ID: 1077434620

View in Genome Browser
Species Human (GRCh38)
Location 11:2532839-2532861
Sequence CAGCAGAGGGAGGCTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 866
Summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 789}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077434608_1077434620 28 Left 1077434608 11:2532788-2532810 CCCGAGGCTTCAGGCCTGGAGGA 0: 1
1: 0
2: 0
3: 40
4: 284
Right 1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG 0: 1
1: 1
2: 3
3: 72
4: 789
1077434612_1077434620 14 Left 1077434612 11:2532802-2532824 CCTGGAGGAGTGAGGACGGCTGT 0: 1
1: 0
2: 1
3: 19
4: 170
Right 1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG 0: 1
1: 1
2: 3
3: 72
4: 789
1077434609_1077434620 27 Left 1077434609 11:2532789-2532811 CCGAGGCTTCAGGCCTGGAGGAG 0: 1
1: 0
2: 3
3: 50
4: 354
Right 1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG 0: 1
1: 1
2: 3
3: 72
4: 789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077434620 Original CRISPR CAGCAGAGGGAGGCTGTGCA GGG Intronic
900331663 1:2137842-2137864 CAGCAGAGCGGGGCTGTGGTGGG - Intronic
900559734 1:3297992-3298014 CCGCAGGGGAAGGCTCTGCAGGG + Intronic
900822799 1:4902122-4902144 CAGCAGAGGGACGCTGGGCCTGG + Intergenic
900825105 1:4920110-4920132 CAGCAAAGAGAGTTTGTGCAGGG + Intergenic
900893763 1:5468685-5468707 CAGCAGAGGCTGGATGAGCAAGG + Intergenic
901028453 1:6291872-6291894 AAACAGAGCGAGGCTGTGCGGGG - Intronic
901212399 1:7534050-7534072 CAGGAGAGCCAGGCTGGGCAAGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901354641 1:8634149-8634171 CAGCAGCGTGAGGATGGGCATGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903208700 1:21802718-21802740 CAGCAAAGGCAGGCTGTCCCCGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904264753 1:29311784-29311806 CTGCAGAGGGTGCCTGAGCAGGG + Intronic
904286936 1:29458979-29459001 CAGCAGAGGGACCCTGGGAAGGG + Intergenic
904302198 1:29561533-29561555 CTGCATAGGGAGGTCGTGCAAGG + Intergenic
904455065 1:30642604-30642626 CTGCATAGGGAGGTCGTGCAAGG - Intergenic
904501324 1:30914462-30914484 AAACAGAGGGAGCCTGGGCAGGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905542092 1:38767933-38767955 AGGCAGAGGGAAGCTGGGCACGG - Intergenic
905776654 1:40672046-40672068 AAGAAAAGGGAGGCTGGGCACGG - Intergenic
906148154 1:43572116-43572138 CAGCAGCCAGAGGCTGAGCAGGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906655102 1:47542533-47542555 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906992558 1:50754847-50754869 AAGCAGAGAGAGGTTGTGTAGGG + Intronic
907275860 1:53316296-53316318 CAGTAGAGGCAGGCTGGGAATGG + Intronic
907786375 1:57617103-57617125 CAGGAAAGGGAGTCTGGGCAGGG - Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908153348 1:61327406-61327428 CAGGAGGGGGCGGCTGTGTAGGG - Intronic
908261860 1:62345276-62345298 GAGCAGATGGAGGCTGGGCGCGG + Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908474091 1:64471189-64471211 CAGAAGAGGGGGGCTGTGCAGGG - Intronic
908603794 1:65771169-65771191 CAGCAGAGGGAGGCTTAGTCTGG - Intergenic
908876948 1:68687767-68687789 AGGCAGAGGGAGGGAGTGCAGGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910499992 1:87879325-87879347 AAGCAGAGGGAGGGTGTGTGGGG + Intergenic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910642748 1:89481097-89481119 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
910758425 1:90713865-90713887 CAGCAGAGGCAGCCAGTACAGGG + Intronic
911040125 1:93584672-93584694 CAGCAGGAGGAGGCTGTGTGGGG - Intronic
911611849 1:99967018-99967040 GAGAAGAGGCAGGCTGGGCACGG + Intergenic
912004316 1:104878353-104878375 CAGCAGAGGGACCCTGAGCCTGG - Intergenic
912451867 1:109772393-109772415 CAGCAGAGGAAGTCTTTACAGGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912960111 1:114188569-114188591 CAGCAGGGGCAGGCTGGGCCAGG + Intergenic
913320240 1:117582820-117582842 CAGCAGAGTGAGGCAGCCCAGGG + Intergenic
913963594 1:143357036-143357058 AAGGAAAGGGAGGCTGGGCATGG - Intergenic
914057954 1:144182625-144182647 AAGGAAAGGGAGGCTGGGCATGG - Intergenic
914121192 1:144783740-144783762 AAGGAAAGGGAGGCTGGGCATGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915356148 1:155256036-155256058 CAGCAGAGGGAAGCTGGGTTGGG + Exonic
915529721 1:156496405-156496427 GGGCAGAGGCAGGCTGTGCCAGG + Intronic
915937371 1:160097399-160097421 CAGCAGGGGAAGGCTTTGCTTGG + Intronic
916208629 1:162339851-162339873 CAGTAGAGGCAGCCTGTGCCTGG - Intronic
916414047 1:164576441-164576463 CGGGAGAGGGAGCCGGTGCAAGG - Intronic
916674481 1:167054303-167054325 CAGCAGAGGGCGGCGGAGGAAGG - Exonic
916910709 1:169342271-169342293 CAGGAGAGAGAGAATGTGCAGGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917336128 1:173926092-173926114 CAGCAAAGGGAGGCTGGGTGCGG + Intergenic
917894950 1:179478542-179478564 CAGCAGAGGGACCCTGGGCCTGG + Intronic
918002432 1:180510078-180510100 CAGCAGGGGGAGGGTGGGAATGG - Intergenic
918503568 1:185226443-185226465 TACCAGAGCGAGGCTGGGCATGG + Intronic
918670761 1:187212514-187212536 GAGCAGAGAGATGCTGTGTAGGG + Intergenic
920044251 1:203123380-203123402 CAGCAGAGGGAGGCAGTGTTAGG - Intronic
920302587 1:204997886-204997908 CAGCAGGGAGTGGCTGTGCCAGG + Intronic
920365884 1:205448222-205448244 CACCAGAAGGAGGCTTTGCTTGG - Intronic
920962789 1:210679236-210679258 CAACAGAGGGAGGCTGTCTGGGG + Exonic
922070435 1:222187370-222187392 GAGAAGAGAGAGGTTGTGCAGGG - Intergenic
922115402 1:222608196-222608218 CAGCAGAGGGACCCTGGGCCAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922752291 1:228075956-228075978 GAGCTGGAGGAGGCTGTGCAGGG - Exonic
922791596 1:228314160-228314182 CAGCAGGGGTAGGCTCAGCAGGG - Intronic
923041989 1:230326125-230326147 AAGCAAAAGGAGGCTGCGCACGG + Intronic
923123111 1:231012501-231012523 AAGCAGAGGGAGGCTGGGTGTGG - Intergenic
923201550 1:231717465-231717487 CAGCAGAGGGAGGCGGGCCTTGG - Intronic
923342742 1:233021661-233021683 TAGGAGAGGCAGGCAGTGCATGG - Intronic
923390214 1:233507475-233507497 CAGCAGAGGAATTCTGTGGAAGG - Intergenic
924143288 1:241048245-241048267 CACCAGGGGGAGGCTGAGCCTGG - Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062895339 10:1098613-1098635 TAGCACAGAGAGGCTGGGCACGG - Intronic
1062958191 10:1553975-1553997 CGGCTGGTGGAGGCTGTGCAGGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063243603 10:4195490-4195512 AAGCAGAGTGAGGCTGGGCGCGG + Intergenic
1063883173 10:10551634-10551656 GCGCAGAGTGGGGCTGTGCAGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064288974 10:14015949-14015971 CAGAAGAGGGAGGCGGTCAATGG - Intronic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1065539680 10:26750245-26750267 CAGCACAGGGAGGCTGAGATGGG + Intronic
1067189343 10:44056647-44056669 GAGCAGGGGGTGGCTGTGAAAGG + Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069884588 10:71615746-71615768 CAGCCCCGGGAGGCAGTGCAGGG - Intronic
1070353500 10:75616146-75616168 CAGGCAAGGCAGGCTGTGCAGGG + Intronic
1070561797 10:77573396-77573418 CAGCAGGGGCAGGCTGGGCAGGG + Intronic
1070797935 10:79227950-79227972 TGGCAGAGGGAGGCTGGACAGGG + Intronic
1071258374 10:83895769-83895791 CAGCAGAGTGAGGGTTTGCCAGG - Intergenic
1071450908 10:85790754-85790776 CAGCAGTGGCTGACTGTGCAGGG + Intronic
