronic
1081383433 11:42443772-42443794 GCTGCTGGTTGGAAACCAGTGGG - Intergenic
1083668678 11:64288685-64288707 GCTGCTCCTGGGAGCACAGCCGG + Exonic
1084137260 11:67194296-67194318 GCAGCTGCTGGGACAGCTGGGGG - Intronic
1084196756 11:67527159-67527181 GCTGCTGATTGAACACAAGCAGG - Intergenic
1084275215 11:68047824-68047846 GGTGCTGCGGGGCCCCCAGCCGG - Intronic
1085098436 11:73779715-73779737 GCTGACGGTGGCACACCAGCGGG - Intergenic
1085394675 11:76201257-76201279 GCTGACGCTGGGACAGGAGCAGG + Intronic
1086457899 11:86977376-86977398 GCTGCTTCTGGGGAACCAGCTGG + Intergenic
1087170835 11:95049146-95049168 GGTGGAGCTGGGACTCCAGCTGG + Intergenic
1087693619 11:101350375-101350397 GCTTCTTCAGGAACACCAGCAGG + Intergenic
1088628622 11:111752158-111752180 GCCGCTGCTGGCAGGCCAGCTGG - Exonic
1089138729 11:116269857-116269879 CCTGCTGCTGGGAGAGAAGCAGG + Intergenic
1089269500 11:117291881-117291903 GTTACTGCTGGGGCCCCAGCTGG + Intronic
1089738067 11:120563633-120563655 GCAGCTGCGGGGAGACCAGCTGG - Intronic
1090641532 11:128733404-128733426 GATGCTTCCGGGACACCAGCAGG - Intronic
1091388255 12:108914-108936 GCAGTTGCTGGGTCACCAGCAGG - Intronic
1091445589 12:542766-542788 GCTGCTCCTGGGACAGCCTCGGG - Intronic
1091601034 12:1917934-1917956 GCAGCTTCTGGGACACCTGAAGG - Intronic
1091814658 12:3428174-3428196 TCTCCTGCTGGGAAACCTGCTGG + Intronic
1091826989 12:3520174-3520196 GCAGTTGCTGGGTCACCAGAAGG + Intronic
1092170539 12:6371369-6371391 GCAGCTGGTGGGAGCCCAGCGGG - Intronic
1092868670 12:12786828-12786850 CCTGCTGCCCGGACGCCAGCGGG - Intronic
1092936250 12:13366961-13366983 GCTGCTGCTGGCCCACCTGTGGG - Intergenic
1095952637 12:47790110-47790132 GCTGGTGCTGGGACTTAAGCTGG - Intronic
1095953094 12:47791946-47791968 GCTCCTGCGGTGACAACAGCAGG - Exonic
1096007285 12:48183650-48183672 GCTGCTGCTGCCACACTCGCGGG + Exonic
1096053747 12:48633671-48633693 GCTGCTGCTGCTACAACTGCTGG + Intergenic
1097040626 12:56153976-56153998 GCTGCTGCTGGCTTAGCAGCAGG - Exonic
1102470182 12:113155346-113155368 CCTGATGCTGGCACACTAGCTGG - Exonic
1104149699 12:126070821-126070843 GTGGCTGCTAGGACACCAGATGG + Intergenic
1104963979 12:132500890-132500912 GCTGCTGCTCATACCCCAGCAGG + Intronic
1105018639 12:132801823-132801845 GCTGCTGCTGGTACCACTGCCGG + Exonic
1105022495 12:132826559-132826581 TGGGCTGCTTGGACACCAGCAGG - Intronic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106041800 13:26100627-26100649 CCTGCTGCTGGTACATCAACTGG + Intergenic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1106671442 13:31910070-31910092 GCTGCACGTGGGACACCAGAGGG + Intergenic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1107069742 13:36256924-36256946 GCTGCTGCTGGCCCACCTGTGGG - Intronic
1108450147 13:50554042-50554064 GTTGCTGCAGTGACACCAGCAGG + Intronic
1108476684 13:50826166-50826188 GCTGCTGCTGATACAACAGGAGG + Intronic
1108794420 13:54014138-54014160 GCTACTGCAGAGACTCCAGCAGG - Intergenic
1112300212 13:98223126-98223148 GCAGCTGATGGGACAGAAGCAGG + Intronic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1113397567 13:109962802-109962824 GCTGCTGCTGCCACAGCCGCCGG + Intergenic
1113490993 13:110691810-110691832 GCAGATGCTTGGACACCAGAGGG + Intronic
1113657441 13:112076348-112076370 GCTGCTTCTGGGGCTCCAGCGGG + Intergenic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1114519065 14:23321646-23321668 GCTGCTGCTGGAGCCCGAGCCGG + Exonic