1071480145 10:86058969-86058991 CAGCAGATGGAGTTTGAGCAGGG + Intronic
1071491859 10:86141537-86141559 CAGCAGTGGGCAGCTGTGCTGGG + Intronic
1071546576 10:86534567-86534589 CAGCCGTGGGATGCTGTGAAGGG - Intergenic
1072418704 10:95271144-95271166 AATCAGAGGGGGGCTGGGCACGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073671728 10:105598336-105598358 CAGTAGAGGCAGTCTCTGCAAGG - Intergenic
1073817598 10:107224522-107224544 CAGCAGAGGGACCCTGGGCTGGG + Intergenic
1074042970 10:109810419-109810441 CAGCATTGGGAGGCTGAGGAGGG + Intergenic
1074158545 10:110818584-110818606 CAGCAAAGGGAAGCTCTGAAAGG + Intronic
1074578424 10:114693139-114693161 CAGAAGAAGGAGGCTGTGTTGGG + Intergenic
1074610590 10:115017386-115017408 GAGCTGAGGGGGGCTGGGCATGG + Intergenic
1074640211 10:115370922-115370944 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1074997830 10:118773111-118773133 AAGAAGAGAGAGGCTGGGCATGG - Intergenic
1075266138 10:121000842-121000864 CAGCAGCAGAAGGCAGTGCAGGG - Intergenic
1075354407 10:121757619-121757641 CAGCAAAGAGAGCTTGTGCAGGG + Intronic
1075550317 10:123388102-123388124 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
1075634337 10:124020042-124020064 GAGAAGATGGAGGCTGGGCAGGG - Intronic
1075688285 10:124378903-124378925 CAGCCGAGGGAGTCTGAGCTGGG + Intergenic
1075708493 10:124517647-124517669 AAGGAGAGGGAGGCTGTCCAAGG - Intronic
1076504750 10:130964258-130964280 CTGCAGAGTGAGACTGGGCAAGG + Intergenic
1076725477 10:132410956-132410978 CTGCTGACGGAGGCTGTGCTGGG - Intronic
1076788605 10:132764542-132764564 CAGGGGTGGGAGGGTGTGCATGG + Intronic
1076872892 10:133202256-133202278 CTGCAGAGCGAGGCTGCCCAAGG - Intronic
1077433314 11:2526616-2526638 GAGCCGAGGCAGGCTGTGCTGGG + Intronic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1077593790 11:3514007-3514029 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078529912 11:12129398-12129420 CAGGAGACTGAGGCTCTGCAGGG + Intronic
1078934912 11:15941712-15941734 CAGCACAGGGAGCCTGGGCAAGG + Intergenic
1079134108 11:17766529-17766551 CAGCAGAGGGACCCTCTGCCTGG - Intronic
1080650553 11:34219429-34219451 CAGCTGTGGGAGGCTGAGGAGGG + Intronic
1080706575 11:34701251-34701273 CAGCAGAGGAGGCCTGGGCAGGG + Intergenic
1080883123 11:36341154-36341176 CAGCACAGGGAGGCTCAGGAAGG - Intronic
1080973354 11:37304302-37304324 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
1081430234 11:42968747-42968769 CAGCAGCAGGATGCTGTGCCTGG + Intergenic
1081716176 11:45252172-45252194 CGGCAGAGAGAGTCTTTGCATGG + Intronic
1082806026 11:57451121-57451143 CAGCAGAGTGAGGCTGGGAAAGG + Intergenic
1083550970 11:63590029-63590051 CTGCTGACGGAGGCTGGGCATGG - Intronic
1083693460 11:64426289-64426311 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1083778633 11:64906781-64906803 AAGCGGCTGGAGGCTGTGCACGG - Exonic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1084004114 11:66314271-66314293 CAGCAGTGGGAGGTTTGGCATGG - Intergenic
1084249602 11:67886735-67886757 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1084334054 11:68446655-68446677 GAGCAGAGGGAGGCAGGGCTGGG - Intronic
1084957542 11:72699287-72699309 CAGCAAACGGAGGCTGCACAAGG - Intronic
1085205836 11:74731385-74731407 CCGCGGAGGGAGGCTGAGCGCGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085528071 11:77175535-77175557 CGGGAGAGGGAGGCAGTGCTGGG + Intronic
1085651497 11:78272835-78272857 CAGCAGAGGGACCCTGGGCCCGG - Intronic
1085740747 11:79076446-79076468 CAGAAGAGAGAGCTTGTGCAGGG + Intronic
1086287941 11:85271109-85271131 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088259012 11:107927685-107927707 CAGCACTGGGAGGCTGAGCCTGG + Intronic
1088290118 11:108227032-108227054 CAACAGAGGAAGGCTCTGCGGGG - Intronic
1088412783 11:109553781-109553803 CAGGAGAGAGAGGGAGTGCAGGG + Intergenic
1088443896 11:109902163-109902185 CAGCACAGGGATCCTGGGCATGG + Intergenic
1089597630 11:119591279-119591301 CAGAAGAGGGAGCCTCTGCCAGG + Intergenic
1089770962 11:120802612-120802634 CAGCAGGGGGAGGCTGGAGAAGG + Intronic
1089796594 11:120986050-120986072 CAGCAACGGGAAGCTGTGCGGGG + Exonic
1090570359 11:128038226-128038248 CAGCAGAGGGGCTCTGTGGAAGG + Intergenic
1090877843 11:130806815-130806837 CAGGTGAGGGAAGCTGTGCAGGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091361863 11:134984184-134984206 GAGCAGATTGAGGCTCTGCAGGG - Intergenic
1091404264 12:199134-199156 CAGCAGGGGGAGGGTGGGGAGGG + Intronic
1091420813 12:338508-338530 CAGCAAAGGGAAACAGTGCATGG - Intronic
1091563522 12:1631353-1631375 CAGCAGCAGCAGGCTGGGCATGG - Exonic
1091962998 12:4714563-4714585 CAGCAAAGGGAGCATGTGTAAGG - Intronic
1092419889 12:8322134-8322156 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092504975 12:9089448-9089470 AATCAAAGGGAGGCTGTGCATGG + Intronic
1092510362 12:9149061-9149083 CAGCAGAGTGAGCTTATGCAGGG + Intronic
1092510868 12:9154759-9154781 CAGCAGAGGGAGCCTGGGTTTGG + Exonic
1092662702 12:10755719-10755741 CAGCAGAGGGACCCTGGGCCCGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092915687 12:13186978-13187000 CAGCATAGGGAGGAAGTGGAGGG + Intergenic
1092967031 12:13654093-13654115 AAGCAGAGGAATGCTGTGCCAGG + Intronic
1093186075 12:16021245-16021267 CAGCATACTGAGGCTGTGCAAGG - Intronic
1093658069 12:21720636-21720658 AAGCAAATGGAGGCTGGGCACGG + Intronic
1093755020 12:22842496-22842518 TAGCAGAAAGAGGCTGGGCATGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094762550 12:33551225-33551247 CAGCTGAGGGACCCTGTGCCTGG - Intergenic
1095382778 12:41615416-41615438 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
1096514820 12:52149992-52150014 CGGGAGAGGGCAGCTGTGCATGG - Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098630888 12:72720562-72720584 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1098848249 12:75564437-75564459 CAGCAGAGTGGGCCTGGGCACGG - Intergenic
1099231436 12:80030173-80030195 CAGAACAAGGAGGCTGGGCAGGG - Intergenic
1099528874 12:83750389-83750411 CAGCAGAGGTAGGATGTGATAGG + Intergenic
1099663520 12:85596750-85596772 CAGCACAGGGATGCTGGGCTTGG + Intergenic
1101708547 12:107243441-107243463 CAGCAGGCGTAGGCTGTGAAGGG + Intergenic
1102122087 12:110449843-110449865 CAGCAGAGGGAGCCTGACCCCGG + Intronic
1102321126 12:111935385-111935407 CAGCAGATGGCGGCCGGGCATGG - Intronic
1102454828 12:113065020-113065042 TGGCAGAGGGAGGCTGTGATGGG + Intronic
1102862148 12:116345218-116345240 GAGAAGAGGGAGGCATTGCAGGG - Intergenic
1103232698 12:119345211-119345233 CAGAAAAAGGAGGCTGGGCACGG + Intronic
1103567970 12:121826622-121826644 CAGCAGAGGGAGGTTGTGAGAGG + Intronic
1103722397 12:122981804-122981826 CAGCAGGTGGAGGCTCTGCCGGG + Exonic
1103767363 12:123290181-123290203 CGCCAGAGGGAGACTGAGCAAGG + Exonic
1103780802 12:123397637-123397659 CAGCAGTGGGAGGCTGTGCTAGG + Intronic
1103844460 12:123891836-123891858 CAGCAGAGGGAAAAAGTGCATGG + Intronic
1104323634 12:127774955-127774977 CAGCCGATGGAGGCTGTTCCTGG - Intergenic
1104678839 12:130734794-130734816 CAGGAAGGGGAGGCTTTGCAGGG - Intergenic
1104792255 12:131490990-131491012 CATCAGTGGGAGGCTGTGATTGG - Intergenic
1104975957 12:132552086-132552108 CAGAACATGGAGGCTGTGGATGG - Intronic
1105393372 13:20003937-20003959 CAGCAGAAGAGGGCTGGGCATGG - Intronic
1105609469 13:21955323-21955345 CAGCAGAGGGACCCTGGGCCCGG + Intergenic
1105633458 13:22194758-22194780 CAGGAGAGGGACCCTGTGGAAGG - Intergenic
1106459343 13:29955299-29955321 GAGCAGAGGGAGGTTTTGCTGGG - Intergenic
1106569619 13:30915377-30915399 CAGTGGACGGAGGCAGTGCAGGG - Intronic
1106760468 13:32862592-32862614 AAGAAAAGGGAGGCTGGGCATGG + Intergenic
1106917317 13:34529558-34529580 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1107383980 13:39888494-39888516 GAGCAGAGGGTGGCTGGGCATGG - Intergenic
1107481620 13:40789988-40790010 CAGGAGTGGGCGGCTGGGCAGGG + Intronic
1107788633 13:43978619-43978641 CAGGAAGGGGAGGCTGGGCATGG + Intergenic
1108257904 13:48628352-48628374 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1108738998 13:53315152-53315174 CAGAAGAGGGAGGGTGGGAAGGG + Intergenic
1109337135 13:61007899-61007921 CAGCAGAGGGACCCTGGGCTTGG - Intergenic
1109879195 13:68449742-68449764 CAGCAAAGAGAGATTGTGCACGG - Intergenic
1110395887 13:75029207-75029229 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1111567895 13:90040789-90040811 CAGGCAAGGGAGACTGTGCAAGG + Intergenic
1111922319 13:94425244-94425266 CTGCTGAGGGAGGCTGTGTGAGG + Intergenic
1112020773 13:95369380-95369402 CAGGAGAGGGAGAGTGTGCAGGG + Intergenic
1113229275 13:108194879-108194901 GGGCAGAGGGAGGCTCAGCACGG + Intergenic
1113235344 13:108266946-108266968 CAGAAGAGGGAGAATGTCCATGG + Intronic
1113281726 13:108795940-108795962 CAGCACAGTGGGGCTGTGAAGGG + Intronic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113478092 13:110599627-110599649 AAGCAGAGGGAGGCTGAGAGGGG + Intergenic
1113734156 13:112665158-112665180 CAGCAGAGGCAGGCTTGGCGAGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113755978 13:112811274-112811296 CGGCAGAGGGAGGGTGTGTGTGG - Intronic
1113878525 13:113609279-113609301 CAGGTGAGGTAGGATGTGCAGGG - Intronic
1113923801 13:113929338-113929360 GAGCAGAGCGAGGCTCTGGATGG - Intergenic
1113958025 13:114109738-114109760 CAGCAGGAGGAGGCTGCTCACGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114484008 14:23052486-23052508 CAGCACAGTGAGGTTGTGCCAGG + Exonic
1115417936 14:33158596-33158618 CTGCAGAGAGAGGGTGTTCATGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117147892 14:52853732-52853754 GAGAAGATGGCGGCTGTGCAGGG + Intergenic
1117473138 14:56066973-56066995 CAGAAGAGAGAGGATATGCAAGG + Intergenic
1117534442 14:56690246-56690268 CAGCAAGTGGAGGCTGAGCAGGG + Intronic
1117551647 14:56843108-56843130 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1117579375 14:57136878-57136900 CAGCAGCAGGATGCTGTGCTGGG - Intergenic
1118369576 14:65125892-65125914 CAGATGAGGGAAGCTGTGCAGGG + Intergenic
1118533213 14:66730126-66730148 ATGCATAGGGAGGCTGTGCAAGG + Intronic
1119480242 14:74954277-74954299 CAGCCAAGGCGGGCTGTGCAGGG - Intronic
1119844526 14:77818570-77818592 AAGCAGAGAGAGGCTGAGCATGG - Intronic
1119914492 14:78384643-78384665 CAGAATAGGAAGGCTGAGCAGGG - Intronic
1120974643 14:90237910-90237932 GAGCAAAGGCAGGCTGGGCACGG + Intergenic
1121458147 14:94052359-94052381 CAGCAGAGGCAGTTTGTGCAGGG - Intronic
1121670616 14:95708182-95708204 ATGTAGAGGGAGGCTGGGCACGG + Intergenic
1121736211 14:96219918-96219940 CAGGAGAGGGAGGTGGTCCAGGG + Intronic
1121743980 14:96273723-96273745 CAGGAGAGGGAGGCTGCTCTGGG - Intergenic
1122213469 14:100188253-100188275 CTGCAGAATGAGGCTGGGCACGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122875793 14:104664305-104664327 CAGCAGGTGGAAGCTGAGCATGG - Intergenic
1123037926 14:105478864-105478886 CAGCAGAGGTGGGCTGGGCGCGG + Exonic
1123164771 14:106315666-106315688 CAGCAGGGAGAGGGTGAGCAGGG - Intergenic
1123402899 15:20004317-20004339 CAGGTGAGGGAGACTGTCCAGGG + Intergenic
1123512238 15:21010971-21010993 CAGGTGAGGGAGACTGTCCAGGG + Intergenic
1123986584 15:25651700-25651722 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1124375842 15:29128204-29128226 CAGCAGAGGGAGAAAGGGCACGG - Intronic
1125324894 15:38526529-38526551 AAACAGAGGGGGGCTGTGCTAGG - Intronic
1125578735 15:40771303-40771325 CGGGAAAGGGAGGCTGTGCCGGG + Exonic
1125637133 15:41198398-41198420 CCCCAAAGGGAGGCTGGGCAAGG + Intronic
1126163580 15:45635145-45635167 CAGCGGAGGGAGACTGGGCGGGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126671707 15:51121260-51121282 TCACAGAGGGAGGCAGTGCAGGG + Intergenic
1126676340 15:51161989-51162011 CAGCAGGGAGAGGCTGGCCAGGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127842898 15:62845968-62845990 CAGGAGAGAGATTCTGTGCAGGG + Intergenic
1128240247 15:66096600-66096622 CAGCAGAGGGGTGCTGTGACAGG + Intronic
1128311270 15:66632934-66632956 CAGCATAGGGAGGCTTTTCCCGG - Intronic
1128898695 15:71399074-71399096 CAGCAGTGGGAAGCTCTGCTTGG + Intronic
1129155631 15:73715641-73715663 CAGCAGGAGGAGCCTGTGCTGGG + Intergenic
1129165268 15:73773706-73773728 CAGCAGAGCAAGGCTCTGCAGGG - Intergenic
1129339152 15:74873486-74873508 CAGCAGAGCGAAGATGTGGACGG - Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1129559509 15:76551993-76552015 CAGGAGAGGGAAGCTGGGCATGG + Intronic
1129604313 15:77017390-77017412 CAGCAGAGGGTAGCTGTCCCTGG + Intronic
1130310741 15:82751853-82751875 CAGGAGAGGGAGGCTATTCATGG - Intergenic
1130552076 15:84895636-84895658 CAGGAGAGGGAGGTTGTGGAGGG + Intronic
1130876321 15:88017721-88017743 CAACACAGGGAGCCTGTGCCTGG - Intronic
1131145142 15:90006089-90006111 CAGCAGAGGGAGGCTGGTCAGGG + Intronic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1131760975 15:95622343-95622365 CAGTGGAGGCAGGCTGGGCATGG + Intergenic
1132011696 15:98282028-98282050 CAACAGAGAGAGCTTGTGCAGGG - Intergenic
1132123165 15:99195783-99195805 CTGGTGAGGGAGGCTATGCATGG + Intronic
1132201065 15:99955143-99955165 CAGAAGGGACAGGCTGTGCAAGG - Intergenic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1132720670 16:1314127-1314149 CAGCCGAGGGAGCCTGTCCGCGG - Intronic
1132777603 16:1604440-1604462 AGGCCGAGGAAGGCTGTGCAAGG + Intronic
1132827039 16:1910273-1910295 CAGCCCTGGGAGGCTGGGCAGGG - Intergenic
1133026616 16:2991435-2991457 CAGGTGAGGGTGGCTGGGCAGGG + Intergenic
1133065888 16:3206867-3206889 CAGCAGAGTGAGGCTGGGTGTGG + Intergenic
1133161612 16:3915737-3915759 CAGCAGAGAGGGGCTGGGGAAGG - Intergenic
1133175357 16:4010310-4010332 AAGCTGAGAGAGGCTGAGCAGGG + Intronic
1133320968 16:4913691-4913713 CAACAGAAGGAGGCTGGGCATGG - Intronic
1133738700 16:8635119-8635141 AAGCAGCGTGAGGCTCTGCAGGG - Intronic
1133765174 16:8832806-8832828 CTGAAGAGGGAGGATGGGCAGGG - Intronic
1134145094 16:11754422-11754444 AAGCAGAGAGACGCTGGGCAAGG + Intronic
1134242065 16:12513438-12513460 GAGCAGAGGAAGGCAGCGCAGGG - Intronic
1135629387 16:24023863-24023885 CAGCAGAGCCTGGCTGTGCTGGG - Intronic
1135651131 16:24207855-24207877 CAGAGGAGGCAGCCTGTGCAAGG + Intronic
1136555653 16:31006361-31006383 AAGCAGAGGGAGGATGAGAAAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137580850 16:49632613-49632635 CAGCTGTGCGCGGCTGTGCAGGG - Intronic
1137655489 16:50154450-50154472 CAGGAGACGGAGGGTGTGGACGG - Intronic
1137676792 16:50307705-50307727 CATAATAGGGAGGCTGTGCGTGG + Intronic
1138166007 16:54802339-54802361 CAGTAGATGGAGGGTGTGGATGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138379340 16:56589557-56589579 CAGCAGCTGGAGGCGGTGAACGG - Exonic