1114551574 14:23535406-23535428 GAGGCTGCAGGGACCCCAGCTGG + Intronic
1118246213 14:64113538-64113560 GCAGGTGCTGGAACAGCAGCTGG + Exonic
1119705602 14:76780973-76780995 GCAGTTGCTGGGTCACCAGCGGG + Exonic
1119728642 14:76937437-76937459 GCTGAGGCTGGAACACCATCAGG + Intergenic
1120787466 14:88550535-88550557 GCGGCTGCTGGGTGAGCAGCTGG - Exonic
1120946234 14:90000184-90000206 GATGCTTCTTGGAGACCAGCAGG + Intronic
1122068400 14:99189586-99189608 GCGGCTACTGGGTCAGCAGCTGG + Intronic
1122278889 14:100609875-100609897 GCTGGGGCTGGGGCAGCAGCAGG + Intergenic
1122317469 14:100834678-100834700 GCTGGTGCTGGGACACCCTGAGG - Intergenic
1123041651 14:105492689-105492711 CCTGCTGACTGGACACCAGCTGG - Exonic
1202904041 14_GL000194v1_random:58453-58475 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1125723274 15:41855316-41855338 GCAGCTGCAGCTACACCAGCTGG - Exonic
1127287792 15:57546024-57546046 GCTGGGGCTGGGCCATCAGCCGG + Intronic
1127760593 15:62135830-62135852 GCTGCTGCTGGGAAACGAAGAGG - Intergenic
1127772890 15:62244834-62244856 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1127900325 15:63336294-63336316 GCAGCTGCTTAGACACAAGCCGG + Intronic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128446489 15:67766189-67766211 TCTGCTGAAGGGACACAAGCTGG - Intronic
1128704091 15:69825959-69825981 GCTGTTGCTGGGAGATTAGCAGG - Intergenic
1129030061 15:72611519-72611541 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129038286 15:72664267-72664289 GCTGCAGCTGGTCCACGAGCTGG - Intronic
1129364553 15:75046361-75046383 GCTGCTGCTGACCCGCCAGCAGG - Intronic
1129530651 15:76261630-76261652 GCTGCTGCCGCCACAGCAGCTGG - Intronic
1129728725 15:77917239-77917261 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1129839791 15:78736632-78736654 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129851471 15:78796362-78796384 GCTGCTGTGGGGACACCATAGGG - Intronic
1130938172 15:88487579-88487601 TATGCTACTGGGGCACCAGCAGG + Intergenic
1131269138 15:90935763-90935785 GCTGATGCTTGGGCCCCAGCTGG + Intronic
1131748752 15:95481775-95481797 ACTTCTGCTGTGACATCAGCTGG + Intergenic
1132130734 15:99275990-99276012 GCTGCTGATGGGACAGGAGGTGG - Intronic
1132414373 15:101610126-101610148 GCAGCTGCAGGGGCATCAGCAGG + Intergenic
1132544937 16:528552-528574 GGGGCTGCTGCGGCACCAGCTGG + Intronic
1132713161 16:1278199-1278221 GCGGGTGCTGGGACCCCAGCCGG + Intergenic
1132867339 16:2100021-2100043 GCTGCAGCTCAGCCACCAGCAGG + Exonic
1132873030 16:2124031-2124053 GCGGCTGCTGGGGCACCACTGGG + Intronic
1134022523 16:10930887-10930909 CCTGCTCCTGAGACACCTGCTGG + Exonic
1134055334 16:11166457-11166479 GCTGCCGCTGGGGCTCCCGCTGG - Exonic
1134514281 16:14874110-14874132 GCTGCTGCAGTGACCCCAGAGGG - Intronic
1134524438 16:14933094-14933116 GCTGCAGCTCAGCCACCAGCAGG - Intronic
1134552118 16:15143210-15143232 GCGGCTGCTGGGGCACCACTGGG + Intergenic
1134712026 16:16331581-16331603 GCTGCAGCTCAGCCACCAGCAGG - Intergenic
1134719883 16:16374874-16374896 GCTGCAGCTCAGCCACCAGCAGG - Intergenic
1134947543 16:18337011-18337033 GCTGCAGCTCAGCCACCAGCAGG + Intergenic
1134954802 16:18377113-18377135 GCTGCAGCTCAGCCACCAGCAGG + Intergenic
1135562339 16:23486441-23486463 CCTGTTGCTGGGACCCAAGCTGG + Intronic
1135920317 16:26643599-26643621 TCTGCTTCTGAGACACCAACTGG - Intergenic
1138651678 16:58464433-58464455 GAAGGTGCTGGGACACCGGCTGG + Exonic
1140456359 16:75107784-75107806 GCTGAGCTTGGGACACCAGCGGG + Exonic
1140457830 16:75115038-75115060 GCTGCTGGGGGGACACCCGCGGG - Intronic
1140968147 16:79987353-79987375 ACTGCTGCTTGGACAACAGCAGG - Intergenic
1142019548 16:87772732-87772754 CATGCTGCTGGCACTCCAGCCGG - Intergenic
1142045984 16:87925584-87925606 GCTGGTGCTGGGAAAACACCAGG + Intronic
1142132374 16:88436941-88436963 GCTGCTGCGGGGGCACCTGCAGG + Exonic
1142188088 16:88704023-88704045 GCTCCTGCTGGGCCCCCAGGGGG + Intronic
1142227386 16:88884265-88884287 CCTGCTGCTGGGCCCCCACCGGG + Intronic
1142443298 16:90116401-90116423 GCTGCTTCTGGCACTTCAGCGGG - Intergenic
1142464100 17:118443-118465 GCTGCTTCTGGCACCTCAGCGGG + Intergenic
1142625226 17:1187474-1187496 GCTGCTGTTGGGAACACAGCTGG + Intronic
1144930628 17:18856129-18856151 GCAGCTGCTGGGATGCCAGGAGG - Intronic
1146637672 17:34518364-34518386 GCTGGTGCTGGCACACCTGGAGG + Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1147517955 17:41140053-41140075 GCAGCAGCTGGGACGGCAGCAGG + Exonic
1147517989 17:41140278-41140300 ACAGCAGCTGGGACAGCAGCTGG + Exonic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG + Exonic
1151349572 17:73523828-73523850 GCTTCTGCTGGGGCAGCATCTGG - Intronic
1151650970 17:75469262-75469284 GGGGCAGCTGGGACAGCAGCAGG - Intronic
1151678093 17:75610214-75610236 GCAGGGGCTGGGCCACCAGCAGG - Intergenic
1151842326 17:76627191-76627213 GCTGCTGCTGGGGCACTGGAGGG + Exonic
1152257901 17:79251017-79251039 CCTGAGGTTGGGACACCAGCCGG - Intronic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152483163 17:80569953-80569975 GCTGCTGGTGAGACTCCAGGAGG - Intronic
1152588037 17:81197711-81197733 CCTCCTGCTGGGAGTCCAGCTGG + Exonic
1152882341 17:82825577-82825599 GCAGCAGCAAGGACACCAGCAGG - Intronic
1152937689 17:83150047-83150069 TCTGGAGCTGGGCCACCAGCAGG - Intergenic
1153043085 18:832355-832377 GCTGCTTCAGAGACACCAGCTGG + Intergenic
1154492021 18:14929933-14929955 GCTTTTGCTGGGACTCCATCTGG - Intergenic
1155789503 18:29947721-29947743 CTTGCTGCTGCTACACCAGCAGG - Intergenic
1157678133 18:49582721-49582743 GAAGCTGCTGGGTCAGCAGCTGG + Intronic
1157747212 18:50146417-50146439 GAAGCTGCTGGCACTCCAGCGGG - Intronic
1157927309 18:51780419-51780441 GCGGCTGCCAGGGCACCAGCAGG + Intergenic
1161155758 19:2731325-2731347 GCTGCAGCAGGGCCACCGGCCGG + Intronic
1161222892 19:3126169-3126191 GCTGCTGCTGGGAGGACAGACGG + Intergenic
1161298554 19:3532008-3532030 GCGGCTGCAGGGCCACCGGCAGG + Exonic
1161459613 19:4389046-4389068 GCTGCTGTTGAGCCACCACCAGG + Intronic
1161507552 19:4652085-4652107 GCTGCTGCGTGGGGACCAGCTGG + Exonic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162740535 19:12771184-12771206 GCTGCTGCTGCAATCCCAGCTGG - Exonic
1162904944 19:13817819-13817841 GCTGGGGCTGGGGCAGCAGCGGG + Exonic
1163370732 19:16899850-16899872 AGTGCAGCTGAGACACCAGCAGG - Intronic
1163606869 19:18280455-18280477 CCTGGTGCTGGGGCAGCAGCTGG + Exonic
1163640940 19:18461628-18461650 GCTGCTGCTGCGACTGCAGAAGG - Exonic
1164143234 19:22493031-22493053 GCTGCTTCTGGGACCCCACAGGG + Intronic
1165148638 19:33748514-33748536 GCTTCTGCTGGGGTCCCAGCTGG + Intronic
1166220956 19:41364141-41364163 GTTGTTGCTGGGGCAACAGCAGG + Exonic