1138895408 16:61198574-61198596 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139649894 16:68356947-68356969 CAGCAGAGAGAAGCTGCTCAGGG - Intronic
1139671204 16:68493282-68493304 CAGCGGAGGGAGGGTGTCCTGGG + Intergenic
1139677883 16:68537803-68537825 TAGCACAGGGAGGCTGAGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140049593 16:71468348-71468370 AGCCAGAGGGAGGCTGGGCATGG - Intronic
1140058943 16:71550516-71550538 CATCAGAGGGACTATGTGCATGG + Intronic
1140540805 16:75754858-75754880 CATCAGAGTAAGGCTGTTCAGGG - Intronic
1140855928 16:78977702-78977724 CAGCAGGGGCAGGGGGTGCAGGG + Intronic
1140876040 16:79153363-79153385 CAGCAGAGGAGGGCTCTGCTTGG - Intronic
1141623922 16:85251569-85251591 CAGCAGAGTGACCCTGGGCAGGG + Intergenic
1141682198 16:85551257-85551279 CACCAGAGGGATTCTGTCCAAGG - Intergenic
1141793715 16:86254280-86254302 CAGCACCGGGAGGCTGAGGAGGG - Intergenic
1141852813 16:86658928-86658950 CAGCAGGTGGAGGCTGTGGCAGG + Intergenic
1142174016 16:88636719-88636741 AAGCAGAGGGTGGGTGGGCAGGG + Intergenic
1142189573 16:88711743-88711765 CACCAGAGGGAGGATCCGCAGGG - Intronic
1142217173 16:88835551-88835573 CAGCAGAGGAGGGCTGTGGTGGG - Intronic
1142273690 16:89104595-89104617 AAGCAGAGGGAAGGTGGGCAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144299879 17:13913233-13913255 CAAGAGAGGGAGCATGTGCAGGG - Intergenic
1144652890 17:17018312-17018334 GAGCCGAGGCAGGCTGTGCCAGG - Intergenic
1144722759 17:17483646-17483668 GAGGAAAGGGAGGCTGGGCACGG + Intronic
1144836014 17:18157093-18157115 CAGGAGGGGGAGGCTGGCCAAGG + Intronic
1145005815 17:19337147-19337169 CAACAGAGGGAGGGAGTGCGTGG + Intergenic
1145981243 17:29012971-29012993 AAACTGAGGGAGGCTGGGCACGG + Intronic
1146173746 17:30651692-30651714 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146347202 17:32067713-32067735 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146455270 17:33004711-33004733 CAGCTGAAGGAGGCTTTGCGGGG + Intergenic
1146656071 17:34636016-34636038 CCGCTGACGGAGGCTGTGCTCGG + Exonic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147843448 17:43388740-43388762 GGGCAGAGGGAGGCGGCGCATGG + Intergenic
1147911342 17:43858034-43858056 CAGCAGAGGGAGGAGGGGCCAGG - Intronic
1148027046 17:44595566-44595588 CAGCAGAGGGAGGTGGTGCCTGG + Intergenic
1148245393 17:46026772-46026794 CAGCAGATGGAGTTTGTGCAAGG - Exonic
1148272102 17:46269418-46269440 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1148464777 17:47858226-47858248 TAGGGGAGGGAGGCTGGGCAAGG - Intergenic
1148593443 17:48833836-48833858 GAGCAGAAGTAGGCTGGGCACGG + Intronic
1148731572 17:49839946-49839968 CAGCAGAGGTAGGCTGTTTTGGG + Intronic
1148789511 17:50165653-50165675 GAGCGGAGTGAGGCTGAGCAGGG + Intronic
1149101358 17:52910192-52910214 CAAGAGAGCGAGCCTGTGCAGGG - Intergenic
1149204466 17:54227890-54227912 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1150322818 17:64230626-64230648 CAGCAGAGGGAGGAGCTCCACGG + Intronic
1150475400 17:65471010-65471032 CAGCTGTGGGAGGCTCTGCCTGG - Intergenic
1151395641 17:73820938-73820960 CAGTGGAGGAAGGCTGTCCAAGG - Intergenic
1151444434 17:74153930-74153952 CAGAAGATGGAGGCTGTGTTGGG - Intergenic
1151558183 17:74857601-74857623 GAGCAGACAGAGGCCGTGCAAGG - Intronic
1151719260 17:75846290-75846312 CAGCAGAGGGAATGTGAGCAGGG + Exonic
1151996177 17:77610687-77610709 CACCAGAGGGTGGCTGAGCCTGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152111607 17:78360182-78360204 CAGCAGAGAAAGGCTGAGCGCGG + Intergenic
1152153816 17:78619614-78619636 CAGCAGTGCAAGGGTGTGCAGGG + Intergenic
1152324555 17:79627969-79627991 CAGCAGAGAGAGGCAGCCCAGGG - Intergenic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152394647 17:80025214-80025236 GAGCAGAGGGTGGCTGTGTGTGG - Intronic
1152793497 17:82294495-82294517 CAGCAAAAGGAGGCTGGGCATGG - Intergenic
1152930953 17:83109626-83109648 CTGCAAAGGGAGGCCCTGCATGG - Intergenic
1153018804 18:608091-608113 AAGCAGAGTGAGGCTGTGCTGGG + Intronic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1154133699 18:11758107-11758129 CAGAAGAAAGAGGCTGTGTATGG + Intronic
1155110508 18:22709680-22709702 CAGGGGTGGGAGGCTGTGAAAGG - Intergenic
1156782382 18:40866370-40866392 CAGATGAGGGAGCCTGTCCAGGG + Intergenic
1156875108 18:42000743-42000765 AAGCAAAGGGAGCTTGTGCAAGG + Intronic
1157811906 18:50703302-50703324 TAGGAAAGGGAGGCTGGGCAAGG - Intronic
1157830150 18:50850167-50850189 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1160050865 18:75431851-75431873 GACCAGAGGGAGGCTGTATAAGG - Intergenic
1160161135 18:76471817-76471839 CAGCAGATGGAAGCTGTTCTGGG + Intronic
1160754031 19:748408-748430 CATTAAAGGGAGGCTGAGCAGGG + Intergenic
1160769495 19:823948-823970 CAGGAGTGGGAGAGTGTGCAGGG + Intergenic
1160906529 19:1454023-1454045 CAGCAGAGGGAGGCAGGGTCTGG + Intronic
1161274314 19:3407033-3407055 GGGCAGAGGCGGGCTGTGCAGGG + Intronic
1161358677 19:3834052-3834074 CAGGAGAGGGCGGGTTTGCAGGG + Intronic
1161473959 19:4474204-4474226 CAGCAGGGAGGGGCTGTGGAGGG + Intronic
1161740787 19:6019919-6019941 CAGCAGAGAAAGACTGTCCAAGG + Intronic
1162404505 19:10465508-10465530 GAGCAGGGGGAGGCTGGGCGCGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162925585 19:13929390-13929412 CAGCACACTGAGGCTATGCAGGG - Exonic
1162988671 19:14288348-14288370 CGGGAGAGGCAGGCTGAGCAGGG + Intergenic
1163672609 19:18637463-18637485 CAGCAGAGAGGGCCTGAGCAGGG + Intronic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1163928157 19:20364702-20364724 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164219909 19:23184025-23184047 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1164948812 19:32318836-32318858 CAGCAGAAGCAGTCTGTCCATGG + Intergenic
1165002524 19:32776683-32776705 CAGGAGAGAGAGGCTGTGGCAGG + Intronic
1165139041 19:33688243-33688265 CAACAGGGCCAGGCTGTGCATGG - Intronic
1165541814 19:36498109-36498131 CAGCAGCGGGAGGGGGTGCAGGG + Intergenic
1165911919 19:39234437-39234459 GTCCAGAGGGAGGCTGTGCCTGG - Intergenic
1166119121 19:40674439-40674461 CAGGAGAGGCAGGCTCTTCAAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166309859 19:41956874-41956896 CACCAGATTGAGGCTGTGGACGG - Exonic
1166713550 19:44952164-44952186 GAGCATAGGAAGGCTCTGCAGGG + Intronic
1166765657 19:45251284-45251306 CGGCGGAGGGAGGCGGTGGAGGG - Exonic
1166853429 19:45770983-45771005 CAGCAGGTGGCGGCGGTGCATGG + Exonic
1167247622 19:48383242-48383264 CAGCAGCGGGAGGCAGAGGAAGG - Exonic
1167265514 19:48481019-48481041 TAGCAGATGGAAGCCGTGCAAGG + Intronic
1167534357 19:50040184-50040206 CAGCAAAGGGAGGAGGTACATGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168112542 19:54201627-54201649 CAGCAGAGGGATGGGGTGCAGGG + Intronic
1168151071 19:54449143-54449165 GGGCCGAGGGAGGCGGTGCAAGG + Exonic
1168312273 19:55466481-55466503 CAGAGGAGAGAGGCTGGGCACGG - Intergenic
1202697437 1_KI270712v1_random:135293-135315 AAGGAAAGGGAGGCTGGGCATGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926127695 2:10282066-10282088 CAGCAGAGGGAAGCTGGGGAGGG + Intergenic
926128487 2:10286114-10286136 CAGCAGAGGGAAGCTGAGGAGGG + Intergenic
927554245 2:24021442-24021464 CAGCAGAGGGGGTGTGTGGAAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