1166381514 19:42357514-42357536 GCAGCTGCTGGAGTACCAGCTGG + Exonic
1166812444 19:45522429-45522451 GCTGCAGCTGGGACCCCCGAAGG - Exonic
1168354397 19:55692485-55692507 TCTGCCCCTGGGACCCCAGCTGG - Intronic
925289880 2:2740404-2740426 GCTGATGGAGGAACACCAGCTGG + Intergenic
926326420 2:11788173-11788195 GCTGCTGCTGGGCCCTCAACTGG + Intronic
926684954 2:15691227-15691249 GCTGCTGCAGGGAGACCCGGCGG + Intronic
926892406 2:17649759-17649781 GCTGCAGCGGGGACAGAAGCAGG - Intronic
927075692 2:19574780-19574802 GTTGCAGCTGGGGCTCCAGCAGG - Intergenic
927480267 2:23448226-23448248 GCAGGTGCTCTGACACCAGCAGG + Intronic
930002005 2:46867837-46867859 GCTGTTCATGGGGCACCAGCTGG - Intergenic
932332237 2:70904327-70904349 GGTGGAGCTGGGATACCAGCAGG + Intronic
932338283 2:70943448-70943470 CCTGCTGCTCGGACACCTGCAGG - Intronic
933346118 2:81087824-81087846 GATGCCCCTGGGACACCAGATGG - Intergenic
934045200 2:88168066-88168088 GCTGCTTCTGGTATCCCAGCTGG - Intergenic
934169086 2:89324424-89324446 GCTTCTGCAGGGACTCCAGCGGG + Intergenic
934198207 2:89858160-89858182 GCTTCTGCAGGGACTCCAGCGGG - Intergenic
937290951 2:120781371-120781393 GCTGCTGCTCTGACCCCGGCAGG - Intronic
937656526 2:124383068-124383090 GCTGGAGCTGGGACACCTGGAGG - Intronic
937855031 2:126666105-126666127 GCAGCTGCTGGGACACAGGTGGG - Intronic
937858680 2:126691356-126691378 ACTTCTGCTGGGACTCCAGAGGG - Intronic
937859180 2:126694941-126694963 ACTTCTGCTGGGACTCCAGAGGG - Intronic
937986434 2:127640195-127640217 GCTGCAGCTGTGAGCCCAGCCGG - Intronic
938313982 2:130314071-130314093 GCTGCTTCTGGACCAGCAGCAGG + Intergenic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
940777878 2:157903564-157903586 GCTTCTGCTGGGCTAGCAGCAGG + Intronic
941403781 2:165063549-165063571 GCTGCTGATGGGACAGGAGGTGG + Intergenic
941703754 2:168635267-168635289 GCTCCCTCAGGGACACCAGCTGG - Intronic
942127864 2:172845553-172845575 GATGTAGCTGGGACAGCAGCTGG + Intronic
942565995 2:177264899-177264921 CCGCCTGCTGGGACCCCAGCTGG - Exonic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
943093741 2:183404456-183404478 GCTGCTGCTGGCACATGAGAAGG - Intergenic
943627555 2:190216906-190216928 GCAGTTGCTGGGTCACCAGCAGG + Intronic
947300295 2:228681901-228681923 GGTGCTGATGGGACAAAAGCTGG + Intergenic
947349732 2:229231072-229231094 GCTTCAGCTGGGACACTGGCTGG - Intronic
947425658 2:229980852-229980874 GCTGCTGGCGGGAAACCACCTGG - Intronic
948257351 2:236577890-236577912 GCAGCAGCAGGGACAGCAGCTGG - Intronic
948681032 2:239634841-239634863 GATGGTGCAGGGACCCCAGCAGG + Intergenic
948920232 2:241062922-241062944 GCTGCAGCTGTCACCCCAGCGGG - Intronic
1169209920 20:3760161-3760183 CATGCTCCAGGGACACCAGCGGG + Exonic
1171133388 20:22675606-22675628 GCTGCTGCTATCAAACCAGCAGG + Intergenic
1172093022 20:32446920-32446942 GCTGCCACAGGGACACCACCAGG - Exonic
1172527041 20:35606187-35606209 GCTGCTGCAGGGAGATCACCAGG + Intergenic
1173944170 20:46936914-46936936 ACTGCTTCTGGGACCCGAGCGGG - Intronic
1174136370 20:48382809-48382831 GCTGGGGCAGGGAGACCAGCAGG + Intergenic
1174407321 20:50310669-50310691 GCTGCCGCTGGGCCCCCAGGAGG - Intergenic
1174837890 20:53875574-53875596 GCTGCTGTTCGGAGACCTGCAGG - Intergenic
1175246772 20:57586761-57586783 GCTTTGGCTGGGACACCAGTGGG + Intergenic
1175502537 20:59460594-59460616 GCTGCTGCTGGCACCCTAGAGGG - Intergenic