928551854 2:32380478-32380500 CAGCTGAGGGAGGCTGAGGCGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929092565 2:38233983-38234005 CAGTGGAGGGAGGCTGGGGAGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930241557 2:48940905-48940927 AAGTAGGGGGAGGGTGTGCAAGG - Intergenic
930310397 2:49732441-49732463 CAGCAGAAGGACCCTGGGCATGG + Intergenic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
931507607 2:62948650-62948672 CAGTAAGGGGAGGCTGTGCTTGG - Exonic
931841879 2:66159980-66160002 AAGCAGAGGGAGGCTGAGGCAGG + Intergenic
931843999 2:66183948-66183970 CAGCAAAGGAAGGTGGTGCATGG - Intergenic
931947375 2:67325087-67325109 CTGCTGAGAGAAGCTGTGCATGG + Intergenic
933065001 2:77781617-77781639 CAGCACAGGGACCCTGTGCCTGG - Intergenic
933268172 2:80204079-80204101 CAGCAGAGGGACCCTGGGCCCGG + Intronic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934278606 2:91592318-91592340 AAGGAAAGGGAGGCTGGGCATGG - Intergenic
935200973 2:100856350-100856372 CAGCATTGGGAGCCTGTGCTCGG - Intronic
935224189 2:101038808-101038830 CCACAAGGGGAGGCTGTGCAAGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936590420 2:113798381-113798403 AAGCAAAGTGAGGCTGGGCACGG - Intergenic
937046315 2:118853861-118853883 CAGCAGAGGTCGGCGCTGCAGGG + Intergenic
937291465 2:120784680-120784702 CAGCAGATGGAGGCTGTGTCTGG - Intronic
937881535 2:126870099-126870121 CATCACAGGAAGGCTGGGCAGGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938339044 2:130523240-130523262 CTGGAGGGGGAGGCAGTGCAGGG - Exonic
938350794 2:130597510-130597532 CTGGAGGGGGAGGCAGTGCAGGG + Exonic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940324406 2:152410440-152410462 CAGGAGAGGAAGTCTGTTCATGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941303190 2:163829038-163829060 CAGCAGAGGGATCCTGGGCTGGG + Intergenic
941319764 2:164040533-164040555 CAGCAAAGAGAGCTTGTGCAGGG + Intergenic
942419940 2:175797273-175797295 CAGCAGAGGGACGCTGGGCCCGG - Intergenic
942517807 2:176772143-176772165 CAAGAGAGGGAGCTTGTGCAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944369065 2:198960620-198960642 CAGGAGAGAGAGAGTGTGCAGGG - Intergenic
944894570 2:204150963-204150985 CAGCAGAGGGAAGCTGCGGCAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945618659 2:212106733-212106755 CAGCAGAGGGACCCTGGGCCAGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945934276 2:215887186-215887208 TTGCACAGGGAAGCTGTGCAAGG + Intergenic
946440786 2:219693426-219693448 CAAGAGAGAGAGTCTGTGCAGGG + Intergenic
946988801 2:225304021-225304043 CAGCAAAGAGAGCTTGTGCAGGG - Intergenic
946999857 2:225441617-225441639 CAGGAGAGAGAGAGTGTGCAGGG + Intronic
947776997 2:232720883-232720905 CAGCTGAGAGAGGCAGGGCACGG - Intronic
947796112 2:232894992-232895014 GAGCAGAGGGAGGCTCAGCAGGG + Intronic
948190218 2:236052443-236052465 CAGCAGAGGCCGGCTGTCCAGGG - Intronic
948197734 2:236107755-236107777 CAGGAGAGCGAGGATGTGCCCGG - Intronic
948643341 2:239388786-239388808 CAGCGGAGGGAGTGTGTGGAGGG + Intronic
948792799 2:240388059-240388081 CAGGCCAGGGAGGCTGTGGAAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170013248 20:11750770-11750792 GAGCAGAGGGAGGCTGAATAGGG - Intergenic
1171105029 20:22424861-22424883 CAGGAGAGAGAGGCTGTGAAGGG - Intergenic
1172139709 20:32713823-32713845 AAGAAGGGGGAGGCTGGGCATGG + Intronic
1172665887 20:36599610-36599632 CAGCAGAAAAAGGCTGAGCACGG + Intronic
1172733884 20:37111212-37111234 TAGGAGGGGGAGGCTGGGCATGG + Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1172969919 20:38865778-38865800 AAACAGAGGCAGGCTCTGCAGGG - Intronic
1173118409 20:40268322-40268344 CAGCAAAGGGCAGCTGAGCAGGG + Intergenic
1173524184 20:43719479-43719501 TGGCAGAGGGAGGCTGGGCGTGG + Intergenic
1173975382 20:47183043-47183065 CAGCAGGAGGAGGCAGCGCAGGG - Intronic
1174194082 20:48760637-48760659 CAGGAGAGGGAGGCTGGACTAGG + Intronic
1174562677 20:51442791-51442813 CCTGAGAGGGAGGCTGGGCATGG + Intronic
1175146058 20:56897345-56897367 CTGCAGAGGGGTGCTGTGCATGG + Intergenic
1175183379 20:57164070-57164092 CAGCAGAGAGAGCTTGTGCAGGG - Intergenic
1175293336 20:57892828-57892850 CAGTGGACGGAGGGTGTGCAGGG - Intergenic
1175415456 20:58797694-58797716 CTTCAGAGGGAGGCTCTTCATGG + Intergenic
1175478079 20:59291070-59291092 CATCAAAGGGAGGCTGTCCTGGG - Intergenic
1175619396 20:60430738-60430760 GAGAGGAGTGAGGCTGTGCAGGG - Intergenic
1175619510 20:60431501-60431523 CAGCCCAGGGAGGCAGGGCAGGG + Intergenic
1175709956 20:61211643-61211665 GAGCAGACTGAGGCTGTGAATGG + Intergenic
1176012621 20:62907594-62907616 GAGCAGAGGGCGGCAGTCCAGGG - Intronic
1176044515 20:63085424-63085446 CAGCAGAGGGAGGGAGGCCACGG + Intergenic
1176192443 20:63818427-63818449 CTGCAGAGGGAGGGTGGGCCAGG + Intronic
1177006731 21:15682556-15682578 CAGCAGAGGGAGGTTGTGGTCGG - Intergenic
1177621538 21:23601597-23601619 CAGCAGTGGGAAGATGTGCTGGG + Intergenic
1177803376 21:25849608-25849630 CAGGAGAGAGAGACGGTGCAGGG - Intergenic
1177959922 21:27650896-27650918 CAGCAAAGAGAGCATGTGCAAGG + Intergenic
1178919261 21:36728076-36728098 ATGCAGAGGGAGGCGCTGCAGGG + Intronic
1179008832 21:37537603-37537625 CAGCACAGGGCGGCTGCCCAGGG - Intergenic
1179532404 21:42028867-42028889 CAGCATAGGGAGGCTGGAGAGGG + Intergenic
1179915994 21:44478678-44478700 CAGCACAGGGAGGAAGTGCGTGG + Intergenic
1180200366 21:46220489-46220511 CAGGCGAAGGAGGCAGTGCATGG + Intronic
1180631374 22:17232491-17232513 GAGGAGCTGGAGGCTGTGCAGGG - Intergenic
1180762546 22:18221023-18221045 CAGCCCTGGAAGGCTGTGCATGG - Intergenic
1180773121 22:18403585-18403607 CAGCCCTGGAAGGCTGTGCATGG + Intergenic
1180804476 22:18653134-18653156 CAGCCCTGGAAGGCTGTGCATGG + Intergenic
1180806274 22:18716276-18716298 CAGCCCTGGAAGGCTGTGCATGG - Intergenic
1181217221 22:21342057-21342079 CAGCCCTGGAAGGCTGTGCATGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181715264 22:24722370-24722392 CAGCAGTGTGGGGCTGGGCACGG - Intronic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182043904 22:27259543-27259565 GAGGGGTGGGAGGCTGTGCAAGG - Intergenic
1182421124 22:30249054-30249076 CAGGAGGGGGAGGCTGGGCCTGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182656490 22:31894567-31894589 CAGAAAAGGGTGGCTGGGCACGG + Intronic
1182887806 22:33790190-33790212 CAGGAAAGAGAGGTTGTGCAGGG - Intronic
1182957271 22:34438349-34438371 GAGATGAGGGAGGCTGGGCATGG + Intergenic
1183097994 22:35565786-35565808 CACCACAGGGAGGCAATGCAGGG + Intergenic
1183181631 22:36264047-36264069 AAGCAGTGGGTGGCTGTGGAAGG + Intronic
1183455987 22:37923635-37923657 ATGCAGAGGGAGGCAGTGTAAGG - Intronic
1183695116 22:39417328-39417350 GAGCAAAGGGAGGCCGGGCATGG + Intronic
1184190579 22:42891912-42891934 CTGCAGAGGAAGGCAGTGCAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184368957 22:44070462-44070484 AAGGAGAGGGACGCTGTGCCTGG + Intronic
1184423997 22:44398428-44398450 CAGCTTATGGAGGCTGTGAAGGG + Intergenic
1184640138 22:45866387-45866409 GAGGAGAGGGAGGGTGGGCACGG - Intergenic
1184642628 22:45880472-45880494 CAGCAGACGGACCCTGGGCAGGG - Intergenic
1184853192 22:47132504-47132526 CAGCAGGGCGGGGCGGTGCAGGG - Intronic
1184889034 22:47368355-47368377 CAGAAGAGGGAGGCTCAGAAAGG + Intergenic
1185088760 22:48754700-48754722 CAGCTGAGGCAGGCTGTCCTGGG + Intronic
1203234953 22_KI270731v1_random:144567-144589 CAGCCCTGGAAGGCTGTGCATGG + Intergenic
949156784 3:837396-837418 CAGGAGAGAGAGGCAGTGAAGGG + Intergenic
949510644 3:4764028-4764050 CACCAGAAGGTGGCCGTGCAGGG - Intronic
949927759 3:9055554-9055576 CAGGGGAGGGAGGCTGGGCCTGG + Intronic
950117945 3:10463542-10463564 GAGCAAATGGAGGCTTTGCAAGG + Intronic
950477549 3:13223518-13223540 CATCAGAGGGAAGCTGGGAATGG + Intergenic
951127055 3:18996385-18996407 CAGCAGAGGGATCCTGGGCCTGG + Intergenic
951813490 3:26727375-26727397 AAGCGATGGGAGGCTGTGCACGG + Intergenic
952070749 3:29632834-29632856 AAGCAGAGGAAGGATCTGCAGGG - Intronic
953139450 3:40213929-40213951 CAGCTGAGGCAGTCAGTGCATGG - Intronic
953744986 3:45567240-45567262 CAGCAGAGGGAGGATCTGTGAGG + Intronic
953907271 3:46874651-46874673 CAGCAGCGGGAGCCCATGCAGGG + Intronic
954388182 3:50255277-50255299 CAGCAGAGGCAGGCCCTGCAGGG + Intronic
954396686 3:50296877-50296899 CAGCTGGGTGAGCCTGTGCAGGG - Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954430416 3:50467902-50467924 CAGGAGATGGAGGCTCAGCATGG - Intronic
954711726 3:52508203-52508225 GAGCAGAGGCAGCCTGGGCAGGG + Intronic
954714106 3:52518623-52518645 CCCCAGAGCGAGGCTGGGCAGGG + Intronic
955550470 3:60079467-60079489 GAGCAGAGGGAGGCTGCTTAAGG - Intronic
956051061 3:65248943-65248965 GAGCAGAGGGAGGGTGTTCAAGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956621515 3:71225871-71225893 CAGCAAAGAGAGACTGGGCACGG + Intronic
957063843 3:75504691-75504713 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
957523072 3:81345969-81345991 CAACAGTGGCAGGCTGGGCATGG + Intergenic
957759679 3:84539076-84539098 GAGCAGAGGGACACTGGGCAAGG - Intergenic
958157344 3:89771602-89771624 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
958736545 3:98016031-98016053 CAGGAGAGAGAGCATGTGCAGGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960679324 3:120230719-120230741 CAGGAGAGAGAGAGTGTGCAGGG + Intronic
960710480 3:120522616-120522638 CAGCTGAAGGTGGCTGGGCACGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961455060 3:127019941-127019963 CACCAGGGGCAGGCTGGGCAGGG - Intronic
961789397 3:129364964-129364986 CAGCACAGGGACCCTGGGCATGG + Intergenic
961793422 3:129392782-129392804 CTTCAGAGTGAGGCTGAGCATGG - Intergenic
961807419 3:129499400-129499422 CTTCAGAGTGAGGCTGAGCATGG - Intronic
961897577 3:130181327-130181349 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
962944255 3:140153162-140153184 GAGCTGAGAGAGGCTGTGCAGGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963525403 3:146409360-146409382 CTTCAGAGGGAGGCAGTACAGGG + Intronic
963710316 3:148739670-148739692 GTGCAAAGGGATGCTGTGCAAGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964030451 3:152132612-152132634 TAGCAGAGGATGGCTGGGCATGG - Intergenic
965518046 3:169643417-169643439 CAGCAGAAAGGGGATGTGCAAGG - Intronic
965637246 3:170795268-170795290 CAGCAGAGGGTGGGTGAGTAGGG - Intronic
965727268 3:171731489-171731511 AATGAGAGGGAGGCTGGGCACGG + Intronic
965795349 3:172433264-172433286 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
966059266 3:175734761-175734783 CAGCAGAGGGACCCTGGGCCTGG + Intronic
966716909 3:183021905-183021927 TAGCCGAGGCAGGCTTTGCATGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967423970 3:189304889-189304911 AAACAGAGGGAGGCTGTGAGTGG - Intronic
967529511 3:190532683-190532705 CAGCACAGGGAGGCAAAGCACGG - Intronic
967908170 3:194519116-194519138 CAAGAGAGGGAGGTTGTGCGGGG - Intergenic
967992505 3:195142083-195142105 CAGGGGAGAGAGGCTGTGGAGGG - Intronic
968403019 4:315062-315084 CAGCAGAGGGACGCTGGGCCTGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968764279 4:2459923-2459945 AAGCAGAGGGAAGGTGGGCAAGG + Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969007743 4:4034893-4034915 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
969275178 4:6129918-6129940 CAGGAGAAGGAGGCTGTTGAGGG - Intronic
969745870 4:9071169-9071191 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
970003812 4:11391438-11391460 CAGCAGAGGTAGGATGTGATTGG - Intergenic
970010576 4:11454582-11454604 CAGAAGAAGGAGGCTGGGCACGG + Intergenic
970231287 4:13913705-13913727 GGGCAGAGGGAGACTGTCCATGG - Intergenic
970357376 4:15269393-15269415 CAGCAGAGGGACCCTGGGCTTGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970411173 4:15809245-15809267 CAGCTGAGGGAGGTGGTGGAGGG + Intronic
971478891 4:27097081-27097103 CAGCAGAGAGAAGGTCTGCAGGG + Intergenic
971729638 4:30361050-30361072 CAGCAGTAGGAGGCTGTGGTGGG + Intergenic
971753285 4:30678187-30678209 CAGCAGAGGGAGCCTGGGCCCGG - Intergenic
972210381 4:36829684-36829706 CAGAAGGGGGAAGCTGTGGAAGG + Intergenic
972259816 4:37396740-37396762 AAGCAAAGCGAGGCTGGGCACGG + Intronic
972484796 4:39530871-39530893 CAGCAGAGGGATCCTGGGCCCGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973015768 4:45135117-45135139 CAGCAGAGGGAGCCTGGGCCTGG + Intergenic
973072841 4:45886364-45886386 CAAGAGAGAGAGCCTGTGCAGGG - Intergenic
973970722 4:56211591-56211613 CAGCGGAGAGGGGATGTGCAGGG + Intronic
974206078 4:58705088-58705110 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976581371 4:86740501-86740523 CAGCAGAGGGACCCTGGGCCCGG + Intronic
976607705 4:86997816-86997838 AAGCTGAGTGAGGCTGGGCATGG + Intronic
977403769 4:96569622-96569644 CAGCAGGGGCTGGCTCTGCATGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978915721 4:114124228-114124250 CAGCACAGGGACCCTGTGCCTGG + Intergenic
978939033 4:114415362-114415384 CAGCAGAGGGACCCTGGGCTGGG - Intergenic
979203085 4:118002672-118002694 AAGAAGAGGGAGAATGTGCATGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979426443 4:120572747-120572769 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
980988553 4:139718588-139718610 CAGCAGAGGGAAGCCGTCCCAGG + Exonic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982227005 4:153175482-153175504 CAGCGGGGGGAGGGGGTGCATGG + Intronic
982235325 4:153246818-153246840 CAGCAGATGGAATGTGTGCACGG - Intronic
982560918 4:156927183-156927205 CAGCAGAGAGACGCTGGGCCTGG + Intronic
983251144 4:165347866-165347888 CAGAAGAGGGATTCTGTGAAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983866368 4:172772067-172772089 AAGCAAAGAGAGGTTGTGCAGGG + Intronic
983976207 4:173937176-173937198 CAGTTCAGGGAGGGTGTGCAAGG - Intergenic
984252590 4:177352274-177352296 CAGCACAGCAAAGCTGTGCAAGG - Intronic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984910793 4:184672666-184672688 CAGCAGAGGATGGCTGTGGCTGG + Intronic
985245789 4:187978589-187978611 CACCTGAGGGAGGCTGTGAGTGG - Intergenic
985263823 4:188139814-188139836 CTGCAGAGCGAGGATGAGCAGGG + Exonic
987024265 5:13908361-13908383 AAGGAGAGGGAGGCAGTGGAAGG - Intronic
987511706 5:18847892-18847914 CAGCAGAGGGACCCTGCGCCAGG + Intergenic
987586570 5:19863788-19863810 CAACATAGGGAGGCTGTGAGAGG + Intronic
988242705 5:28634137-28634159 CTGCAGAATGAGGCAGTGCATGG + Intergenic
988636710 5:32992315-32992337 AAGCAAGGTGAGGCTGTGCAGGG + Intergenic
989503562 5:42198559-42198581 CATCAGATGGAGGCTGGGTATGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989651640 5:43696875-43696897 CAGCAGAGGGACTCTGGGCCTGG + Intronic
990301740 5:54455750-54455772 TGGCAGAAGGAGGCTGTTCAAGG + Exonic