1175904799 20:62374445-62374467 GGAGCTGCTAGGACACCAGCTGG + Intergenic
1175910017 20:62400668-62400690 GCTTCTGCTGGGACCCCCACGGG - Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176001013 20:62831208-62831230 GCAGCTGCTGCAAGACCAGCAGG - Intronic
1176032141 20:63017764-63017786 CCCGCTGCTGGGACCACAGCAGG + Intergenic
1176161073 20:63649127-63649149 GCTCCTCATGGGCCACCAGCTGG - Intronic
1176623413 21:9073220-9073242 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1178785135 21:35646726-35646748 TCTGCTGCTGTGGCAGCAGCAGG + Intronic
1179563039 21:42228816-42228838 GCTGGTGTTGGGACAACAGTGGG - Intronic
1179831607 21:44000541-44000563 GCTGGTGCAGGGACAGCAGTGGG - Intergenic
1180082513 21:45493325-45493347 GCTGCTGCTGTGACACGTGAGGG + Intronic
1180090602 21:45531989-45532011 GCTGCTGCTGGGCCACTCGGTGG - Exonic
1180222286 21:46366641-46366663 GCTGCTCCTGGGCCTCCTGCAGG - Exonic
1180786288 22:18549581-18549603 GGTGCTGCTGGGACAACAGAGGG - Intergenic
1180919733 22:19515360-19515382 GCTGTTGCTGGGAAGCCAGTCGG - Intronic
1181005285 22:20010505-20010527 GCTCCTGCAGGGAAACCAGAGGG + Exonic
1181030960 22:20148763-20148785 GCTGCTGCTGGGCGCCCTGCTGG - Exonic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181131570 22:20735308-20735330 GGTGCTGCTGGGACAACAGAGGG - Intronic
1181243210 22:21489135-21489157 GGTGCTGCTGGGACAACAGAGGG - Intergenic
1181440148 22:22931539-22931561 GCTGCTCCTGGAAACCCAGCAGG + Intergenic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1181748950 22:24975873-24975895 GATGCTGCTGACTCACCAGCAGG + Intronic
1181973498 22:26711557-26711579 GCTGCTGCTGCTACTGCAGCAGG - Intergenic
1182777803 22:32843738-32843760 TCTTCTGATGGGACCCCAGCAGG - Intronic
1183290948 22:37001836-37001858 CCTGCTCCTCGGAGACCAGCTGG + Exonic
1184048591 22:41988003-41988025 CATGCTGCTGGGACACCAGTGGG - Intronic
1184670178 22:46008129-46008151 GCGACTGCTGGGAGAGCAGCTGG + Intergenic
949544621 3:5061800-5061822 CCTGCAGCTGGGGCTCCAGCTGG + Intergenic
950544559 3:13630680-13630702 ACGTCTGCAGGGACACCAGCAGG - Exonic
950604247 3:14064370-14064392 GCTGCTGCTGGGGCTGCTGCTGG - Exonic
952155805 3:30642254-30642276 GCTGCTGAGGGGACAGCACCTGG - Intronic
952312497 3:32202780-32202802 GCTGCTGGAGGGAGAGCAGCTGG - Intergenic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
953301425 3:41780557-41780579 CCTGCTGCAAGGACTCCAGCAGG - Intronic
953980081 3:47409224-47409246 GCTGCTCCAGGGACACGCGCTGG - Exonic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
954372783 3:50177372-50177394 GCTGCTCCTGAGACCCCGGCAGG - Intronic
954938101 3:54345429-54345451 ACTGCTGAAGGGAAACCAGCTGG + Intronic
956704013 3:71983704-71983726 GTTGCTGCTGAGACACCAGGTGG + Intergenic
957648866 3:82972226-82972248 GCTGTTGTTGGTACACAAGCAGG - Intergenic
960485803 3:118251495-118251517 GCAGCAGCTGGCAAACCAGCTGG - Intergenic
960997557 3:123349997-123350019 AGTGCTGCTGGGACAGCAGGTGG - Intronic
961797251 3:129418394-129418416 GCTGGAGCTGGGGCACCATCTGG + Exonic
962148631 3:132869173-132869195 TCTGCTGATGGGAAACCATCTGG + Intergenic
963121128 3:141778031-141778053 AAAGCTGCTGGGACACCTGCCGG - Intergenic
966786621 3:183628774-183628796 CCTGCTGCTGGAATCCCAGCAGG - Intergenic
966822861 3:183938797-183938819 GCTGCTGCTGTGGCAACAGGAGG - Intronic
967108677 3:186273816-186273838 GCTGCTGCAGGGAGGCCCGCTGG - Intronic