990742570 5:58927115-58927137 GAGGAAAGGGAGGCTTTGCAAGG + Intergenic
991085785 5:62647260-62647282 GAGCAGAGGCAGGCTAAGCAGGG - Intergenic
991119462 5:62994361-62994383 CAGCAGAGGGATTCTGAGCCTGG + Intergenic
991221285 5:64222424-64222446 CAGCAAAGGGAGGGGGTACATGG + Intronic
991275665 5:64843897-64843919 CAGCAGTGGGAGGCAGGGCATGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991548479 5:67809974-67809996 CAGAAGATGGAGCCTGTGTAAGG - Intergenic
992565175 5:77988908-77988930 CCGGAGAGGGCGGCTGGGCATGG - Intergenic
992800651 5:80292763-80292785 CACCAGAGTGAGGCTGGGCGTGG - Intergenic
992868870 5:80985746-80985768 CAGCACAGGAAGGATGTGGAGGG + Intronic
992874255 5:81037053-81037075 CAGAAGAGAGAGCTTGTGCAAGG + Intronic
993890104 5:93463150-93463172 CAGCAGGGGGGCCCTGTGCATGG - Intergenic
993968990 5:94393958-94393980 CAGCTGAGGGAGGCTGAGACAGG - Intronic
994081392 5:95711685-95711707 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
994878108 5:105451069-105451091 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
995597547 5:113764104-113764126 TAGAAGAGGGAGGGTTTGCATGG + Intergenic
995755838 5:115503078-115503100 CAGAATAGGTAGGCTTTGCATGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
996214358 5:120848981-120849003 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
996222364 5:120949698-120949720 CAGCAGAGGGACTCTGGGCCTGG - Intergenic
996666917 5:126070783-126070805 AAGCAGTGGTAGGCTGGGCACGG + Intergenic
997274655 5:132574421-132574443 CAGCAGAGGGACCCTGGGCCTGG + Intronic
997519219 5:134511927-134511949 CAGCAGTGGGAGGCAGATCAAGG + Intergenic
997707307 5:135968612-135968634 GAGAAGAGAGAGCCTGTGCAGGG - Intergenic
997796642 5:136817383-136817405 CAGCAGAGAGAAGCTGATCAAGG + Intergenic
998069233 5:139183725-139183747 CGGCAAAGGCAGGCTGTGTATGG + Intronic
998225487 5:140323284-140323306 GAGCAGAGGGAGGCAGTGTCAGG + Intergenic
998385530 5:141755040-141755062 CAGCAGCTGGAGGATGTGCTGGG + Intergenic
998480580 5:142459448-142459470 CACAGGAGGGAGGCTGAGCAAGG - Intergenic
999197188 5:149790409-149790431 CTGCACAGGGAGGGTGTGCAGGG - Intronic
999312719 5:150562182-150562204 CAGCAGAGGGCTCCTCTGCATGG + Intergenic
999385029 5:151147987-151148009 CAGCAGAGGGAGGAAATGTAAGG - Intronic
999792094 5:154950143-154950165 CAGGAGAGAGAGACAGTGCAGGG + Intronic
999812339 5:155139643-155139665 AAGCAGAGGAAGGGTGAGCAGGG + Intergenic
1000029718 5:157391090-157391112 CAGGAGAGGGAGGCTGTGTCTGG + Intronic
1001619947 5:173075369-173075391 CAGCAGAGGTTGCCTATGCAAGG - Intronic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002063039 5:176637723-176637745 CAGCAGAGGGAGGGAGAGGAGGG + Intronic
1002934366 6:1659152-1659174 CTGTGGAGGGAGGCTGGGCAGGG + Intronic
1003460381 6:6323040-6323062 CAGTGGAGGGAGACTGGGCAGGG - Intergenic
1003861410 6:10325484-10325506 CAGCAGAAATAAGCTGTGCAAGG + Intergenic
1003964572 6:11240952-11240974 CAGGAGAGAGAGGCTTTGCCAGG - Intronic
1005738939 6:28773362-28773384 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1006132448 6:31877639-31877661 CACCAGAGTGAGGATGTACAGGG - Intronic
1007180558 6:39926436-39926458 GAGCAGCGGCAGGCTGTGGAAGG + Intronic
1007975664 6:46098809-46098831 CAGTGGAGGGAGGTTGTGCCTGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1011824092 6:91286364-91286386 CAGGAGAGAGAGGCTGAGTATGG + Intergenic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1012253666 6:97008177-97008199 CAGCAGAGGGAGGTTGTGGTGGG + Intronic
1012475791 6:99613789-99613811 GAGCAGAGGGAAGCCGCGCAGGG - Exonic
1012924148 6:105250796-105250818 CAGCAGAGGGAAAAAGTGCATGG + Intergenic
1013599983 6:111694613-111694635 CAGCACAGGTAGGCCCTGCAGGG - Exonic
1013938510 6:115630817-115630839 CAGCAGAGGAAGCCTGTGTATGG + Intergenic
1015679837 6:135793525-135793547 CAGGGGAAGGAGGCTGTCCAGGG + Intergenic
1016253183 6:142071765-142071787 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1017028151 6:150198448-150198470 TTGCTGAGGGAGGGTGTGCATGG + Intronic
1017238517 6:152141778-152141800 AAGCAGAGGTAGGCTGGGCACGG + Intronic
1017307454 6:152935682-152935704 CAGCACTGGGAGGCTGAGGAGGG - Intergenic
1017701485 6:157077415-157077437 TGGCAGAGGCAGGCTGCGCATGG - Intronic
1017721976 6:157249789-157249811 CAGGAGTGGGAGGATGTGGAGGG - Intergenic
1018367471 6:163136232-163136254 CATCAGAGAGAGGCAGAGCAGGG - Intronic
1018374213 6:163195686-163195708 CAGCACAGGGAGGCTGAGAGGGG - Intronic
1018806958 6:167269175-167269197 CGGAACAGGCAGGCTGTGCAGGG + Intergenic
1018906325 6:168078455-168078477 AAGCAGAGTGAGGCGGTCCAGGG + Intronic
1019267172 7:124392-124414 CAGCAGGGCCATGCTGTGCAGGG + Intergenic
1019352917 7:563329-563351 CTGCAGAGGCAGCCTGTGGAGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019919076 7:4151287-4151309 CTGCAGAGGGTGACTGTGCCAGG - Intronic
1019992924 7:4704670-4704692 CAGCAGCGTCAGGCTGTGCTCGG + Intronic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020328267 7:6993024-6993046 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1020543559 7:9493497-9493519 CAGTAGCGGGAGGCTGTGGGTGG + Intergenic
1021168974 7:17374779-17374801 CAGCTGAGGGACGCTGTCCAAGG + Intergenic
1021305096 7:19022561-19022583 CTGCAGAGGATGGCTGAGCACGG + Intronic
1021425508 7:20495526-20495548 CTGCACAGGGATACTGTGCACGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022103411 7:27182438-27182460 CAGTAGAGGGAGGGTGTGGTGGG + Exonic
1022785554 7:33634025-33634047 GACCAGCGGGAGGCTGTGCAGGG - Intergenic
1023029411 7:36079496-36079518 CAGCAGGTGCAGGCTGTGGAAGG + Intronic
1023124935 7:36946050-36946072 CAGCAGAGGTAGCCTGAGCTGGG + Intronic
1023776996 7:43617240-43617262 GAGCAATGGGAGGCTGTGGAAGG + Intronic
1024135843 7:46407072-46407094 AAACAGAGGGAGCCTGGGCAGGG + Intergenic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027121080 7:75520869-75520891 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1028670772 7:93397948-93397970 CAGCAAAGGCAGGCTATGCCAGG + Intergenic
1029111239 7:98213979-98214001 CAGCAGAAGGAAGCTGGGCTTGG - Intergenic
1029465193 7:100720850-100720872 GAGGAGAGGGCGGCTGTCCAGGG - Exonic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1032441956 7:131948728-131948750 CAGCAGGGTGTGGCTGTGCTAGG + Intergenic
1032582294 7:133114749-133114771 AAGCAGAGGGAAGGAGTGCAGGG + Intergenic
1032999501 7:137487990-137488012 CAGAACAGGGAGGCTGCTCATGG + Intronic
1033248377 7:139737600-139737622 TAGCAGAGGCCGGATGTGCAGGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033325117 7:140371285-140371307 CAGCTGAGGGAGGCTGAGGCAGG - Intronic
1034151002 7:148915293-148915315 AAGCAGTGGCAGGCTGGGCATGG - Intergenic
1034516963 7:151588687-151588709 AAGCAGAGAGAGCTTGTGCAGGG - Intronic
1034520570 7:151616214-151616236 CACCAGAGAGAGGCTCTGCTTGG + Intronic
1034878830 7:154748631-154748653 CTCCAGAGGCAGGCTGTGCAGGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034972990 7:155430772-155430794 CCGCACAGGAAGGCTGTGGAGGG + Intergenic
1034995948 7:155577441-155577463 CAGCATGACGAGGCTGTGCAGGG + Intergenic
1035024970 7:155819281-155819303 TTCCAGAGGGGGGCTGTGCAGGG + Intergenic
1035052260 7:156005641-156005663 CAGCAGAAGGAGGGTGTCCAGGG + Intergenic
1035275272 7:157744695-157744717 CAGAAGACGGAGGATGTGGAAGG + Intronic