967853644 3:194100425-194100447 GTTGCTGTTGGGACCACAGCAGG - Intergenic
967915278 3:194573783-194573805 CCTCCTCGTGGGACACCAGCTGG - Intergenic
968363616 3:198167789-198167811 GCTGCTTCTGGCACCTCAGCGGG - Intergenic
968759437 4:2434457-2434479 GCTCCTGCTGGAATGCCAGCTGG - Intronic
968762749 4:2450940-2450962 GCTGCTGCTTGGAGCCCTGCAGG - Exonic
968900629 4:3429975-3429997 GCTGCAGCTGGGACCCGGGCGGG + Intronic
970894251 4:21084071-21084093 GCTTCTGCTGTGGCTCCAGCAGG + Intronic
974197717 4:58598085-58598107 GATGCTTCTGGGATACCAGCTGG + Intergenic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
976401092 4:84608113-84608135 TTTCCTGCTGGTACACCAGCTGG - Intronic
977167017 4:93711755-93711777 GCTGCTGCTGGGGCATGGGCGGG + Intronic
978567969 4:110104755-110104777 GCACTTGCTTGGACACCAGCTGG + Intronic
979249766 4:118553981-118554003 GCTGCGGCTGAAACAGCAGCAGG - Intergenic
979779596 4:124633693-124633715 GCAGCTGCTGGCAAACAAGCAGG - Intergenic
980820860 4:138014960-138014982 CTAGCTGCAGGGACACCAGCAGG - Intergenic
980930089 4:139176795-139176817 GCTGCGGCGGTGACACCGGCCGG - Intronic
981810103 4:148764316-148764338 GTTGCTGCAGCTACACCAGCAGG - Intergenic
984512978 4:180701558-180701580 GCTCCTGTTGGGCCACCAGCTGG - Intergenic
985368125 4:189255309-189255331 ACTGCTGCTGGGCCACTAACAGG + Intergenic
985425690 4:189828344-189828366 TCTGCTGCAGAGCCACCAGCTGG + Intergenic
986607420 5:9536020-9536042 GCTGCTGCTATGACAGGAGCAGG - Intronic
988701592 5:33680406-33680428 GGTGCTGCTGGGACTACAGAGGG + Intronic
988958729 5:36347758-36347780 GCTTTTGCTGGGACTTCAGCTGG + Intergenic
991349238 5:65703601-65703623 GCCTCTGCTGGGACATCAGGTGG - Intronic
991454977 5:66793299-66793321 CCGCCTGCTGGGACACCAGCCGG + Intronic
995831966 5:116363292-116363314 GCTGCTCCTAGGACAACAGATGG - Intronic
997417009 5:133736755-133736777 GCTGCAGGTTGGACACCAGCAGG - Intergenic
997585451 5:135040533-135040555 GCTGCCGCTGGGAGACGGGCTGG + Intronic
997900603 5:137760459-137760481 GCTGCTGCTGTGACAGTAGACGG + Intergenic
999315647 5:150582348-150582370 GCTGGTGCTGGGAGAAGAGCCGG - Intergenic
1000718366 5:164675991-164676013 GCTCCTGCTGGGAAAGCTGCAGG - Intergenic
1001245219 5:170101055-170101077 GATGCTGGTGGTTCACCAGCTGG - Intergenic
1001423116 5:171601778-171601800 GTCGCTACTGAGACACCAGCAGG + Intergenic
1001456268 5:171862690-171862712 GCTGCTGCTGTGGCCCCAGCAGG - Exonic
1002329974 5:178434577-178434599 GCTCTTCCTGGGACCCCAGCTGG + Intronic
1002474981 5:179459832-179459854 TCAGCGGCTGGGGCACCAGCAGG - Intergenic
1002572083 5:180145814-180145836 GCTGCTGCTGGGACCTCTGCAGG + Intronic
1002770013 6:282526-282548 GCTGCTGCTGGGACACTTGAGGG + Intergenic
1003405189 6:5822080-5822102 GATGCTGCTGGAACCCCAGCAGG + Intergenic
1003603809 6:7542010-7542032 GCGGCGGCGGGGGCACCAGCAGG + Exonic
1005851252 6:29824435-29824457 GCTGCTTATGGCACAGCAGCTGG - Intergenic
1005858634 6:29884368-29884390 GCTGCTTGTGGCACAGCAGCTGG - Intergenic
1005992764 6:30913851-30913873 GCTGCTGCTGGCCCACGCGCGGG + Exonic
1006055036 6:31377851-31377873 GCAGCTGCTGGGGCTCCACCAGG - Intergenic
1006310049 6:33250924-33250946 GCTGCGGCTGGGACAGCACCCGG + Exonic
1006436363 6:34027846-34027868 GGCGCTGCTAGGGCACCAGCTGG + Intronic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1007497300 6:42268966-42268988 GAGGCTGCTGGGGCACCTGCTGG + Exonic
1007647734 6:43395859-43395881 GCAGTTGCTGGGTCATCAGCAGG + Intergenic
1011541718 6:88437546-88437568 GCTGCTGCTGTGGCATCTGCTGG - Intergenic
1014067282 6:117142272-117142294 GCTGCTGCTTTGACATCTGCAGG - Intergenic
1016986033 6:149896590-149896612 GCTGCTGTGGGGACACCAGCGGG + Intronic
1017354637 6:153489052-153489074 GTTGCTGCTGAGAGCCCAGCAGG - Intergenic
1017905875 6:158757228-158757250 GCAGCTGCCGGGTCACCAGCTGG - Exonic
1019176110 6:170160329-170160351 GCTCCTTCTGGGACACCTGTTGG + Intergenic
1019252086 7:20894-20916 GCTGCTTCTGGCACTTCAGCGGG + Intergenic
1019527348 7:1486735-1486757 GCAGCTGCTGGGCCGCCTGCAGG - Exonic
1019641863 7:2107571-2107593 CGAGCTGCTGGGACGCCAGCAGG - Intronic
1020275419 7:6621783-6621805 GCAGCTGCTGGAACAGCAGCAGG + Exonic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1020427577 7:8086454-8086476 GCTGCTGCTGGGATGGCTGCTGG - Exonic
1022547149 7:31200191-31200213 ACTGCTGCTGTGGCACCTGCTGG - Intergenic
1023201800 7:37706173-37706195 GCTGTTACTGTGACACCTGCAGG - Intronic
1023281238 7:38572742-38572764 GGTCCTGCTGGGAGACCAGAGGG - Intronic
1024043936 7:45574882-45574904 GCTGCAGCTGGGGCACCTGCAGG - Exonic
1024063638 7:45716184-45716206 GCTGCTACTGGGACATCCACAGG + Exonic
1024248072 7:47485435-47485457 CCTGGAGCTGGGGCACCAGCTGG - Intronic
1025097528 7:56107937-56107959 GCTGTTGCTGGGACACAGGAAGG - Intergenic
1026486974 7:70830154-70830176 GGTGCAGCTGGGGCATCAGCAGG - Intergenic
1026806809 7:73434034-73434056 GCTGCTGCTGTGGCAGCTGCTGG + Exonic
1027734372 7:81914405-81914427 GCTGCTGCTGAGTCTGCAGCGGG + Intergenic
1028792254 7:94866431-94866453 CCTGCTTCTGGGACTCCAGCTGG - Intergenic
1030364131 7:108626882-108626904 GCTGCTGATGGAAGTCCAGCAGG - Intergenic
1031235374 7:119168865-119168887 GCTGCTACCGGGAATCCAGCTGG - Intergenic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1033397759 7:140992218-140992240 GCTTGTGGTGGGAGACCAGCAGG - Intergenic
1034324779 7:150220513-150220535 GCAGCTGCTGGGACCCCGGAGGG + Intergenic
1034462291 7:151204616-151204638 GCGGCTGCTGCGACGCCTGCTGG - Exonic
1034539402 7:151746702-151746724 GCTGCTCCTGGGACGGCTGCTGG + Intronic
1034768412 7:153748718-153748740 GCAGCTGCTGGGACCCCGGAGGG - Intergenic
1034896189 7:154877902-154877924 GTGGCTGCTGGGTCAGCAGCGGG + Intronic
1035026771 7:155831403-155831425 ACCGCTGCTGGGAAACCCGCCGG - Intergenic
1035236811 7:157502634-157502656 GCTGCCCCTGACACACCAGCTGG - Intergenic
1037927367 8:22854349-22854371 TCTGCTTCTGGGACACTATCAGG + Intronic
1039440070 8:37588890-37588912 TCTCCTGCTGGCACTCCAGCAGG + Intergenic
1040888656 8:52292298-52292320 GCTGCTGCTTGGACGCCAGATGG + Intronic
1041244852 8:55880162-55880184 GCCGCGGCTGTGCCACCAGCCGG + Intronic
1041377005 8:57215533-57215555 GCAGCTGATGGCACAGCAGCAGG + Intergenic
1042940730 8:74105155-74105177 GCTGATTCTGAGACATCAGCAGG - Intergenic
1043147088 8:76672879-76672901 GTTGCTGCTGTCACGCCAGCCGG + Intergenic
1043419279 8:80082679-80082701 GCTGCTGCTGGGAGAAGAGGGGG - Intronic
1045184504 8:99823427-99823449 GCAGCTGCTGGGAGACCATGAGG + Intronic
1045485935 8:102631232-102631254 TTTGCTGCTGGGGCAGCAGCAGG + Intergenic
1048296299 8:133217026-133217048 GATGATGCTGGGATTCCAGCTGG - Intronic
1048928732 8:139293883-139293905 CCTGCTGCTGAGGCAGCAGCTGG + Intergenic
1048951940 8:139503742-139503764 GCTGCTCCTGAGCCACCACCAGG - Intergenic