1035635029 8:1138120-1138142 CAGCAGAGCGAGCCTGAGAATGG + Intergenic
1036368358 8:8141091-8141113 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1036544197 8:9750590-9750612 TTGCTGAGGGAGGCTGTGAATGG - Intronic
1036556053 8:9861592-9861614 CAGTAGATGGAGGGTGTGCATGG + Intergenic
1036882530 8:12524551-12524573 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1037832610 8:22198379-22198401 CAGCTGAGAGAGGCTGGGCCAGG - Intronic
1038326940 8:26578814-26578836 CAGCAGAGGGATGCTGAAAAGGG + Intronic
1038493977 8:27988983-27989005 CTTCAGAGGGAGGGTGGGCAAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038748918 8:30278341-30278363 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1038843119 8:31204531-31204553 CAGCAGAGAGAGGATGCCCAAGG + Intergenic
1039609062 8:38904485-38904507 CAGCAGAGAGCTGCTTTGCAAGG - Intronic
1040061062 8:43103138-43103160 CAGCAGAAGGAGGCTGCTTAGGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040520334 8:48170991-48171013 CAGCAGCAGGAGGATGTGCTGGG - Intergenic
1040561321 8:48525526-48525548 CATCTGAGGTGGGCTGTGCAAGG - Intergenic
1040582037 8:48705952-48705974 CCGCAGAGGGATGCTGAGGAAGG + Intergenic
1040627334 8:49163909-49163931 CAGCCAAGGCAGGCCGTGCATGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042680358 8:71376881-71376903 CTGCGGAGGGAGCCTGGGCAGGG - Intergenic
1042759312 8:72253403-72253425 CAGGGGAGGGAGGCGGTGCAGGG + Intergenic
1043124143 8:76367245-76367267 CAGAAAAGTGAGGCTGGGCACGG - Intergenic
1044278497 8:90329488-90329510 GAGCAGAGGAAGGCCGAGCACGG - Intergenic
1044942119 8:97354060-97354082 CAGCAGAGGGTGGGTGTGAAGGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045649390 8:104328248-104328270 CAGAAGAGGGAGGCATTGAAGGG + Intergenic
1045871425 8:106931945-106931967 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1046470152 8:114661981-114662003 CTGCAGAGGGAGGACATGCAAGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047205728 8:122801960-122801982 CAGCCGTGGGTGGCTGGGCAGGG - Intronic
1047384880 8:124399663-124399685 CAGAAAAGGGAGGCTGGGAAAGG + Intergenic
1048037717 8:130693275-130693297 CAGCAGAGGAAGACTGTCAAGGG - Intergenic
1048085821 8:131178338-131178360 AAGTAGAAGGAGGCTGGGCACGG + Intergenic
1048120587 8:131576670-131576692 CACCAGTGTGAGGTTGTGCAGGG + Intergenic
1048292597 8:133192023-133192045 AGGCAGAGGCAGGCAGTGCAAGG + Intronic
1048318159 8:133377201-133377223 CTGCAAAGTCAGGCTGTGCAAGG + Intergenic
1048414208 8:134208259-134208281 CAGGAGAGGATGGCTGTCCAGGG - Intergenic
1048566236 8:135600757-135600779 CTGCAGACCAAGGCTGTGCAGGG - Intronic
1049042885 8:140125505-140125527 CAGCAAGGGGAAGGTGTGCAGGG + Intronic
1049062581 8:140287369-140287391 AAGCAGAGGGAGGAGGGGCATGG + Intronic
1049237500 8:141519408-141519430 CTGCAGAGGGAGGTGGTCCAGGG - Intergenic
1049421127 8:142517156-142517178 CAGGAAAGGGAGGCTGGCCAGGG + Intronic
1049621158 8:143598865-143598887 CAGCAGCGGGCGGCTGAGCCAGG - Exonic
1049800650 8:144516084-144516106 CAGCCGAGGGAAGATGTGCAGGG + Exonic
1050155973 9:2666796-2666818 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1050277729 9:4017588-4017610 GATCAGAGAGAGGCTGTGAAAGG + Intronic
1050426396 9:5516652-5516674 GCACAGAGGGAGGCTGAGCAGGG - Intronic
1050472649 9:6008294-6008316 GGGCAGAAGGAGGCGGTGCACGG + Intergenic
1050533688 9:6612441-6612463 AAGTAGATGGAGGCTGGGCATGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051595260 9:18818677-18818699 CAGCTGAGGGAGGCTGAGATGGG + Intronic
1052156833 9:25202807-25202829 CAGCAGATGGAGCCTGGGCCTGG + Intergenic
1052599090 9:30600623-30600645 GAGCAGAGGGACCCTGGGCATGG + Intergenic
1052701304 9:31941257-31941279 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1053200661 9:36149585-36149607 CTCCCGAGGGAGGCTGTGCGAGG - Intronic
1053218883 9:36294929-36294951 GAGCAGCTGGAGGCTGGGCATGG + Intronic
1054749012 9:68885679-68885701 TAGAAGAGGGAGGGTGGGCAGGG + Intronic
1054800889 9:69347207-69347229 CAGCAGAAGGAGGCTGGGCCTGG + Intronic
1055167863 9:73219098-73219120 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1056447392 9:86679020-86679042 CAACAGAGGTGGGCTCTGCATGG - Intergenic
1056692386 9:88818909-88818931 CCACGGAGGGAGGCTGTCCAAGG + Intergenic
1057034151 9:91799572-91799594 TGGCAGAGGCAGGCTCTGCATGG - Intronic
1057115550 9:92517788-92517810 GAGCAGAGGCAGGTAGTGCAGGG + Exonic
1057164528 9:92915188-92915210 CTGTGGAGGGAGGGTGTGCAAGG + Intergenic
1057510864 9:95678613-95678635 CATGGGAGGGAGGCTGAGCAGGG - Intergenic
1057842399 9:98496530-98496552 AAGCAGAGGGTGGGTGTGCTGGG + Intronic
1058119157 9:101119417-101119439 CAGCAGAGGGCTGCAGAGCATGG + Intronic
1059467942 9:114481229-114481251 CAGCAGAGGAAGGGTGAGCCAGG + Intronic
1061440969 9:130603054-130603076 CAGTGAAGGGAGGCTGGGCATGG + Intronic
1061489335 9:130936558-130936580 CAGCAGAGGAAGGCGGGGCCCGG + Intronic
1061541028 9:131277864-131277886 CAGCAGAGCGAGGCAGCGCGGGG - Intergenic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1061993298 9:134171858-134171880 CAGCTCAGGGAGGCCCTGCAAGG + Intergenic
1062068575 9:134542202-134542224 CAAGAGAGAGAGCCTGTGCAGGG + Intergenic
1062103873 9:134742146-134742168 GAGCAGCGGGAGAGTGTGCAGGG - Intronic
1062331749 9:136047958-136047980 GAGCAGCAGGGGGCTGTGCAGGG + Intronic
1062342249 9:136098949-136098971 CAGCCGAGAGAGCCTGTGCTGGG - Intergenic
1062381852 9:136290559-136290581 CAGCAGAGGGAGGCCGTCCTCGG - Exonic
1062523621 9:136969681-136969703 GGGCAGAGGGAGGCTGGGCTGGG - Intronic
1062525690 9:136977247-136977269 CAGCAGGAGGAGGGTGGGCAAGG + Intergenic
1062596765 9:137303019-137303041 CAGCAGAGGGAGGCAGGCCGCGG - Intergenic
1185513084 X:677614-677636 CAGCAGTGGGAGGCTGCCCTGGG - Intergenic
1186361965 X:8851788-8851810 AACCAGAGGGAGGCCGGGCATGG + Intergenic
1186638125 X:11427739-11427761 CGGCAGCGGGACGCTGTGCCAGG - Intronic
1186822333 X:13303400-13303422 CAAGAGAGGGAGCTTGTGCAGGG + Intergenic
1187378924 X:18782820-18782842 AGGCAGAGGGAGGCTGAGCACGG + Intronic
1188305575 X:28557258-28557280 CAGAAGAGAGAGGGCGTGCAGGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188951116 X:36376438-36376460 CAGGAGAGTGAGGCTGCTCAAGG - Intronic
1188997573 X:36904750-36904772 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
1189196455 X:39157815-39157837 GGGCAGAGGGAGGAGGTGCAGGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190023767 X:46903665-46903687 CAGCAGAGTGAGACTGAGTAGGG + Intergenic
1190322619 X:49187573-49187595 CAGTAGTGGGAGGGTGAGCAGGG + Intergenic
1190540237 X:51469741-51469763 TAGGAGTGGGAGGCTTTGCAAGG + Intergenic
1190984602 X:55489313-55489335 CACCAAAGCGAGGCTGCGCAGGG - Intergenic
1191673334 X:63769626-63769648 CAGCAGAGGGACCCTGGGCCCGG - Intronic
1193305407 X:79944763-79944785 CAGTGGCAGGAGGCTGTGCATGG + Intergenic
1195504525 X:105642137-105642159 CAGGAGTGGGGGGCTGTGCAGGG - Intronic
1195596149 X:106692564-106692586 CAGCAGAGGGAAGGAGTTCAGGG - Intergenic
1199020284 X:142870430-142870452 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
1200161584 X:154012548-154012570 CAGCAGCTGCAGGCTGTCCAGGG + Exonic
1201514677 Y:14806327-14806349 CAGCACATGGAGGCTATGTATGG - Intronic
1201557505 Y:15279407-15279429 CAGGAAAGAGAGGTTGTGCAGGG + Intergenic