1049054410 8:140224154-140224176 GCTGCTTGTGGGACATCAGGTGG - Intronic
1049411853 8:142477107-142477129 TCGGCTGCTGGGTCACCTGCAGG - Exonic
1049659374 8:143812841-143812863 GCAGGTTCTGGGACAGCAGCAGG + Exonic
1050081511 9:1920566-1920588 GCTGCTGGTCTGACCCCAGCAGG - Intergenic
1055082874 9:72284440-72284462 GCTGCTGCTGTGGGACCTGCTGG + Intergenic
1055724113 9:79209215-79209237 GCTGCTGCAGGTAAACAAGCAGG + Intergenic
1056557636 9:87703106-87703128 ACTGCTGCAGCGACATCAGCTGG - Exonic
1056569013 9:87799596-87799618 ACTGCTGCAGTGACATCAGCTGG + Intergenic
1056810082 9:89757364-89757386 GGTCCTGCTGGGACTGCAGCTGG + Intergenic
1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG + Intronic
1060030981 9:120214590-120214612 GTTGCTCCTGAGACTCCAGCTGG + Intergenic
1060296839 9:122348676-122348698 TTTGCAGCTGGGGCACCAGCTGG + Intergenic
1060661473 9:125407725-125407747 GGTGGTGCTGGGAGACGAGCAGG + Intergenic
1060779256 9:126399611-126399633 GCTGCTGCTGGGACAGAGGTTGG + Intronic
1061062848 9:128259229-128259251 GCTGCAGCTGGTCCACGAGCTGG + Exonic
1061675683 9:132214309-132214331 GCTGCTGCGGGGGCACCATCTGG - Intronic
1061837768 9:133340830-133340852 GCTGCTGCTCGGACAACTGCTGG + Exonic
1061890461 9:133616615-133616637 GCTGCTGCTGGGACAGGCACAGG - Intergenic
1062048012 9:134433287-134433309 GCTAGAGCTGGGGCACCAGCAGG + Intronic
1062262694 9:135670800-135670822 GATGCTGCTTGACCACCAGCTGG + Intergenic
1062285790 9:135771944-135771966 GTGGCTGCTGGGGCACCAGGTGG + Intronic
1062450160 9:136611832-136611854 CCAGCTGCTGGGTCACCTGCCGG + Intergenic
1062462483 9:136667718-136667740 GCAGCTGCTGGCCCACCTGCTGG + Intronic
1062748255 9:138231021-138231043 GCTGCTTCTGGCACTTCAGCGGG - Intergenic
1203746597 Un_GL000218v1:43648-43670 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1203563512 Un_KI270744v1:75832-75854 GTTGCTTCTGGGCCAGCAGCAGG - Intergenic
1185543779 X:925723-925745 GCTGCTGCTTTGAGTCCAGCTGG + Intergenic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190781155 X:53596931-53596953 GTTGCTGCAGCTACACCAGCAGG + Intronic
1191753608 X:64570397-64570419 GCTGCTGCCAGGCCACCAGAGGG + Intergenic
1192561945 X:72132940-72132962 ACTGCTGATGGGCCACCAACAGG + Intergenic
1192728437 X:73777728-73777750 GCTGTTGCTGGGTGCCCAGCAGG + Intergenic
1193049079 X:77082288-77082310 GCAGTTGCTGGGTCACCATCAGG + Intergenic
1193517012 X:82478392-82478414 ACTCCTGGTGGGACCCCAGCTGG + Intergenic
1195341241 X:103908079-103908101 TCAGCTGCTGGGACAGCAGTTGG - Intergenic
1195539435 X:106045830-106045852 CCTTCTTCTGGGACTCCAGCTGG + Intergenic
1196473677 X:116058315-116058337 GCTGCTGCTGCCACTGCAGCTGG - Intergenic
1199494887 X:148441805-148441827 GCTGCTGATGGGACAGCACAGGG + Intergenic
1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG + Intergenic
1199691431 X:150311812-150311834 GCAGCTGCTGGGCGACCAGGTGG - Intergenic
1199975599 X:152893396-152893418 GCTGCTTCTGGGGCAGCAGCAGG + Intergenic
1200210807 X:154345876-154345898 GCTGAGGCTAGGACAGCAGCAGG - Intergenic
1200220045 X:154386216-154386238 GCTGAGGCTAGGACAGCAGCAGG + Intergenic
1200742424 Y:6868387-6868409 GGTGCTGTTGGGACACCACGGGG + Exonic
1201159924 Y:11158662-11158684 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1201904517 Y:19076145-19076167 GCAGCTGCCGGGATCCCAGCCGG - Intergenic